ID: 1186472659

View in Genome Browser
Species Human (GRCh38)
Location X:9833528-9833550
Sequence TAACTAAGTGCTTAGTTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472659_1186472661 -1 Left 1186472659 X:9833528-9833550 CCTCATAACTAAGCACTTAGTTA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472659 Original CRISPR TAACTAAGTGCTTAGTTATG AGG (reversed) Intronic
901347920 1:8563667-8563689 TATTTAACTGCTTAGTCATGGGG + Intronic
901890423 1:12258781-12258803 TAAACAAGTGGTTAGTTAAGGGG - Intronic
903689166 1:25158458-25158480 TAAGTAAGAGCTAAGCTATGAGG - Intergenic
909559488 1:76993687-76993709 GAATTAACTGCTTAGATATGAGG - Intronic
912083703 1:105973469-105973491 TAACTACGTGACTATTTATGAGG + Intergenic
916865652 1:168854559-168854581 TAACTAAGTATTTAATTTTGAGG - Intergenic
918110132 1:181448514-181448536 TAAATAAGTGATTACTTCTGAGG - Intronic
918260685 1:182792938-182792960 TAACTAAGTACTACATTATGTGG + Intronic
918406635 1:184217597-184217619 TAACTAAGTTCAAAGTAATGTGG - Intergenic
920717042 1:208349867-208349889 TGACTAATTGCTTTGTTCTGTGG + Intergenic
921040968 1:211431809-211431831 CAACCAAGTACTTAGTTTTGTGG - Intergenic
921566855 1:216731807-216731829 TAACTAAGTGCACAGCTATTTGG + Intronic
923407520 1:233677594-233677616 AAATTAAATGCTGAGTTATGTGG - Intergenic
923640695 1:235756965-235756987 TTACTAAGTGTTCAGATATGGGG + Intronic
1063697747 10:8353447-8353469 TATCTAGGTGCTTAATTATTGGG + Intergenic
1064354610 10:14605450-14605472 TGACTAAGGGCTTATTTATGGGG + Intronic
1072219403 10:93315145-93315167 TGACTAAGTGCTTAGTTAAGAGG - Intronic
1074343322 10:112655843-112655865 TGACTAATTGCCTAGATATGGGG - Intronic
1074718290 10:116241061-116241083 TAACTAAGGGCTTGTTTTTGAGG - Intronic
1081385824 11:42471652-42471674 TAACTCAGTTCTTGGGTATGAGG - Intergenic
1082992250 11:59217456-59217478 TCACTATGTTCTTAGTTTTGTGG - Intergenic
1083685332 11:64371789-64371811 TAACTCAGTGCTTAGAAGTGGGG - Exonic
1084675044 11:70629368-70629390 TAACCTAGTGCTTGGTGATGAGG + Intronic
1086551175 11:88054126-88054148 TAGCTAAGTTCTTAGAGATGTGG - Intergenic
1087395713 11:97595177-97595199 TAACCAAGAGCTAAGCTATGAGG + Intergenic
1088383830 11:109227056-109227078 AAATTAAGTGGATAGTTATGGGG + Intergenic
1095597264 12:43973048-43973070 TATCTAAGTTTTTAGTTTTGGGG - Intronic
1100007589 12:89912644-89912666 TAAGTAAGAGCTAAGCTATGAGG - Intergenic
1101568142 12:105928950-105928972 TAAATAAGAGCATGGTTATGTGG - Intergenic
1102041681 12:109805091-109805113 TAACTGTGTGCTTATTTATGTGG + Intronic
1102232201 12:111270621-111270643 TAACTGAGTGATTAGTTAAAAGG + Intronic
1106409590 13:29502069-29502091 GCACTAGGGGCTTAGTTATGGGG - Intronic
1106615363 13:31322044-31322066 TAAGTAGGAGCTAAGTTATGAGG - Intronic
1107701355 13:43051482-43051504 TAACTAGGAGCTAAGGTATGAGG - Intronic
1108324172 13:49313838-49313860 TATGAAAGGGCTTAGTTATGGGG + Intronic
1111621049 13:90726363-90726385 TAACTTAATTCTCAGTTATGTGG - Intergenic
1116110765 14:40577790-40577812 AAAGTAAGTGCTTATTTATGTGG + Intergenic
1120128535 14:80777065-80777087 TAATTAAGTGTTCACTTATGTGG - Intronic
1123780113 15:23617938-23617960 TAAGTAAGAGCTAAATTATGAGG + Intronic
1126572419 15:50166350-50166372 TAATTTAGTGCTTACTTGTGTGG - Intronic
1127337737 15:58006224-58006246 TAAGTAAGTGCTAAGCTATGAGG - Intronic
1127440539 15:59002534-59002556 TAATTAAATGCACAGTTATGAGG - Intronic
1128118399 15:65127577-65127599 CAACTAAGTGCTGAATGATGAGG - Intronic
1131575406 15:93585207-93585229 TACCTAATGGATTAGTTATGGGG + Intergenic
1135022434 16:18973986-18974008 TAACAAAGTACTAAGTTCTGTGG - Intergenic
1137965259 16:52926393-52926415 TAAGTGAGTGCTAAGCTATGAGG + Intergenic
1138040364 16:53657292-53657314 TAACTAAGTACCTAGTTATAAGG + Intronic
1138791714 16:59912184-59912206 AAACTATGTGCATAGTTAAGGGG + Intergenic
1138976418 16:62213851-62213873 AATCAAAGTGCTTAGTAATGTGG + Intergenic
1141540331 16:84715386-84715408 TAATTAAGTGCTGAATTATGTGG + Intronic
1142585354 17:969038-969060 TAACTAGGTGCTTTGGAATGGGG + Intronic
1145840004 17:27986609-27986631 AAACTAAATGCTTAGCAATGAGG + Intergenic
1150875640 17:68967233-68967255 TAAGTAAGAGCTAAGCTATGAGG - Intergenic
1155381435 18:25226624-25226646 TATCTAAGTGCATAGTTTTCAGG + Exonic
1155834606 18:30565344-30565366 TGCCTAAATGCTTCGTTATGTGG + Intergenic
1156089747 18:33452669-33452691 TACCTAAGTATTTAATTATGGGG - Intergenic
1156416028 18:36891518-36891540 TAAGTGAGAGCTAAGTTATGAGG - Intronic
1156647099 18:39177914-39177936 AAAATAAGTGGTTAGATATGTGG + Intergenic
1159495393 18:69196200-69196222 TAAATTAGAGCTAAGTTATGAGG + Intergenic
1163079105 19:14923816-14923838 TAAGTAGGAGCTAAGTTATGAGG - Intergenic
1164756750 19:30695431-30695453 TAATTAAGTGCCTAATTGTGTGG + Intronic
1168488761 19:56789356-56789378 TAACTAAGTGGTTATGAATGTGG + Intronic
925835942 2:7947044-7947066 TAATTAAGTGATTAAATATGGGG + Intergenic
929366950 2:41170291-41170313 TTACTTAGAGCTTAGTCATGTGG + Intergenic
930924605 2:56801910-56801932 TAACTCAGTTCTTAGTCATCTGG - Intergenic
932785876 2:74603428-74603450 TAATTAAGTGCTAAATTACGTGG + Intronic
935105369 2:100038644-100038666 TATTTAAATGCTTCGTTATGTGG - Intronic
935110148 2:100085642-100085664 TAACTAAATGCTTATTTCTATGG - Intronic
935609920 2:105011614-105011636 TAAGTGAGAGCTAAGTTATGAGG - Intergenic
936124826 2:109779564-109779586 TAACTAAATGCTTATTTCTATGG + Intergenic
936219865 2:110591902-110591924 TAACTAAATGCTTATTTCTGTGG - Intergenic
936605045 2:113943650-113943672 TCAGTAATTGCTTAGATATGAGG + Intronic
936810022 2:116387047-116387069 TACCTAAGTGCTTAGTAAACAGG - Intergenic
936873844 2:117164588-117164610 AAACTAAATACTTATTTATGTGG - Intergenic
938861081 2:135370386-135370408 TAACTGAGAGCTAAGCTATGAGG - Intronic
939317771 2:140575144-140575166 GAACTAAGTGTATAGATATGAGG + Intronic
939549521 2:143596928-143596950 TGAATAAATGATTAGTTATGAGG - Intronic
940385022 2:153060484-153060506 TACCCAAGTGCTCAGATATGAGG + Intergenic
940442813 2:153738931-153738953 AAGCTAAGTGGTTAGTTTTGGGG - Intergenic
941566649 2:167117178-167117200 TAACTAAATGCTTTGTTTTGTGG + Intronic
941945342 2:171090687-171090709 TAAATGAGTGCTTATCTATGGGG - Intronic
943304871 2:186248328-186248350 TAACTATGTACTTTGTTATTGGG + Intergenic
943770200 2:191708253-191708275 TAATTAAGTGCTTCATTATGTGG - Intergenic
944899673 2:204201372-204201394 TAGTTATGTGCTTAGTTAAGTGG - Intergenic
948267882 2:236650043-236650065 TACCTAAGTGCTTAATTGAGTGG + Intergenic
1170722329 20:18894043-18894065 TATCTAAGTACTTTGTTTTGGGG - Intergenic
1173355503 20:42283916-42283938 TAACTATGAGATTAATTATGGGG - Intronic
1173920081 20:46737720-46737742 CAACTAGGTGCTCAGTTAGGAGG + Intergenic
1177249424 21:18572857-18572879 TAAGTAGGAGCTAAGTTATGAGG - Intergenic
1177590947 21:23166653-23166675 TAACTGAGTACTGAGTCATGTGG - Intergenic
1182060296 22:27392562-27392584 TAATTAGCTGCTGAGTTATGGGG - Intergenic
1182265220 22:29109425-29109447 TAAATAAGTGTTGAATTATGAGG + Intronic
950731439 3:14962899-14962921 GTACTAAGTGCTGAGTTATATGG + Intronic
950843553 3:15991399-15991421 TAACTAAGTGCTTCATTTTCTGG + Intergenic
952101630 3:30019816-30019838 TGGCTAGGTGCTTAGGTATGAGG + Intergenic
953649424 3:44787270-44787292 CAACTTAGTGCTTAATTTTGGGG - Intronic
955082545 3:55671598-55671620 TTGCCAAGTGCTTACTTATGTGG - Intronic
956870257 3:73409862-73409884 AAACTAAGTACCTATTTATGGGG + Intronic
957627910 3:82678648-82678670 TTACAAAGAGCATAGTTATGTGG - Intergenic
957932906 3:86905363-86905385 TATTTAAATGCTTGGTTATGTGG - Intergenic
959711104 3:109386631-109386653 TAATTAAGTGATAACTTATGGGG - Intergenic
960256909 3:115520396-115520418 TAATCAAGTGCTTAATGATGTGG + Intergenic
960773663 3:121224581-121224603 TAATTAAGTGCTGAGTTGTATGG + Intronic
962039202 3:131687204-131687226 TAACTAAGTGCTTCATTGTTGGG + Intronic
964047626 3:152349264-152349286 TATCTTAGTGCTGATTTATGGGG + Intronic
964874247 3:161347895-161347917 TAATTAAGTGATGAGTAATGTGG + Intronic
965190443 3:165521044-165521066 TCACTGAGGGATTAGTTATGAGG + Intergenic
966244501 3:177791490-177791512 TAATTAAGTGCTAATTTGTGTGG - Intergenic
971554518 4:27996657-27996679 TAAGTAGGAGCTAAGTTATGAGG - Intergenic
972856057 4:43108291-43108313 TAACCAAGTGCTAATTTATTTGG + Intergenic
974432077 4:61811798-61811820 TAACAAAGTACATAGTGATGGGG + Intronic
976679843 4:87744885-87744907 AAATTAAGTGCTTATTCATGGGG - Intergenic
977174603 4:93804890-93804912 TAACTTAGTACTTGGTTATGTGG + Intergenic
978726014 4:111970480-111970502 TAAGTAGGAGCTAAGTTATGAGG + Intergenic
978871221 4:113580794-113580816 GAATTAAGTGCTTAAATATGTGG - Intronic
979498676 4:121413491-121413513 TAAGTAAGAGCTAAGCTATGAGG - Intergenic
979839546 4:125421291-125421313 TTAGAAAGTGCTTAGATATGTGG - Intronic
980092482 4:128456755-128456777 TCACTAAGTGCTTGGCTTTGTGG + Intergenic
982973789 4:162025941-162025963 TAACTAAATGCTAAGTTCTTAGG + Intronic
983882378 4:172947970-172947992 TAAATCAGTACTTAGTTTTGGGG - Intronic
988876372 5:35451410-35451432 TAAGTAGGAGCTAAGTTATGAGG + Intergenic
989846663 5:46152798-46152820 TGACTAACTGCTTTGTGATGTGG + Intergenic
989855059 5:46275180-46275202 TAAGAAACTGCTTTGTTATGTGG - Intergenic
992017573 5:72591508-72591530 TAATTAAGTGCTTCATTGTGTGG - Intergenic
993425520 5:87759486-87759508 TAAATAAGTTCGTAGTTATAAGG - Intergenic
993520357 5:88891933-88891955 TAACTAAGTGTTAAGTTAAAAGG - Intronic
993626278 5:90228241-90228263 TAGCTAAGTGCTTGGTTAACGGG + Intergenic
994204551 5:97019892-97019914 TACCTAACTGCATTGTTATGTGG - Intronic
994943247 5:106352055-106352077 TAACTAAGTGTTTACTTTGGGGG + Intergenic
997623109 5:135313322-135313344 TAATTCAGAGCTTAGATATGTGG + Intronic
1000101168 5:158018072-158018094 TCACGGAGAGCTTAGTTATGTGG + Intergenic
1004881785 6:20015815-20015837 TAACAAAGTAATTAGTTATATGG + Intergenic
1006592597 6:35169425-35169447 TAAATAAGTGCTTAGAATTGTGG + Intergenic
1007874887 6:45085516-45085538 TAACCAAGTTCTTAGAAATGAGG - Intronic
1008531924 6:52469443-52469465 TAACAAGGTGCTTCGTTATTTGG + Exonic
1009032617 6:58078419-58078441 TAACTAATTAATTAGTTAGGTGG - Intergenic
1009208227 6:60830186-60830208 TAACTAATTAATTAGTTAGGTGG - Intergenic
1011611770 6:89158798-89158820 TTACTAAGTACTTAGTTATCTGG + Intronic
1012027793 6:94019963-94019985 TAACTATGAGCTAAGCTATGAGG - Intergenic
1015695314 6:135973477-135973499 TAAATAAATACTTAGTAATGGGG + Intronic
1016640813 6:146347035-146347057 TACCTACGTGCATAGTGATGGGG + Intronic
1016652780 6:146482432-146482454 TAACAAAGCTCTTAGTTTTGAGG - Intergenic
1016914672 6:149233566-149233588 TTACTTAGTGCTTTGTTAGGGGG - Intronic
1017199020 6:151732392-151732414 TCACTAAGTCCTTAGTTCTTTGG - Intronic
1018434328 6:163747479-163747501 TAAGTAAATGCTCAGTCATGAGG - Intergenic
1019941288 7:4293541-4293563 TAAATAATTGCTGAGTTATAGGG - Intergenic
1020650099 7:10864369-10864391 TTTTTAAGTGCTTAGTGATGTGG - Intergenic
1020982862 7:15093654-15093676 TTACTAAGTACTTATGTATGTGG - Intergenic
1027686759 7:81288082-81288104 TAATTAAGTTATTAGCTATGGGG - Intergenic
1027986361 7:85296016-85296038 TAAGAAAGTTCTTAGTTATTTGG + Intergenic
1028418678 7:90608653-90608675 AAACTAAGTGCTTAATTATCTGG - Intronic
1028792347 7:94867119-94867141 TAACTCAGAGCTAAGCTATGAGG - Intergenic
1030851779 7:114495842-114495864 TAACTGAATACTCAGTTATGTGG + Intronic
1036737908 8:11335325-11335347 TATCTAAGTACTTAATTTTGGGG - Intergenic
1037520739 8:19678453-19678475 TCAGTAACTGCTTAGCTATGAGG - Intronic
1039573891 8:38608347-38608369 TAACTAAGAGCTGAGATTTGGGG - Intergenic
1040584182 8:48724968-48724990 AAACACAGTGCTTGGTTATGTGG + Intronic
1042234420 8:66595107-66595129 TACCCAAGTGATTAGTTATTAGG + Intronic
1043617159 8:82140390-82140412 CAACTCAGTGCTTGGTTAGGTGG - Intergenic
1044366546 8:91353950-91353972 AAAGTAAGAGCTTAGTTTTGGGG + Intronic
1045572237 8:103380036-103380058 TATCTAAGTACTTAGTGAAGAGG - Intronic
1047234074 8:123023604-123023626 TAACTATGGGGTTAATTATGTGG - Intronic
1048206903 8:132422698-132422720 AAATGAAGTGCTTAGTTATATGG - Intronic
1053374750 9:37596156-37596178 TAAAAAAGTGCTTATTTATTTGG + Intronic
1056114637 9:83430038-83430060 TTAGTAAGTGATTAGTGATGGGG - Intronic
1056952275 9:91051183-91051205 AAACTAAGTGTTTGGTTTTGGGG + Intergenic
1185947159 X:4389485-4389507 TAAGTGAGAGCTAAGTTATGAGG - Intergenic
1186472659 X:9833528-9833550 TAACTAAGTGCTTAGTTATGAGG - Intronic
1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG + Intronic
1186757445 X:12687589-12687611 TAACAAATTGCTGAGTTCTGTGG - Intronic
1188433052 X:30128613-30128635 TAACCCAGTGTTTACTTATGAGG - Intergenic
1189076929 X:37925814-37925836 TAAGTAGGAGCTAAGTTATGAGG - Intronic
1192231897 X:69271083-69271105 TAAGTGAGAGCTAAGTTATGAGG - Intergenic
1193301862 X:79898639-79898661 TAAGTGAGAGCTAAGTTATGAGG + Intergenic
1193321363 X:80125443-80125465 TAAATGAGAGCTAAGTTATGAGG - Intergenic
1193667949 X:84347068-84347090 TACCTAAGTGTTTAATTTTGGGG + Intronic
1195876080 X:109542327-109542349 TTACTAAGTACTTAGTTTTCTGG + Intronic
1197743469 X:129914162-129914184 TAAGGAAGTGCTTAGTTCAGAGG + Intronic
1201267174 Y:12218625-12218647 AAACTATGTGCATATTTATGGGG - Intergenic