ID: 1186472657

View in Genome Browser
Species Human (GRCh38)
Location X:9833513-9833535
Sequence TTATGAGGTCCCTAATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472657_1186472661 14 Left 1186472657 X:9833513-9833535 CCTCCTAATTAGGGACCTCATAA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472657_1186472660 -3 Left 1186472657 X:9833513-9833535 CCTCCTAATTAGGGACCTCATAA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472657 Original CRISPR TTATGAGGTCCCTAATTAGG AGG (reversed) Intronic
910524552 1:88163273-88163295 TTCTGAGGTCCTTAAATAGGAGG - Intergenic
911974753 1:104477703-104477725 TTATCTGGTCACAAATTAGGAGG + Intergenic
912137591 1:106680671-106680693 TAATCAGGAGCCTAATTAGGAGG + Intergenic
912317955 1:108683271-108683293 TTATGAGCTCCCTTATTCAGAGG + Intergenic
924904453 1:248436981-248437003 TTATGAGGTACCTAACAAGGTGG - Intergenic
1068480097 10:57579100-57579122 TGAGGAGGTCCCGAATAAGGGGG + Intergenic
1068906371 10:62328801-62328823 TAATGAGGTACCAAATTGGGTGG + Intergenic
1072107402 10:92287837-92287859 GTATGAGGTTCCTTATTAGAGGG - Intronic
1073512557 10:104051884-104051906 TTATGTGATCCCTAAGTGGGTGG - Intronic
1073618032 10:105017792-105017814 TCATGAGGTCCTTGATTAGAAGG + Intronic
1084626902 11:70314704-70314726 TTATGTGGTCCCTAAATACTAGG + Intronic
1084872730 11:72108967-72108989 TTTTGAGGTCCCTGCTTGGGTGG - Exonic
1086221512 11:84450597-84450619 TAATGGGGGCCTTAATTAGGGGG + Intronic
1095381778 12:41603555-41603577 TTTTGAGGTCGCAAACTAGGTGG - Intergenic
1096787467 12:54025695-54025717 TTATGACGTCCCTAAACAGAGGG - Intronic
1098225617 12:68319523-68319545 TTATGAGGTTCCTAAATATAAGG - Intronic
1100849852 12:98698037-98698059 TTATGTGGTCCCTCAATATGTGG + Intronic
1101035691 12:100703655-100703677 TTATGGGGTGCCTCATTAGTGGG + Intergenic
1116055946 14:39863946-39863968 TTATGTGGTTCCTAAAAAGGTGG + Intergenic
1116574127 14:46551598-46551620 TTATGCTGCTCCTAATTAGGGGG - Intergenic
1133474207 16:6104094-6104116 CTATGATGTCCCTAATTAGAAGG - Intronic
1134887714 16:17808639-17808661 TTATCAGTTCCTTAATTATGGGG + Intergenic
1150969802 17:70015046-70015068 GTATGAGCTCCCTAGTTAGCTGG + Intergenic
1155069532 18:22302003-22302025 TTGTCAGTTACCTAATTAGGTGG + Intergenic
1155312397 18:24536646-24536668 TGTTGAGGTCCCTCCTTAGGAGG + Intergenic
933070252 2:77848258-77848280 TTATGAGCGTCCTATTTAGGTGG + Intergenic
940454358 2:153876917-153876939 TCATGAGGACTCTAATTACGTGG - Intronic
941953946 2:171185218-171185240 TGATGAGGTCCCAAATAAAGAGG - Intronic
947594871 2:231404691-231404713 GTATGAGGTCACAAAGTAGGGGG + Intergenic
948546169 2:238730352-238730374 GTCTGAGGTCCCTACTGAGGAGG - Intergenic
1183103347 22:35597604-35597626 GTATTAGGTACCTGATTAGGTGG + Intergenic
949103331 3:172415-172437 TTATGAGTGTCCTAATTAGGTGG - Intergenic
952780470 3:37092444-37092466 TTATGAAGGACCTATTTAGGAGG + Intronic
954327659 3:49872421-49872443 TTATGAGGACCCTCCTAAGGAGG + Intergenic
958091098 3:88877147-88877169 TTATGATGTAGCTAATTATGAGG - Intergenic
958946109 3:100363857-100363879 TGAGGAGGTCACTAATTAGTTGG - Exonic
959495416 3:107045097-107045119 TGATGAAATACCTAATTAGGAGG - Intergenic
959858482 3:111189780-111189802 TTATTAGGTACCTAGATAGGGGG + Intronic
969529409 4:7722415-7722437 TTATGGGGTCCCTAGGAAGGAGG - Intronic
969826576 4:9762804-9762826 GTATGAGGTCCCAAAGTGGGCGG + Intergenic
970258300 4:14193583-14193605 TTATGAGGTATCTATTTATGAGG - Intergenic
971130869 4:23808855-23808877 TTTTGAGTTCCATAAGTAGGAGG - Intronic
975473901 4:74799903-74799925 TTATGTGGACCATTATTAGGTGG - Intergenic
981107108 4:140893564-140893586 TTAAAAGGTACCTAATAAGGTGG - Intronic
981526316 4:145709769-145709791 TCATGAGCTCCCTATTTAGGAGG + Intronic
983415201 4:167443488-167443510 TTCTGAGGTCCCTACTTTTGAGG + Intergenic
985346986 4:189016563-189016585 TTATGAGCTCACAAATTAGGTGG - Intergenic
988071932 5:26302011-26302033 TTATGAAGCCCCGGATTAGGTGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
1001890004 5:175330899-175330921 TTATTAGGTCACTAATTATTAGG + Intergenic
1008215739 6:48786255-48786277 TTATGAGGTACATATTTATGGGG - Intergenic
1011630364 6:89317227-89317249 TTGTGAGATCCCTAGGTAGGGGG + Intergenic
1018079951 6:160250662-160250684 TTATGAGGACTGTAGTTAGGAGG + Exonic
1022470654 7:30680182-30680204 TGATGAATGCCCTAATTAGGGGG - Intronic
1022648455 7:32253300-32253322 TTATAAGGTCACCAATAAGGTGG - Intronic
1024969716 7:55057365-55057387 TTATGAGATGCTTAATTAAGAGG - Intronic
1030865055 7:114691659-114691681 TTATGAGGTCCCTTGGTTGGGGG - Exonic
1034687396 7:152984955-152984977 TTATGAGGACACTAGTCAGGCGG + Intergenic
1051708516 9:19905701-19905723 ATAGGAGGTCCCTAAAGAGGTGG - Intergenic
1056015600 9:82383038-82383060 TTATGAGATTCCTAAGGAGGGGG + Intergenic
1061013151 9:127967184-127967206 TTAGGAAGTCCCAAGTTAGGAGG + Intronic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1190257309 X:48773312-48773334 TTGTGATGTCCCTATTGAGGAGG + Exonic