ID: 1186472777

View in Genome Browser
Species Human (GRCh38)
Location X:9834265-9834287
Sequence AGGCTTCCCCAGCACTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186472777_1186472784 6 Left 1186472777 X:9834265-9834287 CCAGGAGAGTGCTGGGGAAGCCT 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1186472784 X:9834294-9834316 AGGAGGTGGTGTCCTCCAGAGGG 0: 1
1: 0
2: 5
3: 21
4: 247
1186472777_1186472785 9 Left 1186472777 X:9834265-9834287 CCAGGAGAGTGCTGGGGAAGCCT 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1186472785 X:9834297-9834319 AGGTGGTGTCCTCCAGAGGGAGG 0: 2
1: 1
2: 1
3: 14
4: 167
1186472777_1186472781 -8 Left 1186472777 X:9834265-9834287 CCAGGAGAGTGCTGGGGAAGCCT 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1186472781 X:9834280-9834302 GGAAGCCTGTCAGGAGGAGGTGG 0: 1
1: 3
2: 5
3: 109
4: 971
1186472777_1186472783 5 Left 1186472777 X:9834265-9834287 CCAGGAGAGTGCTGGGGAAGCCT 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1186472783 X:9834293-9834315 GAGGAGGTGGTGTCCTCCAGAGG 0: 1
1: 0
2: 3
3: 26
4: 253
1186472777_1186472787 19 Left 1186472777 X:9834265-9834287 CCAGGAGAGTGCTGGGGAAGCCT 0: 1
1: 0
2: 1
3: 22
4: 277
Right 1186472787 X:9834307-9834329 CTCCAGAGGGAGGAATCTGCTGG 0: 1
1: 0
2: 0
3: 14
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186472777 Original CRISPR AGGCTTCCCCAGCACTCTCC TGG (reversed) Intronic
900488245 1:2933606-2933628 AGGCTTCCCCAGCACGGCCCGGG - Intergenic
900938074 1:5779691-5779713 GGCCTTCCCCTGCACTTTCCTGG - Intergenic
901006016 1:6171862-6171884 TGGCTGCCCCACCACCCTCCTGG + Intronic
901088418 1:6625729-6625751 AGTCTGCTCCAGCACTCGCCCGG + Intronic
901788183 1:11638402-11638424 AGGGACCCCCAGCACTCTGCAGG - Intergenic
902043431 1:13508904-13508926 AGGCTCCCCCAGCAAGCCCCAGG + Intronic
902618455 1:17636804-17636826 AGGCTTCCCCTCCACTCCCCTGG + Intronic
902679929 1:18036187-18036209 AGGCCTCTCCAAAACTCTCCAGG + Intergenic
903368563 1:22819656-22819678 TGATTTCCCCATCACTCTCCAGG - Intronic
904254075 1:29243598-29243620 AAGCCTTCCCAGCCCTCTCCCGG + Intronic
904286531 1:29456261-29456283 AGGCTGCCCCAGCTCTCACCTGG - Intergenic
904366061 1:30011671-30011693 CGTCTTCCCCACCCCTCTCCTGG + Intergenic
904383622 1:30127678-30127700 AGGTCTCCCCAGCCCTCCCCTGG + Intergenic
904686578 1:32265316-32265338 AGGCCTCCCCGGCACTAGCCTGG + Intronic
905745647 1:40415079-40415101 AGGCTTCCCCAGAGCACTCTGGG + Intronic
909100566 1:71343162-71343184 GGGCTTCCCCTGCACACACCAGG - Intergenic
911097256 1:94064831-94064853 AGGCCTGCCCAGAACTCCCCTGG - Intronic
911104003 1:94116045-94116067 AGGCTTGTCACGCACTCTCCTGG + Intronic
912384818 1:109266007-109266029 AGGCCTCCCCAGGCCTCCCCAGG - Intronic
912454570 1:109788986-109789008 AGGCCGCACCAGCACTCTCTGGG - Intergenic
913698225 1:121348263-121348285 AGGCTTCCACAGGACTGCCCTGG + Intronic
914139324 1:144931789-144931811 AGGCTTCCACAGGACTGCCCTGG - Intronic
914788041 1:150851229-150851251 AGGCGCCCCCACCACCCTCCCGG - Intronic
915264868 1:154709579-154709601 AGGCCTCCCCAGCAGACTACAGG + Intronic
915534255 1:156525319-156525341 AGGATTCCCCAGTTCTCTCAGGG + Intergenic
917477159 1:175378755-175378777 TGGTTTCCCCTGCCCTCTCCAGG - Intronic
920361181 1:205417565-205417587 TGGCTACCCCAGGCCTCTCCTGG - Intronic
920485624 1:206366919-206366941 AGGCTTCCACAGGACTGCCCTGG + Intronic
920517919 1:206600177-206600199 AGGCTTCCCCAGCATCCATCTGG + Intronic
922209521 1:223476888-223476910 TGTCATCCCCAGCACTCTGCTGG + Intergenic
922359959 1:224812124-224812146 ATGTGTTCCCAGCACTCTCCTGG - Intergenic
922890364 1:229057492-229057514 AGGCTGGACCAGCACTCTCAGGG - Intergenic
923409110 1:233689968-233689990 AGGTTTGCCCAGAACTATCCTGG - Intergenic
1062860305 10:805197-805219 CGGCGTCCCCTGCACCCTCCAGG - Intergenic
1063565706 10:7171107-7171129 GGTCCTCTCCAGCACTCTCCAGG + Intronic
1064160431 10:12940863-12940885 AGGCTTACCCAGCACTGTCCAGG + Intronic
1064850213 10:19701352-19701374 ATGATTCCCCAGAACTATCCGGG - Intronic
1065186140 10:23172722-23172744 CAGCTTCCCCAGCTCCCTCCTGG + Intergenic
1069389677 10:67920310-67920332 AGGCTTACCATGCACTCTTCAGG + Intergenic
1072019368 10:91383050-91383072 TGGCTTCCAAAGCACTGTCCAGG - Intergenic
1072256335 10:93624852-93624874 AGGCCTCACCAGCACGCTGCAGG - Intronic
1072660449 10:97360520-97360542 AGGCTTCCACTCCTCTCTCCTGG - Intronic
1074870039 10:117569189-117569211 AGCTTCCCCCAGCAGTCTCCAGG - Intergenic
1075585763 10:123656976-123656998 GGGCTTCCCCAGTAGTCTGCTGG + Intergenic
1076114625 10:127886680-127886702 AGGCTTGCCCAGTCTTCTCCTGG - Intronic
1076568306 10:131413593-131413615 AGGGTTCCCCAGGGTTCTCCAGG - Intergenic
1076833560 10:133008777-133008799 AGCATCCCCCTGCACTCTCCTGG + Intergenic
1077184569 11:1230411-1230433 GGGCATCCCCAGCACACTTCTGG + Intronic
1080388324 11:31823310-31823332 AGACTTCCCCAGAAATCTCATGG - Intronic
1080450417 11:32374647-32374669 AGGGCTCCCCAACACGCTCCCGG + Intergenic
1083314037 11:61803157-61803179 AGGCCAGCCCAGCATTCTCCAGG + Intronic
1083486897 11:62988729-62988751 GGGATTCCCCAGCAGCCTCCTGG + Intergenic
1086142971 11:83519225-83519247 AGTCTTCCCTAGCACTCAGCAGG + Intronic
1090911374 11:131122555-131122577 GTGCTCCCCCAGCACTCTCTCGG - Intergenic
1091121382 11:133060698-133060720 AGGCTTTCTCAGCACCCTTCAGG - Intronic
1091410338 12:235014-235036 AGGCTTTCCCTGCACTCTGACGG - Intronic
1093967688 12:25344924-25344946 AGGCTCCCTCAGCACCCTTCTGG - Intergenic
1094064856 12:26351383-26351405 GGGCCTGCCCAGCATTCTCCCGG + Intronic
1097240109 12:57569292-57569314 AGGATTCTCCAGGACTCTCTCGG + Exonic
1097244364 12:57598905-57598927 AAGCTTCCCCAAAACACTCCAGG - Intronic
1098630620 12:72717310-72717332 GGGCTTTCTTAGCACTCTCCAGG - Intergenic
1100981445 12:100165855-100165877 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1102149149 12:110676713-110676735 AAGCTTCCAGAGCCCTCTCCTGG - Intronic
1102965150 12:117119995-117120017 TGGCTCCCCCAGCAGTGTCCAGG - Intergenic
1103472279 12:121191449-121191471 AGGCCTCCCCAGCCCTCCCCAGG + Intergenic
1104540498 12:129660076-129660098 GGGCTTTCCCATCACCCTCCTGG - Intronic
1105247439 13:18666100-18666122 AGGCTTCCACAGCAGCTTCCCGG - Intergenic
1105278197 13:18948366-18948388 AGGCTTCCCCACCACTCACGTGG + Intergenic
1105794226 13:23834376-23834398 AGGCCTCCCCAGCAGTCTAGAGG + Intronic
1108361019 13:49668010-49668032 GGGCTTCACCAGCAATCCCCAGG + Intronic
1108604381 13:52022525-52022547 AGGCTTCCCCAGCATCCTGTGGG + Intronic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1112579306 13:100664573-100664595 TGGCTTCCCCCGAACTCTGCAGG + Intronic
1113045769 13:106153047-106153069 AGGATTCCCCAGGACACTTCAGG - Intergenic
1113656461 13:112070988-112071010 GGGCCTCCCCAGTCCTCTCCGGG + Intergenic
1119622106 14:76138927-76138949 AGGCTCCCCCAGGCCTCGCCGGG + Intergenic
1120941655 14:89955784-89955806 AGGTTTCCCCAGCCCCGTCCTGG + Intronic
1121323444 14:93006256-93006278 AAGCTTCCCCAGCCCTTCCCAGG - Intronic
1121327714 14:93031184-93031206 ATTCTTCCCCAGGTCTCTCCTGG - Intronic
1121345075 14:93129594-93129616 ATGCTTCACCAGCCCCCTCCTGG + Intergenic
1121702178 14:95962819-95962841 AGGCTTACCCAGGACCTTCCTGG - Intergenic
1122267664 14:100554208-100554230 AGGCCTCCCCCGCAGCCTCCAGG - Intronic
1122609643 14:102973153-102973175 AGGCCTCCCCAGGCCTCTCTGGG + Intronic
1122715198 14:103692520-103692542 CGGCGTCCCCAGCCCTCTGCAGG - Intergenic
1122720546 14:103719630-103719652 AGGCTTTCCCAGCACACTGCAGG + Intronic
1123473167 15:20569516-20569538 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123644839 15:22430837-22430859 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1123733468 15:23164527-23164549 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123751598 15:23361902-23361924 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124283971 15:28385827-28385849 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124298726 15:28525787-28525809 AGGTGACCCCAGCACCCTCCAGG - Intronic
1126860037 15:52874417-52874439 AGGCTTCTCTAGCACTCCCTGGG + Intergenic
1127719014 15:61681469-61681491 AGGCTTCCCCACCACATCCCAGG - Intergenic
1128902321 15:71435817-71435839 AGACTTTCCCAGCACTAACCAGG + Intronic
1129839613 15:78735569-78735591 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130259451 15:82344128-82344150 AGGTGACCCCAGCACCCTCCGGG - Intronic
1130269227 15:82435040-82435062 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130281815 15:82525057-82525079 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130473182 15:84241220-84241242 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130480597 15:84355285-84355307 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130484792 15:84392721-84392743 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130491115 15:84432474-84432496 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130502699 15:84511274-84511296 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130595467 15:85245810-85245832 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1131117923 15:89805771-89805793 GGGCTTCCCCACCCCTCACCAGG - Intronic
1131188103 15:90292572-90292594 AGGTGACCCCAGCACCCTCCAGG + Intronic
1131282682 15:91033893-91033915 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1131967203 15:97857142-97857164 AGGCTTCTCCATATCTCTCCTGG - Intergenic
1132503727 16:296629-296651 AGCCTTCCCCAGCCCTCAGCAGG + Intronic
1133201165 16:4205548-4205570 AGGCCTCCCCAGGTCTCTGCTGG + Intronic
1133915405 16:10105143-10105165 AGGCTTCTCCAGGCTTCTCCAGG - Intronic
1133915409 16:10105153-10105175 TGGCTTCCCCAGGCTTCTCCAGG - Intronic
1136524611 16:30820973-30820995 TGGCTTCCTCGGCCCTCTCCGGG - Intergenic
1136639630 16:31552707-31552729 GGCCTTCCCCAGCCCCCTCCAGG + Intergenic
1136665128 16:31803794-31803816 GGCCTTCCCCAGCCCCCTCCAGG - Intergenic
1136681993 16:31973057-31973079 AGGCATGCCCAGCTCTGTCCTGG + Intergenic
1136782300 16:32914559-32914581 AGGCATGCCCAGCTCTGTCCTGG + Intergenic
1136887486 16:33939292-33939314 AGGCATGCCCAGCTCTGTCCTGG - Intergenic
1137720829 16:50626434-50626456 AGGCCTCCCCTGGACCCTCCAGG - Intronic
1203084965 16_KI270728v1_random:1178546-1178568 AGGCATGCCCAGCTCTGTCCTGG + Intergenic
1142551806 17:745394-745416 CTGCTTCTCCAGCAGTCTCCTGG + Exonic
1142608862 17:1096914-1096936 CCCCTTCCCCAGCTCTCTCCCGG - Intronic
1143291049 17:5829329-5829351 AGGCTTCCAAATCAATCTCCTGG + Intronic
1146890097 17:36501308-36501330 TGGCCTCCCTAGCACTCTACAGG + Intronic
1147448711 17:40490563-40490585 AGCCTGCCCCAGCCCGCTCCTGG + Intronic
1147996337 17:44362306-44362328 AGTCTCCCCCAGCTCTCTCGGGG - Intronic
1148348791 17:46923333-46923355 AGGCATCCCCAGCAGTGCCCTGG - Intronic
1148552835 17:48560764-48560786 AGGGTGCCACAGCACTCTACCGG - Intronic
1150867500 17:68868916-68868938 AGTCATTCACAGCACTCTCCAGG - Intronic
1151241900 17:72764632-72764654 AGTCTGCCCCAGCCCTCACCGGG - Intronic
1151575888 17:74952400-74952422 AGGCTTGCCCCGCAGCCTCCGGG - Intronic
1151756754 17:76079623-76079645 AGGAGACCCCAGCACTATCCAGG - Intronic
1151954555 17:77373884-77373906 AGGCTGCCTCGGAACTCTCCAGG + Intronic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1152776634 17:82206034-82206056 AGGCGTCCCCAGCAAGCACCTGG + Intronic
1152818188 17:82421233-82421255 GGGCCTCCCCTGCACCCTCCTGG - Intronic
1153199670 18:2635370-2635392 AGCCTTTCCCAGCCCTTTCCAGG - Intergenic
1153605206 18:6826610-6826632 AGCCTGCCCCAGCACACTCTGGG + Intronic
1153667489 18:7379321-7379343 AGGACTCCCCAGCAATCCCCAGG + Intergenic
1156510410 18:37631898-37631920 AGTCATCTTCAGCACTCTCCTGG + Intergenic
1157723627 18:49945498-49945520 AGGACTACCCAGCTCTCTCCTGG + Intronic
1158667794 18:59448565-59448587 ACGGTTCCCCAGCACACTCAGGG + Intronic
1159398308 18:67893917-67893939 AGCCTTCCCCATCAATCTCCAGG - Intergenic
1160205723 18:76829814-76829836 AGGCCTTCCCCGCACTGTCCTGG + Intronic
1160610183 18:80078374-80078396 AGCCTTTCCCAGCCCTCTACAGG - Intronic
1160797872 19:954108-954130 AGGGCCCCCCAGCACCCTCCTGG - Intronic
1162081860 19:8222862-8222884 AGGCTTTCCCACCACCCTCATGG - Intronic
1164050773 19:21584608-21584630 AGGCTTTCACAGGACTTTCCAGG - Intergenic
1164185127 19:22859779-22859801 AAGCTTCCCCAGTACTTACCTGG - Intergenic
1164978482 19:32593692-32593714 AAGCTGCTCCAGCACTCTTCAGG + Intergenic
1166295688 19:41888190-41888212 AGGCCTCCCCAGGCCCCTCCCGG + Exonic
1166932313 19:46308651-46308673 GGGCCTCCCCAGCCCTGTCCAGG + Exonic
1167525855 19:49983376-49983398 AGTCTTCCCCAGACCCCTCCAGG + Intronic
1167659285 19:50786393-50786415 ATGGCTCCCCAGCACCCTCCGGG - Intergenic
1167728541 19:51235673-51235695 AGGATGCCCCATCACTCACCGGG - Exonic
925211632 2:2053243-2053265 AGGCCTCCCCCACACTCTCTGGG - Intronic
926038493 2:9654252-9654274 AAGCTTCCACAGCACTTTCTAGG - Intergenic
929568854 2:43007089-43007111 AGGCTGCCTCAGCACCCTTCTGG - Intergenic
929756056 2:44766024-44766046 ACGCTTCCCCAACACAGTCCTGG - Intronic
929895217 2:45953786-45953808 TGGCTTTCTCAGCACTCTCCAGG + Intronic
936637591 2:114276909-114276931 ATGCTTCCCCTGGACTCCCCAGG - Intergenic
937429820 2:121828856-121828878 AGCCTGCCCCAGCACACTCTGGG - Intergenic
938299955 2:130203336-130203358 AGGCCTCCCCAGGCCTCTCTGGG - Intergenic
938456758 2:131471153-131471175 AGGCCTCCCCAGGCCTCTCTGGG + Intronic
939166042 2:138642312-138642334 AGGCTTCCTCACCACTCTGTAGG + Intergenic
941389156 2:164890337-164890359 AGGTTTCCCCAGCCTTCACCAGG - Intergenic
942087448 2:172456534-172456556 AGGTTTCCCCAGGACAGTCCTGG - Intronic
942987648 2:182161944-182161966 AGGCATCCCCAGCTCACTCCTGG - Intronic
945447456 2:209955095-209955117 AGGCTTCCCCATCCCTATCCTGG - Intronic
945884161 2:215357175-215357197 AGTCTTGTCCAGCAGTCTCCTGG + Intergenic
948244104 2:236463844-236463866 AGTCTTCGCCAGCACTTTCATGG - Intronic
948478847 2:238238510-238238532 AGGCTTCACCAGCCCTGTGCGGG - Exonic
948524988 2:238566085-238566107 AGGCTTCCCCCGCATACACCAGG - Intergenic
948925670 2:241095224-241095246 CACCTGCCCCAGCACTCTCCAGG + Exonic
1170231671 20:14054233-14054255 AAGTTTCCCCAGTATTCTCCAGG - Intronic
1171412007 20:24953718-24953740 AGGCTGCCCCGGCAGGCTCCTGG + Intronic
1172571418 20:35973879-35973901 AAGTTTCCCCAGCAATCACCTGG + Intronic
1174130972 20:48343140-48343162 TGGCTTCCCCAGAAATCTGCTGG + Intergenic
1174148218 20:48467460-48467482 AGGTTTGCCCAGAACTCTCTTGG + Intergenic
1174891139 20:54395841-54395863 TGGCTTCCCCAGCGCTCACTGGG - Intergenic
1174974429 20:55315819-55315841 TGGCTTCCAAAGCACTCTCTAGG - Intergenic
1175212910 20:57372752-57372774 AGGCTTCCCCTGAACTCACACGG + Intronic
1175864859 20:62169984-62170006 AGGCGGCCCCAGCACTGCCCAGG - Intronic
1176098700 20:63355484-63355506 GGGCTTCCTCACCCCTCTCCAGG + Intronic
1176666868 21:9695869-9695891 AGCCTTCCCAAGCTCTGTCCAGG - Intergenic
1178405605 21:32320834-32320856 AGACTTCCACAGCAATCTCTGGG + Intronic
1178591613 21:33915740-33915762 TGGCTGCCCCAGCAGTGTCCGGG - Exonic
1180078431 21:45475102-45475124 AGGTTTCCCCAGCGCACGCCCGG - Intronic
1181417431 22:22770765-22770787 AGTCTTTCCCAACACTGTCCTGG + Intronic
1181538035 22:23556849-23556871 AGGCATCTCCAGCAGTCTCATGG - Intergenic
1181937397 22:26448665-26448687 AGGATTCCAAAGCACTCTCTGGG + Intronic
1181956046 22:26588988-26589010 AGCCTTCCCTGGCATTCTCCTGG - Intronic
1182483238 22:30623161-30623183 AGCTTTCCCTAGCACCCTCCTGG + Intronic
1183035659 22:35139262-35139284 ATGCTTCCCCTGCACTCTCGTGG - Intergenic
1183048999 22:35245829-35245851 AGGCTTCTGCTGCTCTCTCCTGG + Intergenic
1183334704 22:37240031-37240053 AGGGTTTCCCTGCCCTCTCCTGG + Intronic
1183614723 22:38937036-38937058 AGGGTGTCCCAGCCCTCTCCAGG + Intergenic
1184723364 22:46328931-46328953 GGGCTTCCCGAGCAGCCTCCAGG - Intronic
1184865619 22:47200436-47200458 AGGCATCCCCAGCAGTGACCTGG + Intergenic
1184878718 22:47291713-47291735 TGGCTTCCCCAGCCCTCTGCAGG - Intergenic
1185341628 22:50293669-50293691 AGGCTGCCCCACCACGGTCCGGG - Intronic
950726840 3:14922258-14922280 AGGCCTCTCCTGCACCCTCCAGG - Intronic
952189973 3:31012538-31012560 AGGCTTCCCCAGAACAATTCAGG - Intergenic
952838784 3:37627135-37627157 AGGCTCCCCTATCACTCTCTTGG + Intronic
953019903 3:39106898-39106920 AGGATTCTGCAGCACTCTCCCGG + Intronic
959392480 3:105793300-105793322 AAGCATGCCCAGCACTCTCTGGG + Intronic
961463161 3:127065840-127065862 GGCCTGCCCCAGAACTCTCCCGG - Intergenic
963106522 3:141652187-141652209 ATGCCTTCCCAGCACTGTCCCGG - Intergenic
963274792 3:143319273-143319295 AGGCTTCCTGAGTTCTCTCCTGG + Intronic
963954174 3:151234835-151234857 AGGGGTCACCATCACTCTCCTGG + Intronic
964772244 3:160236522-160236544 AGTCATCCCCAGCAGTCTCCTGG + Intronic
967224853 3:187281575-187281597 AGGCATCCCCAGCAGGCTGCAGG + Intronic
967448811 3:189598717-189598739 AGGCTGCGCCAACACTCTGCTGG - Intergenic
968108915 3:196026250-196026272 GGCCTTCCCCAGCAGTCCCCTGG - Intergenic
968487054 4:867800-867822 AAGCTTCTGCAGCACTCGCCAGG - Intronic
968648304 4:1750538-1750560 TGGCCTCCCCAGCACTGCCCTGG - Intergenic
969630125 4:8331019-8331041 TGGCTCCCCCTCCACTCTCCAGG + Intergenic
969964937 4:10984435-10984457 ATGCTTCCCCATGACTCTCTGGG - Intergenic
970104814 4:12569587-12569609 AGGCTTGCCCAGCCCTTCCCAGG - Intergenic
973771007 4:54206550-54206572 AGTCTTCTCCAGGACTCTCAAGG - Intronic
975723579 4:77270971-77270993 ACACTTCCCTAGCAGTCTCCTGG + Intronic
976224025 4:82781046-82781068 AGGCTTCTCCAGCCCTCCTCTGG - Intronic
981570166 4:146143114-146143136 TGGCTTCCCCAGCAGCTTCCTGG + Intergenic
981614966 4:146637100-146637122 CGCCTTCCCCAGCACTCTGGCGG + Intergenic
985470670 5:42457-42479 GGCCTTCCCCAGCAGTCCCCTGG - Intergenic
986311941 5:6557437-6557459 AGGCTTCACCAGGAGCCTCCTGG + Intergenic
986607638 5:9538007-9538029 AGGCTTCCTCAGCTCTCTTGTGG - Intronic
988348694 5:30072478-30072500 AGGAATCCACAGCACTTTCCAGG - Intergenic
993475451 5:88358554-88358576 AGGCTTCCTCAGCACCTGCCTGG + Intergenic
994157194 5:96516997-96517019 CGATTTCCCCAGCTCTCTCCTGG + Intergenic
995355045 5:111227633-111227655 TGCCTTCGCCAGCACTATCCAGG - Intronic
997304211 5:132826219-132826241 AGGCTGTCCCAGCCCTCACCCGG - Intronic
997475754 5:134141511-134141533 GGGCTTCCCCATCACTCAGCTGG - Intronic
997853609 5:137354383-137354405 AGGCTTCTCCAAGACTCCCCAGG + Intronic
999123714 5:149230501-149230523 TGGCTTTCCCAGCTCCCTCCTGG - Intronic
1002538029 5:179888898-179888920 TCTCTTCCCCAGCACTCACCTGG - Intronic
1004159859 6:13203906-13203928 AGTCTTCCCCAGCCTCCTCCAGG - Intronic
1006447503 6:34088009-34088031 AGGCCTCCCCAGGACTAGCCAGG + Intronic
1006639136 6:35480013-35480035 TGGCCTGCCCAGCACCCTCCTGG - Intronic
1006887552 6:37395232-37395254 AGGCTTCCACAGAGGTCTCCTGG - Intergenic
1007257028 6:40536644-40536666 AAGCTCTCCCAGCACTCTGCGGG - Intronic
1007691878 6:43707711-43707733 AGGCTGCCCCACCACTCTTCTGG - Intergenic
1011437283 6:87351760-87351782 TTGCTTCCCCAGCAGACTCCTGG + Intronic
1011493652 6:87917504-87917526 TGGCTTCCCCAGGACCTTCCTGG - Intergenic
1013171158 6:107637294-107637316 GTGCTTCCCAAGCAATCTCCTGG - Intronic
1013323452 6:109019359-109019381 AGATTCCCCCAGCACTCTGCTGG - Intronic
1013655725 6:112244386-112244408 AGACTTCCCCATCCCTTTCCTGG + Intronic
1019217323 6:170452300-170452322 AGGCTTCAGCAGCACCCTCCTGG - Intergenic
1019284614 7:217293-217315 AGGCTTGCCCAGGCCCCTCCTGG + Intronic
1019594339 7:1851448-1851470 AGGCGTCCCCAGCAGTGCCCAGG + Intronic
1020248288 7:6447643-6447665 TGGCTTCCCAAGCACTGTCGCGG - Intronic
1021730961 7:23595393-23595415 AGCCTTCCCCAGCTCTGTCAGGG - Intergenic
1021866960 7:24967715-24967737 AGGCTTCCCCCTTTCTCTCCTGG + Intronic
1022028511 7:26470310-26470332 TGTCATTCCCAGCACTCTCCAGG + Intergenic
1022863262 7:34390098-34390120 GGACTTTCCCAGCACTATCCAGG - Intergenic
1024710806 7:52012392-52012414 AGGCTTCTTCAGGACTCACCAGG + Intergenic
1025234248 7:57223176-57223198 AGGTTTGCCCAGAACTTTCCCGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029151606 7:98484294-98484316 AGGCTTCAGCAGCCCTCTCTTGG + Intergenic
1032468930 7:132164270-132164292 GGGGCTCCCCAGCACACTCCTGG + Exonic
1032484691 7:132276579-132276601 AGGTTTCCCCAGAAATCTGCAGG + Intronic
1032906473 7:136373221-136373243 AGACTTACCCAACATTCTCCTGG - Intergenic
1034421382 7:150992897-150992919 GGGGTACACCAGCACTCTCCAGG - Intronic
1036246965 8:7126203-7126225 AGGCTTCACCCGCCCTCTACAGG - Intergenic
1036598926 8:10240938-10240960 AGACTCCCCCAGCACCCACCAGG - Intronic
1036950051 8:13132283-13132305 AAACTACCCCAACACTCTCCAGG + Intronic
1037433725 8:18841326-18841348 GGGCCTCCCCAGCACTCCCAAGG - Intronic
1037565252 8:20112514-20112536 TGGCTTCCACAGCACTTTCCTGG + Intergenic
1037922314 8:22816048-22816070 AGGCCTCCCCAGCGGTCTCAGGG - Intronic
1042383781 8:68150224-68150246 AGGCTTTTCCAGGACTCCCCTGG + Intronic
1042563132 8:70088494-70088516 AGCTTTCCCCAGCACCCTACAGG - Intergenic
1044858270 8:96496849-96496871 AGGCTTTCCCAGCTGCCTCCAGG - Intronic
1048868050 8:138775300-138775322 AGCCATCCCCACCACTCCCCAGG + Intronic
1049147830 8:141014666-141014688 AGGATTCTCCTGCTCTCTCCTGG - Intergenic
1049687835 8:143946037-143946059 AGGCTTCCCCAGCACGTGGCAGG - Intronic
1054815031 9:69466506-69466528 AGGCTTCCCCTGCACTCTGGTGG + Intronic
1055345035 9:75326927-75326949 AGGCTTCCTTAGCACTGTCCGGG + Intergenic
1056769220 9:89464789-89464811 AGGCTTATCCAGCCCTCTCCAGG - Intronic
1057171315 9:92964920-92964942 AAGCTTCCTCTGCACTCTGCAGG + Intronic
1057274758 9:93670379-93670401 AGGCTTCCCCACCACTCACGTGG - Intronic
1059176846 9:112175541-112175563 TTTCCTCCCCAGCACTCTCCGGG - Intergenic
1059366025 9:113786937-113786959 GGGCTTCCCAAGCACCCTCTGGG - Intergenic
1059546637 9:115182558-115182580 AGAATTCCCCAGCTCTTTCCAGG + Intronic
1060243584 9:121925670-121925692 AGGCTCCCGCAGCTGTCTCCTGG + Intronic
1061062966 9:128259960-128259982 AGGTGACCCCAGCACCCTCCAGG - Intronic
1061406828 9:130396913-130396935 GGGCATCTCCAGCACCCTCCTGG - Intronic
1061733905 9:132639065-132639087 AGGCTATCCGAACACTCTCCAGG - Intronic
1061768049 9:132895021-132895043 AGCCTTTGCCAGCATTCTCCCGG + Exonic
1186472777 X:9834265-9834287 AGGCTTCCCCAGCACTCTCCTGG - Intronic
1186478460 X:9877602-9877624 AGACCTGCCCAGGACTCTCCAGG - Intronic
1187325020 X:18278574-18278596 AAGCTGGCCCAGCTCTCTCCTGG - Intronic
1187573407 X:20529191-20529213 AGCCATCCCCAGCACACTGCTGG + Intergenic
1189293782 X:39904552-39904574 AGGCTATCCCAGCTCTCCCCAGG + Intergenic
1190063475 X:47225129-47225151 AGGCTTCCCCAACCCACCCCTGG + Intronic
1191936996 X:66437180-66437202 TGGCTTTCCCACCTCTCTCCTGG - Intergenic
1192560624 X:72125723-72125745 AGGACTCCCCAGTACTCTTCAGG - Intergenic
1196032120 X:111102351-111102373 AGTCTTCCACAGTACTCCCCAGG - Intronic
1197739115 X:129875741-129875763 AGGCTTCCCTAGCAGTCACCAGG + Intergenic
1200162586 X:154017041-154017063 AGGCCTGCCCACCTCTCTCCTGG - Exonic
1202373306 Y:24212566-24212588 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1202497476 Y:25457554-25457576 AGGTGACCCCAGCACCCTCCAGG + Intergenic