ID: 1186472651

View in Genome Browser
Species Human (GRCh38)
Location X:9833497-9833519
Sequence TAGGAGGTCCGATGCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472651_1186472661 30 Left 1186472651 X:9833497-9833519 CCACCCCTGCATCGGACCTCCTA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472651_1186472660 13 Left 1186472651 X:9833497-9833519 CCACCCCTGCATCGGACCTCCTA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472651 Original CRISPR TAGGAGGTCCGATGCAGGGG TGG (reversed) Intronic
900168757 1:1255898-1255920 CAGGAGCCCCGAGGCAGGGGAGG - Intronic
900411473 1:2514601-2514623 TAGGAGGCCTGGTGCAGGGTGGG + Intronic
901839596 1:11945490-11945512 TGGGAGGTCCCTTGCATGGGAGG + Intronic
901879732 1:12186735-12186757 TAGGAGGTCAGAGCCAGGGCTGG - Intronic
906002680 1:42440512-42440534 CAGGGGGTCCAATGCAAGGGAGG + Intronic
906293068 1:44632250-44632272 TCGGGGGTCCGGTGCTGGGGCGG + Intronic
906819858 1:48918181-48918203 AAGCAGGTCCACTGCAGGGGTGG + Intronic
909911038 1:81258205-81258227 TAGGAAGACTGAGGCAGGGGAGG + Intergenic
910228759 1:84964684-84964706 TAGAAGGTCCCATCTAGGGGTGG + Intronic
914304451 1:146403985-146404007 TAGGAGCTCCCAAGCAGGAGAGG + Intergenic
915937211 1:160096572-160096594 TAGGAGCCCAGAAGCAGGGGTGG - Intronic
918407235 1:184223201-184223223 TAGAAGGTCCCATCTAGGGGTGG + Intergenic
923022610 1:230176462-230176484 TAGAAGGCCAGATGCTGGGGTGG + Intronic
1064080530 10:12304439-12304461 AAGGAGGTCTGATGCAGAGCCGG - Intergenic
1069883564 10:71609235-71609257 TAGAAGGTCTGATGTTGGGGCGG - Intronic
1076133849 10:128031251-128031273 TTGGAGGTCTGATCCAGGGTGGG + Intronic
1079091842 11:17486186-17486208 TAGGAAGGGGGATGCAGGGGAGG - Intergenic
1085680939 11:78574541-78574563 AAGGAGGGCCGCTGCAGGCGGGG - Exonic
1089620461 11:119719268-119719290 AAGAAGGTGCTATGCAGGGGTGG + Intronic
1091238499 11:134037155-134037177 GAGGAGGGGCGGTGCAGGGGCGG + Intergenic
1100959693 12:99948681-99948703 AAGGAGGTGCGATGTTGGGGAGG - Intronic
1117255395 14:53971957-53971979 TAAGAGGTCTGCTGCAGGGCTGG - Intergenic
1119750865 14:77076475-77076497 TAGGAGGTCAGGGGCGGGGGAGG - Intergenic
1120330868 14:83091764-83091786 TAGGAGGTGTGATGAAGGGAAGG - Intergenic
1124466063 15:29941134-29941156 TAGGAGGTCATTTGCAGAGGTGG - Intronic
1130275644 15:82474997-82475019 TGGCAGGTCCCATGCATGGGTGG - Intergenic
1130468004 15:84202389-84202411 TGGCAGGTCCCATGCATGGGTGG - Intergenic
1130496262 15:84471153-84471175 TGGCAGGTCCCATGCATGGGTGG + Intergenic
1130590296 15:85206987-85207009 TGGCAGGTCCCATGCATGGGTGG - Intergenic
1132645389 16:997132-997154 GAGGAAGCCCCATGCAGGGGTGG - Intergenic
1132830637 16:1926434-1926456 TAAGAGGGGCGAGGCAGGGGTGG - Intergenic
1135679253 16:24442759-24442781 TAGATGGTCCCATTCAGGGGTGG + Intergenic
1136372958 16:29847647-29847669 AGGGTGGTCAGATGCAGGGGAGG + Intronic
1137057734 16:35753526-35753548 AAGGAGGTCCCAGGCAGTGGCGG - Intergenic
1137435852 16:48453721-48453743 TGGAAGGTCTGAGGCAGGGGAGG - Intergenic
1137709340 16:50555498-50555520 GAGGAGGTCAGCTGCAGGGCTGG + Intronic
1147722960 17:42550022-42550044 GTGGAGGTCTGGTGCAGGGGAGG + Exonic
1147724172 17:42556249-42556271 GTGGAGGTCTGGTGCAGGGGAGG + Intergenic
1148186959 17:45651161-45651183 GAGAAGGCCCGATCCAGGGGAGG - Intergenic
1166803136 19:45470138-45470160 CGCGAGGTCCCATGCAGGGGCGG - Intronic
932103791 2:68924711-68924733 TAGGAGGTTGGATGCAGAGGTGG - Intergenic
935605584 2:104969607-104969629 CAGCAGGTCCGAGGCAGGAGAGG - Intergenic
936224738 2:110638219-110638241 GTGGAAGTCAGATGCAGGGGTGG - Intronic
941828568 2:169927666-169927688 TAGGAGGTTAAATGCTGGGGTGG - Intronic
948181221 2:235982428-235982450 TAGGAGGTCAGAAGGAAGGGGGG + Intronic
1170891392 20:20379007-20379029 TAGGAGGCCCGAAGCATGGCTGG - Intergenic
1172759952 20:37314836-37314858 GAGGAGGGCCCATGCAGGGAAGG - Intronic
1173334548 20:42101998-42102020 TAGTAGATCAGAAGCAGGGGGGG + Intronic
1175853259 20:62104913-62104935 GAGGAGGTGGGAGGCAGGGGAGG + Intergenic
1178427757 21:32492375-32492397 TGGGAGGAGAGATGCAGGGGAGG + Intronic
1181977684 22:26742606-26742628 TTGGGGGGCCGAGGCAGGGGCGG + Intergenic
1183424709 22:37733295-37733317 TAGGAAGTCCGAGGCAGCGGGGG + Exonic
951835032 3:26973645-26973667 AAGGAGATCTGATGCTGGGGAGG - Intergenic
966520615 3:180869915-180869937 TAGCAGGTCTGAACCAGGGGAGG - Intronic
968432393 4:566672-566694 CAGGGGGTGGGATGCAGGGGTGG - Intergenic
968432420 4:566739-566761 AAGGGGGTGGGATGCAGGGGTGG - Intergenic
968432441 4:566792-566814 CAGGTGGTGGGATGCAGGGGTGG - Intergenic
968432481 4:566916-566938 CAGGTGGTTAGATGCAGGGGTGG - Intergenic
970295694 4:14627074-14627096 TGGTAGGTCTGATGAAGGGGTGG - Intergenic
971178448 4:24304596-24304618 TTGGAGGTCTGATGGAGAGGTGG - Intergenic
971257482 4:25028620-25028642 TAGGAAGTGCCATGCAGGGTGGG + Intronic
981847746 4:149188879-149188901 TAGGAGGTCGGCGGCGGGGGTGG - Intergenic
986949930 5:13070853-13070875 TAGGAAGTCTGCTGCAGGGGCGG - Intergenic
991098722 5:62767942-62767964 TAGGAGGTAGGATCCATGGGAGG + Intergenic
991372703 5:65936146-65936168 AGGGAGGTCTGATGGAGGGGGGG + Intronic
992954216 5:81891057-81891079 GAAGAGGTCTGCTGCAGGGGTGG + Intergenic
997286258 5:132680868-132680890 TAGGGGGTAAGATACAGGGGAGG + Intronic
998349589 5:141492044-141492066 TAGGAGGCTGGCTGCAGGGGTGG - Intronic
999701263 5:154230652-154230674 TAGGTGGTCCTATGCAAGAGAGG - Intronic
1002339931 5:178509181-178509203 CCGGAGGTCCGATGCCGGTGGGG - Intronic
1006618076 6:35343053-35343075 GAAGAGGTCAGAGGCAGGGGAGG - Intronic
1007655071 6:43446778-43446800 CAGGAGGCCAGATGCAGGGCAGG - Intronic
1017966051 6:159267265-159267287 TAGGAATTCTGAAGCAGGGGAGG - Intronic
1020361520 7:7331588-7331610 AAGGAGGTGAGAGGCAGGGGAGG + Intergenic
1021764434 7:23932646-23932668 TAGGAAGGCAGATGCAAGGGAGG + Intergenic
1032795916 7:135276126-135276148 TTGGAGCTCAGATGCAGGGCTGG + Intergenic
1036653575 8:10661473-10661495 TGGGAGGTCAGAGGCTGGGGAGG - Intronic
1038330024 8:26600923-26600945 TAGGTGGTTCCATGCTGGGGAGG + Intronic
1038492929 8:27982923-27982945 CAGCAGGTCCGGTGCAGGAGTGG + Intronic
1042204310 8:66313044-66313066 TAGAAGGTCCACTGTAGGGGTGG + Intergenic
1050470925 9:5989339-5989361 TGGGAGGACCGATGCTTGGGAGG + Intronic
1052169581 9:25377078-25377100 TCGGGAGTCCCATGCAGGGGTGG - Intergenic
1057214026 9:93218396-93218418 GATGTGGTCAGATGCAGGGGTGG + Intronic
1057295207 9:93830592-93830614 TAGGAGGCACGTTGCAGGGATGG + Intergenic
1060951728 9:127608325-127608347 CAGGAGGTCCGGTGGAGGGGTGG + Intergenic
1062265011 9:135683041-135683063 TGGGAGGCCTGAGGCAGGGGCGG + Intergenic
1186472651 X:9833497-9833519 TAGGAGGTCCGATGCAGGGGTGG - Intronic
1186670938 X:11766670-11766692 TAGGAAGTCAGCAGCAGGGGAGG + Intronic
1187370450 X:18701377-18701399 TAGGAGGGGCCATGCATGGGTGG - Intronic
1189463116 X:41258503-41258525 TGGGAGGTCCGAGGCTGGGAAGG + Intergenic
1191815538 X:65240925-65240947 TAGGAGCTCTGACCCAGGGGAGG + Intergenic
1197190612 X:123643249-123643271 AAGGAGGTTGGATGCAGGGAGGG + Intronic
1198618419 X:138481951-138481973 TAGGAGTTCCTGGGCAGGGGTGG + Intergenic
1199139240 X:144290161-144290183 GAAGAAGTCTGATGCAGGGGTGG + Intergenic