ID: 1186472661

View in Genome Browser
Species Human (GRCh38)
Location X:9833550-9833572
Sequence ACTAGGACATTGAGCGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472658_1186472661 11 Left 1186472658 X:9833516-9833538 CCTAATTAGGGACCTCATAACTA 0: 1
1: 0
2: 1
3: 1
4: 57
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472657_1186472661 14 Left 1186472657 X:9833513-9833535 CCTCCTAATTAGGGACCTCATAA 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472659_1186472661 -1 Left 1186472659 X:9833528-9833550 CCTCATAACTAAGCACTTAGTTA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472651_1186472661 30 Left 1186472651 X:9833497-9833519 CCACCCCTGCATCGGACCTCCTA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472652_1186472661 27 Left 1186472652 X:9833500-9833522 CCCCTGCATCGGACCTCCTAATT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472653_1186472661 26 Left 1186472653 X:9833501-9833523 CCCTGCATCGGACCTCCTAATTA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1186472654_1186472661 25 Left 1186472654 X:9833502-9833524 CCTGCATCGGACCTCCTAATTAG 0: 1
1: 0
2: 0
3: 3
4: 31
Right 1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472661 Original CRISPR ACTAGGACATTGAGCGCTGA AGG Intronic
902656713 1:17874117-17874139 ACTAAGACATGGAGGGATGAAGG + Intergenic
902692975 1:18121794-18121816 ACTTGGACATTGAGAGCCAATGG - Intronic
911881029 1:103238130-103238152 ACAATGTCATTGAGTGCTGATGG + Intergenic
919545124 1:198906577-198906599 ACTAGTACATTGTGCTCTCATGG - Intergenic
1065480898 10:26192990-26193012 TCTAGGACTTTGAGAGCTAAGGG - Intronic
1069913059 10:71771527-71771549 CCTAGGACAGTGTGCACTGAGGG - Intronic
1083328558 11:61886108-61886130 ACCAGGACATTGAGGGGTGCTGG - Intronic
1083425249 11:62581015-62581037 ACTAAGACATGGAGAGCTAAAGG + Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1098577803 12:72063530-72063552 ACCAGGACATTGAGGGCACAAGG + Intronic
1106320606 13:28634409-28634431 ACCAGGGTATTGAGAGCTGAGGG - Intergenic
1125195023 15:37035897-37035919 AGTAGCACATTGAAAGCTGAAGG - Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126373347 15:47970164-47970186 ACTGGGACAATGGGCTCTGAAGG + Intergenic
1127798715 15:62459455-62459477 ACTAGGACATTCAGGGCTTGAGG - Intronic
1149488832 17:57067260-57067282 AATAGCACATTTAGCACTGAAGG - Intergenic
1157555618 18:48611127-48611149 ACTGGGACCTTGGGGGCTGAAGG - Intronic
1161347954 19:3777443-3777465 ACTTGGACCTTGAGGGCTGTTGG + Intergenic
925833360 2:7918154-7918176 AAGAGGACATGGAGAGCTGATGG - Intergenic
930613553 2:53570108-53570130 ACGGGGACATTTAGTGCTGATGG - Intronic
1169746194 20:8945543-8945565 ACTAGGAAATTCAACCCTGAAGG + Intronic
1173789646 20:45819660-45819682 AGAAGGAAATTGAGCCCTGAGGG + Intergenic
959146797 3:102556647-102556669 AGGAGGACATTGAGCATTGAGGG + Intergenic
962462598 3:135628406-135628428 ACTTGGACCTTGAGGGATGAAGG - Intergenic
975223234 4:71838561-71838583 ACTAAGACATTGAACCCTGTGGG + Intergenic
980897705 4:138875632-138875654 ACTTGGCCTTTTAGCGCTGAAGG + Intergenic
981066565 4:140492298-140492320 ACTGGGACATTTGGAGCTGAAGG - Intronic
1004578357 6:16922434-16922456 ACCAGGACATTGACCTCTGCTGG + Intergenic
1009461878 6:63922956-63922978 ATGAGGACATTGAGGCCTGAGGG - Intronic
1018778460 6:167041439-167041461 ACTAAGACATGAAGAGCTGAAGG - Exonic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021205391 7:17773785-17773807 TCTAGGACATTGAGAGCACAAGG - Intergenic
1022312416 7:29209577-29209599 AGTAGGACAGTGAGGGTTGAAGG + Intronic
1029061053 7:97798234-97798256 ACTTGGACATTGAACCCTGGCGG - Intergenic
1029464931 7:100719586-100719608 ATGAGGACATTGAGGGCTCAAGG + Intergenic
1034081258 7:148279679-148279701 ACTAGGACATTGATCGTTACTGG + Intronic
1039790427 8:40871610-40871632 ACCAGGACATGGAGCAATGAAGG + Intronic
1055295364 9:74827684-74827706 ACTAGGAGAGTGAGCTCTGATGG + Intronic
1062419487 9:136472985-136473007 ACAAGGACATTCAGCTCTGCTGG - Intronic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1196383023 X:115114149-115114171 ACTAAGACATGGATCGCAGAAGG - Intronic
1197358339 X:125465849-125465871 ACTAGGGCATTGGTTGCTGAAGG + Intergenic