ID: 1186472660

View in Genome Browser
Species Human (GRCh38)
Location X:9833533-9833555
Sequence TAACTAAGCACTTAGTTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472652_1186472660 10 Left 1186472652 X:9833500-9833522 CCCCTGCATCGGACCTCCTAATT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472658_1186472660 -6 Left 1186472658 X:9833516-9833538 CCTAATTAGGGACCTCATAACTA 0: 1
1: 0
2: 1
3: 1
4: 57
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472657_1186472660 -3 Left 1186472657 X:9833513-9833535 CCTCCTAATTAGGGACCTCATAA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472653_1186472660 9 Left 1186472653 X:9833501-9833523 CCCTGCATCGGACCTCCTAATTA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472654_1186472660 8 Left 1186472654 X:9833502-9833524 CCTGCATCGGACCTCCTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472650_1186472660 14 Left 1186472650 X:9833496-9833518 CCCACCCCTGCATCGGACCTCCT 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472649_1186472660 15 Left 1186472649 X:9833495-9833517 CCCCACCCCTGCATCGGACCTCC 0: 1
1: 0
2: 1
3: 17
4: 279
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1186472651_1186472660 13 Left 1186472651 X:9833497-9833519 CCACCCCTGCATCGGACCTCCTA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472660 Original CRISPR TAACTAAGCACTTAGTTACT AGG Intronic
910518273 1:88088219-88088241 TAACGAAGCACTTTGTCCCTTGG + Intergenic
912537992 1:110390149-110390171 CAACTAAGGACTTAGTTACCTGG + Intronic
912982318 1:114386793-114386815 CCACTAAGCACTCAGTTTCTAGG - Intergenic
916526307 1:165612798-165612820 TAAATAATCAACTAGTTACTAGG + Intergenic
918156275 1:181849723-181849745 TAACAAAGCACTTTGTGCCTTGG - Intergenic
921546201 1:216477976-216477998 TATCTTAGCACTTAGGCACTAGG - Intergenic
922382277 1:225042566-225042588 TAAATAGGCACTCAGTGACTAGG + Intronic
1069547627 10:69339883-69339905 GAACTAATCACTTAGCTTCTTGG + Intronic
1070993887 10:80758122-80758144 TTATTAAGCACATACTTACTGGG - Intergenic
1071697821 10:87896678-87896700 AAATTAATCACTTAGGTACTAGG - Intronic
1074003406 10:109394101-109394123 TAACAAAGCACTTTGTTCCTTGG - Intergenic
1075492748 10:122886852-122886874 TAAATAAGAACTTTCTTACTAGG - Intergenic
1080871071 11:36237483-36237505 TAACTCAGCCCTCAGTTACCAGG + Intergenic
1085592871 11:77780252-77780274 TTGCTAATCAGTTAGTTACTTGG - Intronic
1087551911 11:99661757-99661779 CAACTAATCACTTAATAACTGGG - Intronic
1087954086 11:104262840-104262862 TAGCTAAGAAATTAATTACTTGG - Intergenic
1088800228 11:113298660-113298682 CACCTAAGCACTTAGTCACCAGG + Intergenic
1089489532 11:118873338-118873360 TTACTAAGCACGTAGTTTATGGG + Intergenic
1092465132 12:8724773-8724795 TAACTGAGGACTTAGTTTCCAGG - Intronic
1092696772 12:11180170-11180192 TGACCAATCACTTAGTTACCTGG - Intergenic
1093522557 12:20067390-20067412 TAACAAAGCACTTTGTCCCTTGG - Intergenic
1095495335 12:42778253-42778275 TAACTAGGCATTTAGCTAGTTGG - Intergenic
1097447513 12:59690370-59690392 TTAATCTGCACTTAGTTACTGGG - Intronic
1102357582 12:112252094-112252116 GAAATAAGCACTTAGATCCTGGG - Intronic
1103836891 12:123828934-123828956 TAACTCAGCCCTGAGTCACTGGG - Intronic
1104256340 12:127142845-127142867 TAACAAAGCACTTTGTCCCTTGG + Intergenic
1107312737 13:39096938-39096960 TGACCATGCACTTAGTTACAAGG - Intergenic
1108144724 13:47464224-47464246 TAACAAAGCACTTTGTCCCTTGG - Intergenic
1108300138 13:49065312-49065334 TTCATAAGCACTTAGATACTGGG - Intronic
1108820320 13:54341508-54341530 GAACTAAGCAATTAATTAATGGG - Intergenic
1109451566 13:62521258-62521280 TGACTGAGCAGTTAGGTACTGGG - Intergenic
1109636937 13:65132537-65132559 TTACTATGCACTTGATTACTGGG + Intergenic
1114842643 14:26283195-26283217 TAACTAAACTCCTAGTTAGTAGG - Intergenic
1115081401 14:29455683-29455705 TAGCTAAGCAATTATTTTCTAGG - Intergenic
1115726676 14:36224838-36224860 TAACTGAGCACTTACGTGCTGGG - Intergenic
1116730850 14:48620716-48620738 TAACTAAGCCAATAGTTACAGGG + Intergenic
1116977471 14:51131796-51131818 TAACAAAGCACTTTGTCCCTTGG - Intergenic
1124940310 15:34211467-34211489 TAAGTAAGGACTCTGTTACTAGG - Intergenic
1125752974 15:42043007-42043029 TAAGAAAGAACTTAGTCACTTGG + Intronic
1126186395 15:45834608-45834630 TAACGTAGCTCTTAGGTACTAGG + Intergenic
1126552942 15:49953214-49953236 TAACGAAGCACTTTGTCTCTTGG + Intronic
1130765901 15:86870982-86871004 TCCCTAAGCAGTTAGTTGCTGGG - Intronic
1130784485 15:87081008-87081030 TCACTGATCACTTAGTCACTGGG - Intergenic
1138040364 16:53657292-53657314 TAACTAAGTACCTAGTTATAAGG + Intronic
1140094902 16:71866771-71866793 TAACTTAGCAATTAATTGCTCGG - Intronic
1142911634 17:3098162-3098184 TAACGAAGCACTTTGTCCCTTGG - Intergenic
1150078588 17:62216119-62216141 TAATTGAGCATTTAGTTACTTGG + Intergenic
1159689186 18:71464692-71464714 TTAGTCAGAACTTAGTTACTTGG + Intergenic
1160380811 18:78453912-78453934 TAAATCAGCACATAGTTACATGG + Intergenic
1163958310 19:20664349-20664371 TAATGAAGCACTTTGTTCCTTGG + Intronic
1164407596 19:27966862-27966884 TAACTAAGAAACTAGTTACAGGG - Intergenic
926561902 2:14426898-14426920 TCACAAACCACTTAGCTACTGGG + Intergenic
929178606 2:39008326-39008348 CAACCAAGCACTTAGCTCCTAGG + Intronic
929809469 2:45177292-45177314 TAACTAAGAATGGAGTTACTGGG - Intergenic
929813866 2:45215040-45215062 TAACCAAGCACTTATATACAAGG - Intergenic
930244907 2:48973717-48973739 TAACAAAGCAATAAGTTTCTGGG - Intronic
935465645 2:103394880-103394902 GGACTAAGCACATAGTTACCTGG - Intergenic
935621626 2:105135198-105135220 TAACTGAGATCTTAGTTACCAGG + Intergenic
938048519 2:128145303-128145325 TAATTAAAGATTTAGTTACTTGG + Intronic
938136761 2:128765607-128765629 TAACGAAGCACTTTGTCCCTTGG + Intergenic
938561239 2:132473972-132473994 CAACTACACACTTAGTGACTGGG + Intronic
939119904 2:138103722-138103744 TAGCTTGGCACTTAGTGACTGGG - Intergenic
940094066 2:149953552-149953574 TAACTGAGTACAAAGTTACTGGG - Intergenic
940167734 2:150793347-150793369 TAACGAAGCACTTTGCCACTTGG - Intergenic
940273326 2:151914983-151915005 TAACAAAGCACTTTGTCCCTTGG + Intronic
941694316 2:168534734-168534756 TAACAAAGCACTTTGTCCCTTGG + Intronic
942841365 2:180365534-180365556 TAACTAAGCAGTTATTCAATAGG + Intergenic
942924142 2:181411714-181411736 TAACCAAGCACTTTGTCCCTTGG - Intergenic
943280615 2:185927995-185928017 TAAATAAGCACTTATTCACTAGG + Intergenic
943304871 2:186248328-186248350 TAACTATGTACTTTGTTATTGGG + Intergenic
943354338 2:186832995-186833017 TTATTAAGCACTTAGATACTAGG - Intronic
1170219051 20:13921997-13922019 TTATAAAGCACTTAGATACTAGG - Intronic
1176378216 21:6097489-6097511 TAAATAAGCATTTCCTTACTAGG + Intergenic
1178044117 21:28675026-28675048 TAATGAATCATTTAGTTACTGGG - Intergenic
1179071062 21:38071444-38071466 TAATTAAGGTCTGAGTTACTTGG - Intronic
1179745257 21:43440757-43440779 TAAATAAGCATTTCCTTACTAGG - Intergenic
1181295885 22:21838459-21838481 TGTATAAGCCCTTAGTTACTTGG + Intronic
950292883 3:11801296-11801318 TAAATAATCACTTAATCACTGGG + Intronic
953115576 3:39989523-39989545 TAACAAAGCACTTTGTCCCTTGG + Intronic
955963364 3:64363498-64363520 TAACTGAGCAGTCAGTGACTGGG - Intronic
959452769 3:106523501-106523523 TAACAAAGCACTTTGTCCCTTGG - Intergenic
963146106 3:141996747-141996769 TAACTAAGGTCTTAAATACTTGG - Intronic
966250449 3:177859952-177859974 TAACAAAGCACTTTGTCCCTTGG + Intergenic
970288007 4:14539641-14539663 TAACGAAGCACTTTGTTCCTTGG - Intergenic
972364294 4:38359844-38359866 TACCTGAGCACATAGTTATTTGG - Intergenic
972875795 4:43358124-43358146 TAAATAAGGACATCGTTACTAGG - Intergenic
973240541 4:47951679-47951701 TAACTAAGAAACTAGTTTCTAGG + Intronic
973535085 4:51872951-51872973 CACCTAAGCACTTAGTGAATGGG + Intronic
974760441 4:66266927-66266949 TAACAAAGCACTTTGTCCCTTGG - Intergenic
974885274 4:67810002-67810024 TAATGAAGCACTTTGTTCCTTGG - Intergenic
978561799 4:110041879-110041901 TAACTAAGTATATATTTACTGGG + Intergenic
979197781 4:117941304-117941326 TAACAAAGCACTTTGTCCCTTGG + Intergenic
984984732 4:185316987-185317009 TATCCAAGTCCTTAGTTACTAGG + Intronic
987549047 5:19354796-19354818 CAATTAAGAACTTAGTTTCTCGG + Intergenic
987834645 5:23145943-23145965 TAACAAAGCACTTTGTCCCTTGG + Intergenic
989092104 5:37743909-37743931 TAACGAAGCACTTTGTCCCTTGG - Intronic
989255257 5:39359324-39359346 TGACTAAGCAATTGGTCACTGGG + Intronic
990139029 5:52682190-52682212 TAACGAAGCACTTTGTCCCTTGG + Intergenic
990735355 5:58854696-58854718 AATCTTAGCACTTAGTTACCAGG - Exonic
991144777 5:63287805-63287827 TAAATAATAACTTAGTTACTTGG + Intergenic
993117208 5:83733487-83733509 TAACAAAGCACTTTGTCCCTTGG + Intergenic
993587270 5:89746723-89746745 TAACAAAGCACTTTGTCCCTTGG + Intergenic
997289352 5:132715167-132715189 TCACTCAGCACTTAATGACTGGG + Intronic
998755560 5:145375479-145375501 TAACGAAGCACTTTGTCCCTTGG + Intergenic
1000110701 5:158105600-158105622 TAACTCAGCAAATACTTACTGGG - Intergenic
1011611770 6:89158798-89158820 TTACTAAGTACTTAGTTATCTGG + Intronic
1011944241 6:92880885-92880907 TAACAAAGCACTTTGCCACTTGG - Intergenic
1013249976 6:108324466-108324488 TAAGTGACCAGTTAGTTACTGGG + Intronic
1014002428 6:116379665-116379687 TAACAAAGCACATAGATAATGGG - Intronic
1014369217 6:120584123-120584145 TAACAAAGCACTTTGTCCCTTGG + Intergenic
1016513531 6:144869624-144869646 CCACTAATCACTTAGTTAATTGG + Intergenic
1016907760 6:149168672-149168694 AAAGTAAGAACTTAGTTACCAGG - Intergenic
1017961231 6:159222878-159222900 TGAGAAAGCACTGAGTTACTTGG + Intronic
1018496077 6:164347082-164347104 TAATTAACCCCTTAGTTTCTGGG - Intergenic
1018603734 6:165575998-165576020 TAACTAATCCGTTAGTTTCTTGG + Intronic
1018784179 6:167095162-167095184 TTACTAAGCACCTAGCAACTTGG + Intergenic
1020633729 7:10671902-10671924 TAACAAAGCACTTTGTCCCTTGG + Intergenic
1026241668 7:68580948-68580970 TAACTAAACAATTAGTTGCTTGG - Intergenic
1031402344 7:121340446-121340468 TAACTTAGCAGTTAGTTATATGG + Exonic
1031804644 7:126292989-126293011 TAACAAAGCACTTTGTCGCTTGG - Intergenic
1032776871 7:135122526-135122548 TAACGAAGCACTTTGTCCCTTGG - Intronic
1032919977 7:136534415-136534437 TAACGAAGCACTTTGTCCCTTGG - Intergenic
1037807220 8:22065363-22065385 TAGCTAAGCACTTGATTACAGGG - Intronic
1038243283 8:25830656-25830678 TAATGAAGCACTTTGTTTCTTGG + Intergenic
1040614135 8:49018053-49018075 TAACAAAGCACTTTGTCCCTTGG + Intergenic
1041240419 8:55844629-55844651 TGGCTGTGCACTTAGTTACTTGG + Intergenic
1043223784 8:77699208-77699230 TAACTAAGCACTGTGTCCCTTGG + Intergenic
1044356090 8:91224692-91224714 TAACAAAGCACTTTGTCCCTTGG + Intronic
1044893519 8:96863148-96863170 TGAATAAGAACTTAGTTTCTAGG + Intronic
1051283157 9:15463980-15464002 TAACTAAGAAATTATTTCCTTGG + Exonic
1056022554 9:82455713-82455735 TAATTAATCAATTATTTACTGGG + Intergenic
1058374365 9:104305539-104305561 TAATGAAGCACTTTGTTCCTTGG - Intergenic
1059845697 9:118273866-118273888 TAAATAAGCATTAAGTTACCAGG - Intergenic
1186472659 X:9833528-9833550 TAACTAAGTGCTTAGTTATGAGG - Intronic
1186472660 X:9833533-9833555 TAACTAAGCACTTAGTTACTAGG + Intronic
1187820793 X:23285787-23285809 GAACTAAGCAATTAATGACTTGG + Intergenic
1193039354 X:76987975-76987997 TAACAAAGCACTTTGTCTCTTGG - Intergenic
1193336081 X:80291183-80291205 TAATTATGCACTTAATTATTAGG + Intergenic
1194021994 X:88702378-88702400 TAACAAAGCACTTGGTCCCTTGG + Intergenic
1195140781 X:101957496-101957518 TAGCTAAGCCATTAGTTAATGGG + Intergenic
1198724449 X:139662661-139662683 TACCCAAGCACTTGGGTACTTGG - Intronic