ID: 1186472658

View in Genome Browser
Species Human (GRCh38)
Location X:9833516-9833538
Sequence TAGTTATGAGGTCCCTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472658_1186472661 11 Left 1186472658 X:9833516-9833538 CCTAATTAGGGACCTCATAACTA 0: 1
1: 0
2: 1
3: 1
4: 57
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472658_1186472660 -6 Left 1186472658 X:9833516-9833538 CCTAATTAGGGACCTCATAACTA 0: 1
1: 0
2: 1
3: 1
4: 57
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472658 Original CRISPR TAGTTATGAGGTCCCTAATT AGG (reversed) Intronic
904034913 1:27553382-27553404 TAGTTATAAAGTACCTACTTTGG + Intronic
915219874 1:154366203-154366225 TAGGTATGAAGTTCCTACTTGGG - Intergenic
1069172207 10:65246071-65246093 TAGTTATGAGTACATTAATTTGG + Intergenic
1071394546 10:85208605-85208627 TATTTATGAACTCCCAAATTGGG - Intergenic
1079354196 11:19716115-19716137 TAGTTTCCAGGTCCCAAATTTGG + Intronic
1086684439 11:89714798-89714820 TAGTTTTGAAGTCCTAAATTTGG + Intronic
1093724185 12:22484244-22484266 TTGTCATGAGTTCCCCAATTAGG + Intronic
1100053763 12:90484148-90484170 AAGTTATGAGATGCCTATTTTGG - Intergenic
1106273807 13:28183385-28183407 TAGTTCTGAGGGCATTAATTTGG - Intronic
1109135229 13:58641152-58641174 TAGTTATGCTGTCTCAAATTTGG + Intergenic
1109402399 13:61852048-61852070 TCATTATGAGGTCTCTAATAGGG - Intergenic
1114342991 14:21764731-21764753 TGGCTATGAGGGCCCTTATTTGG - Intergenic
1114388393 14:22279517-22279539 TATCTATGAGTTCACTAATTAGG - Intergenic
1118977920 14:70693312-70693334 TAGTTTTGGGGTGCCTATTTAGG - Intergenic
1120924454 14:89783635-89783657 TAGTAAAAAGGTCCCAAATTAGG - Intergenic
1135810285 16:25580520-25580542 TACTTATCAAGTGCCTAATTTGG + Intergenic
1137906142 16:52323983-52324005 TAGGTATGAGTTCCCTAATTGGG - Intergenic
1137964880 16:52920786-52920808 TAGTTCTGAAGTCACGAATTGGG + Intergenic
1150032717 17:61756293-61756315 TAGTTTTTAGGTGCCTAGTTAGG - Intronic
1152036357 17:77875469-77875491 TCCTTATGAGGTCCCCAACTTGG - Intergenic
931773937 2:65523750-65523772 TTGGTATCAGGTCCCTTATTGGG + Intergenic
933319040 2:80748756-80748778 TAGTTTTCAGGTTACTAATTAGG + Intergenic
936394468 2:112111258-112111280 TAGTTATGAGTTTCCAAATCTGG - Intronic
1169047473 20:2545633-2545655 TAGTTTTGAGATCACTAAGTAGG + Intronic
1170023244 20:11860349-11860371 AAGTTATGGGGTCCATATTTTGG - Intergenic
1170541074 20:17388602-17388624 AACTTATGAGGTGCCTAATGAGG - Intronic
1175090847 20:56502807-56502829 TAAATATGAGGTTCCTAATAAGG - Intronic
1175587953 20:60160730-60160752 TAGCTATGAGGTCACAAGTTAGG + Intergenic
949103332 3:172418-172440 TCGTTATGAGTGTCCTAATTAGG - Intergenic
951634721 3:24760690-24760712 GAAATATGAGGTCCGTAATTTGG + Intergenic
952300053 3:32097025-32097047 AAGTCATGAGGGCTCTAATTGGG + Intergenic
955594080 3:60569682-60569704 TAAATATGAGGTGACTAATTTGG - Intronic
965482500 3:169236600-169236622 TAGTTAGGATTTCCCAAATTTGG + Intronic
970907191 4:21229747-21229769 TAGCTATGAGGTGCCTATCTTGG - Intronic
975473902 4:74799906-74799928 TAGTTATGTGGACCATTATTAGG - Intergenic
975553217 4:75634111-75634133 TAGGTATGAGGTTCCTTTTTGGG + Intergenic
975954634 4:79822782-79822804 TACTTATTAGGTCCCTATTAAGG - Intergenic
988241296 5:28612571-28612593 TGGTTCAGAGGTCCCTAGTTCGG - Intergenic
990597641 5:57327389-57327411 TAGTAATGTGGTCTCTATTTTGG + Intergenic
992507514 5:77402124-77402146 TGATTATGAGGTCCCTGAATAGG + Intronic
999483617 5:151971432-151971454 TATTTGTGAGGTCCCTAGTGTGG + Intergenic
1001014369 5:168127104-168127126 GAAAAATGAGGTCCCTAATTGGG + Intronic
1001139322 5:169130612-169130634 TATTTATCAGGTGCCTACTTTGG - Intronic
1002818971 6:705654-705676 TAGTTATTAGATTCCTAATCAGG - Intergenic
1016313673 6:142761872-142761894 TAGATATGAGGTCCCTTCTCAGG - Intronic
1021263843 7:18494725-18494747 AAGTTAGGAGGTCCATATTTCGG + Intronic
1021835062 7:24662895-24662917 TAGTTATGATCTCCGAAATTTGG - Intronic
1022060258 7:26786077-26786099 TACTTTGGAGGGCCCTAATTGGG - Intronic
1037200365 8:16245095-16245117 TATTTATGATGCCCCAAATTGGG - Intronic
1044878740 8:96700410-96700432 TAGTTATGAGATACCCCATTTGG + Intronic
1045444171 8:102242853-102242875 TAGTTATGAGGACCATAGTGAGG + Intergenic
1046473370 8:114708960-114708982 TAGTTATAAGGTCTGTAATTTGG - Intergenic
1047860368 8:128959356-128959378 TAGAAATGAGGTCTATAATTTGG + Intergenic
1053549380 9:39059821-39059843 AAATTATGAAGTCCCTACTTAGG + Intergenic
1056553443 9:87670430-87670452 TAGTTATTAGGTCTCTATTACGG + Intronic
1057492355 9:95530791-95530813 TAGTTAAGAGCTTCATAATTTGG + Intergenic
1057555246 9:96082859-96082881 CAGTTTTGAGGTGCCTAACTGGG - Intergenic
1186472658 X:9833516-9833538 TAGTTATGAGGTCCCTAATTAGG - Intronic
1187401122 X:18961198-18961220 TATTTATTAGGTACCTAACTAGG - Intronic
1195157002 X:102133589-102133611 TAGGTCTGAGGTCCCCAGTTAGG - Intergenic