ID: 1186472653

View in Genome Browser
Species Human (GRCh38)
Location X:9833501-9833523
Sequence TAATTAGGAGGTCCGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472653_1186472661 26 Left 1186472653 X:9833501-9833523 CCCTGCATCGGACCTCCTAATTA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472653_1186472660 9 Left 1186472653 X:9833501-9833523 CCCTGCATCGGACCTCCTAATTA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472653 Original CRISPR TAATTAGGAGGTCCGATGCA GGG (reversed) Intronic
908573404 1:65433554-65433576 TAATTAGCAGGTATGATGCTGGG + Exonic
1079061045 11:17249125-17249147 GAATTAGGAGGTCTGTTGGAGGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1098980731 12:76952898-76952920 TAATTTGGAAGGCCGAGGCAAGG - Intergenic
1099844636 12:88014195-88014217 AGATCAGGAGGTCTGATGCATGG + Intronic
1106870498 13:34013731-34013753 TATTTAGGAGGTACGATGCCAGG + Intergenic
1111468705 13:88648401-88648423 TACTTAGGAAGTCCAATGAAAGG - Intergenic
1116377301 14:44219513-44219535 TAATTAGTAGGTCTGATCAAAGG + Intergenic
1117255396 14:53971961-53971983 AAATTAAGAGGTCTGCTGCAGGG - Intergenic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1135507764 16:23053451-23053473 TAATGAGGAGGCCAGAGGCAGGG - Intergenic
1139348537 16:66320679-66320701 TAATTAGGTTGACAGATGCAGGG - Intergenic
1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG + Intronic
1166424957 19:42669467-42669489 TAATGAGGAAGTCATATGCAAGG - Intronic
1166594956 19:44038185-44038207 TAATTAGGAGCTCTGATGTTTGG - Intergenic
933400289 2:81787775-81787797 CAATGAGGAGGTCTGATTCAGGG + Intergenic
1170891393 20:20379011-20379033 GACTTAGGAGGCCCGAAGCATGG - Intergenic
1175064790 20:56275607-56275629 TACTTAGGAAGTCCAAAGCAAGG - Intergenic
961975619 3:131022168-131022190 TAAGTAGGATGTCCCTTGCAGGG + Intronic
970044282 4:11832657-11832679 AAATTAGGAGAGCAGATGCAGGG + Intergenic
973012824 4:45097551-45097573 TAGTTAGGAGGTAAGATGAATGG + Intergenic
998493655 5:142568283-142568305 TAATTAGGAGTCCTGATGAATGG + Intergenic
1012880690 6:104784755-104784777 TAATTAAGAGATCCTATACAAGG + Intronic
1013711480 6:112905256-112905278 TAATTAGGGGGTGAGTTGCATGG + Intergenic
1015340846 6:132098720-132098742 TAATTAGGACTTAGGATGCATGG + Intergenic
1019095969 6:169579417-169579439 AAATTAGGGGGTCTGAGGCAGGG + Intronic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1042180519 8:66082677-66082699 TATTTAGCAGCTCCTATGCAGGG + Intronic
1045539069 8:103064859-103064881 TAATAAAGAGGTCCAATGTAAGG - Intronic
1057861012 9:98640849-98640871 TGATCAGTAGGTCTGATGCATGG + Intronic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1189413383 X:40793014-40793036 TACTTAGGAAGTCCAAAGCAGGG + Intergenic
1198069068 X:133130047-133130069 TAAATAGAAAGTCAGATGCATGG - Intergenic