ID: 1186472654

View in Genome Browser
Species Human (GRCh38)
Location X:9833502-9833524
Sequence CTAATTAGGAGGTCCGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472654_1186472661 25 Left 1186472654 X:9833502-9833524 CCTGCATCGGACCTCCTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472654_1186472660 8 Left 1186472654 X:9833502-9833524 CCTGCATCGGACCTCCTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472654 Original CRISPR CTAATTAGGAGGTCCGATGC AGG (reversed) Intronic
903970498 1:27115691-27115713 CTAGTTAGGAGGGCCGAGGCAGG + Intronic
904662631 1:32096569-32096591 CTACTTGGGAGGCCCGAGGCAGG - Intronic
908573403 1:65433553-65433575 GTAATTAGCAGGTATGATGCTGG + Exonic
1079495953 11:21044299-21044321 CTTATCAGGAGGTCTGTTGCTGG + Intronic
1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG + Intronic
1089789322 11:120931257-120931279 CTTATTAGGAGGGCCCCTGCAGG + Intronic
1090876895 11:130798262-130798284 CTAAGTAGGAGGTACTATGAGGG - Intergenic
1096272339 12:50175249-50175271 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1098176327 12:67795336-67795358 CAAATTAAGAGGTCTGATTCTGG - Intergenic
1115618022 14:35114880-35114902 CTACTTAGGAGGGCTGAGGCAGG + Intronic
1118969254 14:70619245-70619267 CTATTTAAGAGGGCTGATGCAGG - Intergenic
1127018124 15:54711770-54711792 CTCATTAGGTGGCACGATGCCGG - Intergenic
1139962230 16:70724597-70724619 CTAATTAGGAGATGAGAAGCCGG + Intronic
1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG + Intronic
1144232613 17:13223118-13223140 CTAATTAGCAGGTCACTTGCGGG + Intergenic
1148501786 17:48097140-48097162 CTACTTAGGAGGCCTGAGGCAGG + Intronic
926979789 2:18556601-18556623 CTACTTAGGAGTTCTGATACTGG - Intronic
927869407 2:26614097-26614119 CTCATTAGGAGGCCCGAAGAGGG + Intronic
947377299 2:229509701-229509723 CTACTTAGGAGGGCTGAAGCAGG + Intronic
950937893 3:16861426-16861448 CTAATTATTAGGGCCAATGCTGG - Intronic
954467146 3:50662310-50662332 CTAATCAGGAGTCCCGAGGCAGG + Intergenic
958731456 3:97964583-97964605 CTACTCAGGAGGTCCAAGGCAGG + Intronic
981094824 4:140768025-140768047 CTAATTATGAGGGCTGAGGCGGG + Intergenic
984077066 4:175196746-175196768 CTAATTAGGAGGTCTCATGTAGG - Intergenic
993978873 5:94516987-94517009 CTACTTAGGAGGCCTGAGGCAGG + Intronic
1006603055 6:35238480-35238502 CTAGTTAGGAGGACTGAAGCTGG + Intronic
1009651824 6:66485956-66485978 CTTATTGGTAGCTCCGATGCTGG + Intergenic
1011738530 6:90336334-90336356 CTAATTAGCAGGTAAAATGCAGG - Intergenic
1020202630 7:6092287-6092309 CTACTCAGGAGGTCTGAGGCAGG - Intergenic
1020453006 7:8341247-8341269 CTGATTAGAAGGGCAGATGCTGG - Intergenic
1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG + Intergenic
1058275715 9:103038568-103038590 CTAATTAGGAGGTCCTGAGCCGG + Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1188070893 X:25716786-25716808 TGACTTAGGAGGTCTGATGCAGG + Intergenic
1195805544 X:108761489-108761511 CTAATTGGGAGGGCTGAGGCAGG - Intergenic