ID: 1186472652

View in Genome Browser
Species Human (GRCh38)
Location X:9833500-9833522
Sequence AATTAGGAGGTCCGATGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472652_1186472660 10 Left 1186472652 X:9833500-9833522 CCCCTGCATCGGACCTCCTAATT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472652_1186472661 27 Left 1186472652 X:9833500-9833522 CCCCTGCATCGGACCTCCTAATT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472652 Original CRISPR AATTAGGAGGTCCGATGCAG GGG (reversed) Intronic
901245252 1:7725334-7725356 AATAAAGAGGTCAGATGCAATGG + Intronic
902445431 1:16460488-16460510 AATTAAGAGGCCGGGTGCAGTGG + Intergenic
903994243 1:27295739-27295761 AAATAGAAGGTCAGGTGCAGTGG - Intronic
904245532 1:29185205-29185227 AAATAGGAGGTTGGGTGCAGTGG - Intergenic
906082814 1:43104936-43104958 AATTCAGAGGTCTGGTGCAGTGG - Intergenic
909920266 1:81373076-81373098 AATTTGGGGGTCACATGCAGAGG + Intronic
910883467 1:91942819-91942841 AATTAGGAGGCTGGGTGCAGTGG - Intergenic
915559688 1:156679424-156679446 AAGAAGGAGGTCGGGTGCAGTGG - Intergenic
915918069 1:159953081-159953103 AAGGAGGCTGTCCGATGCAGTGG - Intronic
916072574 1:161179247-161179269 AATTAAGAGGCCTGATGCTGTGG - Intergenic
916761991 1:167825361-167825383 AATTTGGAGGTCAGGTGCAGTGG + Intronic
917748675 1:178035542-178035564 AGTAAGGAGGCCGGATGCAGTGG - Intergenic
922126973 1:222737346-222737368 AAACAGGAGGTAAGATGCAGAGG + Intronic
923936879 1:238771228-238771250 AATGAGGAGGCCGGGTGCAGTGG - Intergenic
1063354849 10:5388437-5388459 GTTTAGAAGGTCGGATGCAGTGG + Intergenic
1064218270 10:13418336-13418358 AACTAGATGGTCCCATGCAGGGG - Intergenic
1064555386 10:16542197-16542219 AATTTGGAGGCCAGATGCAGTGG - Intergenic
1064686357 10:17866436-17866458 AATTATGATCTCAGATGCAGGGG - Intronic
1065428700 10:25631811-25631833 AACAAGGAGGTCAGATACAGGGG - Intergenic
1066374501 10:34845273-34845295 AATGAGCAGGCCAGATGCAGTGG + Intergenic
1070450525 10:76552969-76552991 AATTAGGATGTCCATTCCAGAGG + Intronic
1070683057 10:78462553-78462575 ACTGAGGAGGTAAGATGCAGAGG - Intergenic
1070805791 10:79270010-79270032 AATGAGGAGGTGAGAGGCAGAGG - Intronic
1075044552 10:119135886-119135908 AATTATCAGGCCAGATGCAGTGG + Intronic
1075145745 10:119881674-119881696 CATTAGGGGGTCAGGTGCAGTGG - Intronic
1075490698 10:122866187-122866209 AAAAAGGAGGTCGGGTGCAGTGG - Intronic
1079061044 11:17249124-17249146 AATTAGGAGGTCTGTTGGAGGGG - Intronic
1084975241 11:72793560-72793582 AATTAGGAGAGGCGATGAAGAGG + Exonic
1085339093 11:75719715-75719737 AATTAGGCGGCCTGGTGCAGTGG + Intronic
1086228011 11:84535757-84535779 GATTAAGAGGTCAGATGTAGAGG - Intronic
1087858932 11:103129393-103129415 AATTAGGAGGCTGGGTGCAGTGG + Intronic
1088262149 11:107954411-107954433 AATTAGGAGGTCTGAGGAAGAGG - Intronic
1089620460 11:119719265-119719287 AATAAGAAGGTGCTATGCAGGGG + Intronic
1092955222 12:13543281-13543303 AATTAGGAGGTGGGTTGGAGAGG - Exonic
1093483799 12:19631313-19631335 AATTAGGGGGCCGGGTGCAGTGG - Intronic
1094355514 12:29573683-29573705 CAGCAGGAGGTCCTATGCAGAGG + Intronic
1095413584 12:41950384-41950406 AATTTGGAGGCCAGGTGCAGTGG - Intergenic
1097794994 12:63851852-63851874 AACAAGGAGGCCAGATGCAGTGG - Intronic
1099093087 12:78338373-78338395 AGTTAGGAGGCCAGGTGCAGTGG + Intergenic
1099688622 12:85922052-85922074 AATTAGGAGGTCCTATGACATGG - Intergenic
1099844637 12:88014196-88014218 GATCAGGAGGTCTGATGCATGGG + Intronic
1102958281 12:117073934-117073956 AATTAACAGGTCTGGTGCAGCGG + Intronic
1103104025 12:118206880-118206902 AATGAGGAGGCCGGGTGCAGTGG - Intronic
1103301353 12:119929838-119929860 AATTTGGAGGCCGGATGCGGTGG - Intergenic
1110212813 13:72993044-72993066 AATCAGTAGGCCAGATGCAGTGG + Intronic
1110625498 13:77651040-77651062 ATTTAGGAGGTCAGGGGCAGGGG + Intergenic
1115467914 14:33736428-33736450 CTTTAGCAGGTGCGATGCAGAGG + Intronic
1116003892 14:39272064-39272086 AATTAGGAGGCCGGGTGCGGTGG + Intronic
1116746412 14:48824900-48824922 AAGTAGAAGGCCAGATGCAGTGG + Intergenic
1117590426 14:57262783-57262805 AATTAGAAGGACCCTTGCAGGGG - Intronic
1120544129 14:85789361-85789383 AAATAGGAAGTCCCATGGAGAGG - Intergenic
1122091057 14:99340893-99340915 AATTAGGAGGTGGGCTCCAGGGG - Intergenic
1122757047 14:103989932-103989954 AATAAGGAGATCTGATGGAGAGG - Intronic
1124381362 15:29170061-29170083 ACTTTGGAGGGCCGAGGCAGGGG + Intronic
1126648551 15:50898831-50898853 AAATAGGGGGCCAGATGCAGTGG - Intergenic
1128543966 15:68555161-68555183 AATGAGGAGGTGTGATGCTGTGG + Intergenic
1130722493 15:86402965-86402987 AATCAGGAGGACTGATCCAGCGG + Intronic
1133000165 16:2846475-2846497 AGTTAGGAGGTCCCAGGCATAGG + Intergenic
1136658177 16:31726471-31726493 AATTTGGAGGCCAGATGCAGTGG + Intronic
1137015772 16:35373063-35373085 AATAAGGAGGCCAGGTGCAGTGG + Intergenic
1137057735 16:35753529-35753551 AACAAGGAGGTCCCAGGCAGTGG - Intergenic
1138344214 16:56310022-56310044 AAATATTAGGTCAGATGCAGTGG + Intronic
1139043648 16:63030722-63030744 AATGAAGAAGTCTGATGCAGAGG + Intergenic
1139570705 16:67810152-67810174 AATTCGAAGGTCCCTTGCAGAGG - Intronic
1142381750 16:89736616-89736638 AATTTGGGGGGCCGGTGCAGTGG - Intronic
1146189709 17:30753965-30753987 ATTTAATAGGTCGGATGCAGTGG - Intergenic
1146334610 17:31958321-31958343 ATTTAATAGGTCGGATGCAGTGG - Intronic
1147846328 17:43406651-43406673 AATAAGGAGGCCAGGTGCAGTGG - Intergenic
1152474171 17:80507046-80507068 AATTCAGAGGTCGGGTGCAGTGG + Intergenic
1153799033 18:8652347-8652369 AATAAGGAGGCCAGTTGCAGTGG + Intergenic
1154929575 18:20978786-20978808 AATTAGGAGGTGGGATATAGTGG + Intronic
1162319268 19:9961108-9961130 ATTTGGGAGGTCAGATGGAGTGG - Intronic
1164696044 19:30245142-30245164 GATGAGGGGGTCCCATGCAGAGG - Intronic
1165598305 19:37030446-37030468 AAATAGAAGGCCGGATGCAGTGG - Intronic
1167222285 19:48208021-48208043 AAATAGAAGGCCGGATGCAGTGG - Intronic
929623726 2:43384850-43384872 AATTTGGAGGCCAGGTGCAGTGG + Intronic
930074610 2:47396529-47396551 AATAAAGAGGCCAGATGCAGTGG + Intergenic
930782660 2:55238302-55238324 AATAATGAGGTCAGGTGCAGTGG - Intronic
933400290 2:81787776-81787798 AATGAGGAGGTCTGATTCAGGGG + Intergenic
935117381 2:100147970-100147992 ACTTTGGAAGTCCGAGGCAGGGG + Intergenic
936518676 2:113198531-113198553 AATTTGGAGGCCCGGTGCGGTGG - Intronic
937106406 2:119318810-119318832 AATTACAAGGCCAGATGCAGTGG - Intronic
938024897 2:127939118-127939140 AATCAGTAGGTCAGGTGCAGTGG + Intergenic
938913244 2:135905566-135905588 AAATAAGAGGTCAGGTGCAGCGG + Intergenic
946029847 2:216695133-216695155 AATAATGAGATCGGATGCAGTGG + Exonic
1168821986 20:780353-780375 AATTTCGAGGCCGGATGCAGTGG + Intergenic
1169459070 20:5778913-5778935 AGTTAGGAGGCCAGATGCAGTGG + Intronic
1171064114 20:21996025-21996047 AATTAGGTGGTCAGCTGCGGTGG - Intergenic
1171944796 20:31367107-31367129 AATTTGGAGGCCAGGTGCAGTGG + Intergenic
1172595268 20:36146857-36146879 AAAAAGGAGGTCAGGTGCAGTGG + Intronic
1173645487 20:44630733-44630755 AAATAGGAGGCCGGGTGCAGTGG + Intronic
1176876962 21:14139940-14139962 AATTGGGAGGTATGAGGCAGTGG + Intronic
1178533667 21:33395249-33395271 ACTTTGGAGGGCCGAGGCAGTGG - Intergenic
1178853459 21:36232129-36232151 AATTAGGGGGCCAGGTGCAGTGG - Intronic
1181426344 22:22843561-22843583 AATTGGGAGGCCGGGTGCAGTGG + Intronic
1182439129 22:30351783-30351805 AATGAGGAGGTCAGGTGCTGTGG - Intronic
1183555975 22:38527490-38527512 AAAAAGGAGGTCCAGTGCAGTGG - Intronic
1185198339 22:49486610-49486632 AATTAGGGAGGCCGAGGCAGTGG + Intronic
1185300987 22:50081054-50081076 AAAGAGGAGGTCTGGTGCAGTGG + Intronic
949804952 3:7944536-7944558 AATTACCAGGTCAGGTGCAGTGG - Intergenic
952119903 3:30229815-30229837 AATTATTAGGCCCGGTGCAGTGG - Intergenic
952311344 3:32193135-32193157 AATTAGGACTTCAGATCCAGGGG - Intergenic
958959321 3:100494017-100494039 AATTATAAGGTCGGGTGCAGTGG - Intronic
961315548 3:126032985-126033007 AGTTAGGAGGCCCAAGGCAGGGG - Intronic
963206763 3:142644113-142644135 AAAGAAGAGGTCAGATGCAGTGG - Intronic
963578366 3:147092791-147092813 AATTTGGAGGCCAGGTGCAGTGG + Intergenic
966690575 3:182737552-182737574 AATTAGGAGGCTGGGTGCAGAGG + Intergenic
966972430 3:185057417-185057439 AAATTGGAGGTCAGGTGCAGTGG + Intergenic
968244023 3:197123966-197123988 AATAAAGAGGTCAGGTGCAGTGG + Intronic
970044283 4:11832658-11832680 AATTAGGAGAGCAGATGCAGGGG + Intergenic
971178449 4:24304599-24304621 AATTTGGAGGTCTGATGGAGAGG - Intergenic
971869919 4:32221171-32221193 AATAAGGAGGCCGGGTGCAGTGG - Intergenic
975183689 4:71376488-71376510 TTTTAGGAGGCCAGATGCAGTGG - Intronic
979449917 4:120858649-120858671 AATTAGCAGGTGGGAGGCAGAGG - Intronic
981847747 4:149188882-149188904 AATTAGGAGGTCGGCGGCGGGGG - Intergenic
981981986 4:150804823-150804845 AGTTATGAGGTCAGGTGCAGTGG + Intronic
985274085 4:188220679-188220701 AATGAGGAGGCCGGGTGCAGCGG + Intergenic
993312755 5:86356745-86356767 AATTAGGTGGTTGGATGCAGTGG - Intergenic
994993884 5:107034840-107034862 AATTTGGAGGTCCCACCCAGAGG + Intergenic
997553146 5:134771335-134771357 ACTTTGGGGGTCCGAGGCAGGGG - Intronic
1004579634 6:16937393-16937415 ATTGAAGAGGTCAGATGCAGGGG + Intergenic
1004956697 6:20735155-20735177 AAAGAGAAGGTCGGATGCAGTGG - Intronic
1007508068 6:42352280-42352302 AATTATGAGGCTGGATGCAGTGG - Intronic
1008502694 6:52199459-52199481 CATTAGGAGGCCAGGTGCAGTGG + Intergenic
1011468642 6:87685925-87685947 AATTAGGAGGCCAGATGCAGTGG + Intronic
1011679587 6:89770116-89770138 AATTAAGAGGCCGGGTGCAGTGG + Intronic
1012403851 6:98870792-98870814 TATAGGGAGGTCAGATGCAGTGG + Exonic
1019095970 6:169579418-169579440 AATTAGGGGGTCTGAGGCAGGGG + Intronic
1026062961 7:67042707-67042729 TATTAGGAGGCCGGGTGCAGTGG + Intronic
1028106182 7:86881641-86881663 AATTAGGTGGTCGGGCGCAGTGG - Intronic
1028549594 7:92045152-92045174 AATTTGGAGGTCAGAAGCAGAGG + Exonic
1030036619 7:105413198-105413220 AATTCAGAGGTCGGGTGCAGTGG + Intergenic
1030604544 7:111625631-111625653 AATTATGAGGCCAGGTGCAGTGG - Intergenic
1032122729 7:129168734-129168756 AATACTGAGCTCCGATGCAGGGG - Exonic
1033090553 7:138381598-138381620 TAGAAGGAGGTCAGATGCAGTGG + Intergenic
1037954602 8:23044926-23044948 AATGAGGAGGCCAGGTGCAGTGG + Intronic
1038387662 8:27164661-27164683 AAATAGGTGATCCAATGCAGGGG + Intergenic
1042825061 8:72971807-72971829 AATGAGTAGGCCAGATGCAGTGG + Intergenic
1042905043 8:73764071-73764093 AATTACCAGGTCAGGTGCAGTGG + Intronic
1043141862 8:76600580-76600602 ATTTAGAAGGTCCGATGTGGGGG + Intergenic
1046026172 8:108726879-108726901 AATTAGGGGGGCTGGTGCAGGGG + Intronic
1055542715 9:77329501-77329523 AATAGGGAGGTCCGAAGAAGAGG + Intronic
1059181256 9:112214627-112214649 TATTAGGAGGCCAGATGCAGTGG + Intergenic
1059219886 9:112605372-112605394 AAGCAGGAGGTCAGAGGCAGAGG - Intronic
1060055455 9:120409142-120409164 ATCCAGGAGGTCCGCTGCAGCGG - Exonic
1060618983 9:125045351-125045373 AATTAGCTGGCCAGATGCAGTGG - Intronic
1060951727 9:127608322-127608344 ACTCAGGAGGTCCGGTGGAGGGG + Intergenic
1061021433 9:128018010-128018032 AAAAAGGAGGCCAGATGCAGTGG + Intergenic
1186472652 X:9833500-9833522 AATTAGGAGGTCCGATGCAGGGG - Intronic
1188961385 X:36496605-36496627 AAAAAGGAGGTCAGGTGCAGTGG + Intergenic
1189273076 X:39765398-39765420 AATGAGGAGGTACGATGTAGTGG - Intergenic
1193470154 X:81891008-81891030 AACTAGGAGGTCTGAGGAAGAGG + Intergenic
1196253815 X:113492622-113492644 ACTTAGGAGGCCAGGTGCAGTGG + Intergenic
1198682480 X:139197702-139197724 AAATAGGAGGCCAGGTGCAGTGG + Intronic
1199239890 X:145534230-145534252 AATTAAGAGGGTTGATGCAGAGG - Intergenic
1199438233 X:147838423-147838445 AATTAGGAGATGGTATGCAGTGG - Intergenic