ID: 1186473071

View in Genome Browser
Species Human (GRCh38)
Location X:9836226-9836248
Sequence CAGCTGCCCTTGGGTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 235}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186473061_1186473071 12 Left 1186473061 X:9836191-9836213 CCATGTCCCCTCTCCCAGCTCCT 0: 1
1: 1
2: 16
3: 203
4: 1803
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473062_1186473071 6 Left 1186473062 X:9836197-9836219 CCCCTCTCCCAGCTCCTCTTTTT 0: 1
1: 0
2: 12
3: 94
4: 1108
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473064_1186473071 4 Left 1186473064 X:9836199-9836221 CCTCTCCCAGCTCCTCTTTTTAG 0: 1
1: 1
2: 2
3: 61
4: 875
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473063_1186473071 5 Left 1186473063 X:9836198-9836220 CCCTCTCCCAGCTCCTCTTTTTA 0: 1
1: 0
2: 2
3: 66
4: 626
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473068_1186473071 -8 Left 1186473068 X:9836211-9836233 CCTCTTTTTAGTGGACAGCTGCC 0: 1
1: 0
2: 0
3: 4
4: 128
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473066_1186473071 -1 Left 1186473066 X:9836204-9836226 CCCAGCTCCTCTTTTTAGTGGAC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473060_1186473071 13 Left 1186473060 X:9836190-9836212 CCCATGTCCCCTCTCCCAGCTCC 0: 1
1: 0
2: 17
3: 131
4: 1232
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235
1186473067_1186473071 -2 Left 1186473067 X:9836205-9836227 CCAGCTCCTCTTTTTAGTGGACA 0: 1
1: 0
2: 2
3: 20
4: 155
Right 1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG 0: 1
1: 1
2: 0
3: 20
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186473071 Original CRISPR CAGCTGCCCTTGGGTAAAAG TGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
902121300 1:14168237-14168259 CAGCTTCTGTTGGGTCAAAGTGG + Intergenic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
905340141 1:37272552-37272574 CAGCTTCCCTGGGGTATCAGGGG + Intergenic
905350266 1:37341001-37341023 CAGCTGCCCTTGCCTGGAAGTGG - Intergenic
906843160 1:49161283-49161305 CAGCTTCCCTTGGTTAGGAGAGG + Intronic
907512587 1:54972857-54972879 CATCAGCCCTTGGGTGAATGGGG + Intergenic
909017980 1:70400128-70400150 TGGCTGCCTTTGGGAAAAAGGGG + Intergenic
909735339 1:78952346-78952368 CAGCTGCATTGGGGAAAAAGAGG - Intronic
910030524 1:82716284-82716306 CAGTTGGCTTTGGGGAAAAGGGG - Intergenic
910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG + Intergenic
912148154 1:106820189-106820211 CAGCAGCCCTGGGGAAAAAAGGG - Intergenic
915153229 1:153852278-153852300 CAGCTGCCCCTTGCTAGAAGTGG + Intronic
916612870 1:166410138-166410160 CAGCTTCCCTTGGCTAGTAGAGG + Intergenic
917266603 1:173227677-173227699 CAGCTTCCCTTGGGTAGGAAAGG - Intergenic
919748870 1:201024428-201024450 GAGCTGCCCTGGGGGAAAGGAGG + Intergenic
920382191 1:205541638-205541660 GAGGTGCCCTTGGGGAAAATGGG - Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921098728 1:211910238-211910260 CAGGGGCCCCTGGGTAGAAGTGG + Intergenic
922384933 1:225073246-225073268 CAGCTGACTGGGGGTAAAAGTGG - Intronic
922715944 1:227872098-227872120 CAGCTTCCCTTGGCTAGAGGAGG - Intergenic
923773126 1:236955173-236955195 CATCTGCCTGTGGGGAAAAGTGG + Intergenic
1067332341 10:45333856-45333878 CAGCTTCCCTTGGCTAACAGGGG + Intergenic
1067762015 10:49055545-49055567 CAGCTGACCTTGGGGAGAAGGGG - Intronic
1071427211 10:85571240-85571262 CAGCTGGCTTTGAGGAAAAGAGG + Intergenic
1072320811 10:94247848-94247870 TAGCATCCCTTGGGGAAAAGAGG + Intronic
1073884126 10:108019097-108019119 CAGCTTCCCTTGGCTAGAGGAGG - Intergenic
1075364089 10:121867501-121867523 CATCTAACCTTGGGAAAAAGGGG - Intronic
1077490942 11:2860712-2860734 CAGTTTCCCTTAGGTAAATGGGG - Intergenic
1078852332 11:15176089-15176111 CAGCTGCCCTGGGATAGGAGTGG + Intronic
1080800904 11:35609415-35609437 CTTCTGCTATTGGGTAAAAGAGG - Intergenic
1083385594 11:62306892-62306914 CAGCTTCCCTTGGCTAGAGGAGG + Intergenic
1083776502 11:64896670-64896692 AAGCTGCCATTGGGAATAAGAGG - Intronic
1083898174 11:65630699-65630721 CAGCTTCCCTTGGACAAAACAGG - Intronic
1084515997 11:69638286-69638308 CAGCCGCCCTGGTGGAAAAGCGG + Intergenic
1087332106 11:96793456-96793478 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1087484831 11:98748093-98748115 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
1088842030 11:113635401-113635423 CAGCTGCTCTGGGGTGAGAGGGG - Intergenic
1092690840 12:11108577-11108599 CAGCTTCCCTTGGCTAGGAGAGG - Intronic
1094677884 12:32638824-32638846 CAGATGCCCTTGGGGGCAAGGGG + Intronic
1095306344 12:40643106-40643128 CAGCTTCCCTTGGCTAGAAATGG + Intergenic
1095348033 12:41175822-41175844 CAGCTTCCCTTGGGTGAACAGGG - Intergenic
1095967753 12:47880264-47880286 CTCCTGCCCTTGGGTGACAGAGG + Intronic
1099437101 12:82658195-82658217 CAGCAGCCCTTGGATTCAAGAGG + Intergenic
1099799748 12:87442443-87442465 CAGCTGGCTTTGGGGAAAAGGGG + Intergenic
1103363148 12:120365869-120365891 CAGCTGCCCCTGGGAAAAGCGGG - Intronic
1105967278 13:25396367-25396389 TGGCTGGCCTTGGGGAAAAGGGG + Intronic
1109195858 13:59377031-59377053 CAGCTTCCCTTGGCTAGGAGAGG - Intergenic
1109675937 13:65675732-65675754 CAGCTTCCCTTGGCTAGAAAGGG + Intergenic
1110915961 13:81021176-81021198 GGGCTGCCCTTAGGTAAGAGGGG + Intergenic
1111627886 13:90813109-90813131 CAGCTTCCCTTGGCTAGGAGAGG - Intergenic
1113113849 13:106853891-106853913 CACCTGCCTTTGGTGAAAAGAGG + Intergenic
1117797059 14:59405647-59405669 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
1119168440 14:72514805-72514827 CCGCTGCCCTTGGGGAGGAGCGG + Intronic
1119611845 14:76070005-76070027 CAACTGCCCCTGGCTAGAAGTGG - Intronic
1120100665 14:80441456-80441478 CACCTGAGCTTGGGTAAATGAGG + Intergenic
1120128110 14:80771885-80771907 CAGCTATCCTTGGGTAGAAATGG - Intronic
1122773880 14:104108727-104108749 CGACTGCCCTTGGGTAGGAGTGG - Intronic
1130364825 15:83225465-83225487 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1133107119 16:3519227-3519249 CAGAGGCCCTTGGGCAACAGAGG - Intronic
1133505380 16:6406933-6406955 CTGCTGCCCATCGGTAAAATGGG + Intronic
1133506566 16:6418184-6418206 CAGCTACCCTTCGGTAAAATAGG - Intronic
1147129731 17:38400018-38400040 CAGCTGCCCATGGCAACAAGAGG - Exonic
1147896939 17:43757328-43757350 CAGCTGACCTTGCCTAGAAGGGG + Intronic
1148980973 17:51574615-51574637 CAGCTTCCTTTGGCTAAATGAGG - Intergenic
1149032653 17:52101538-52101560 CAGCTGCCCTTGAATAAATAAGG - Intronic
1149150889 17:53562385-53562407 CCACCGCCCTTGGGCAAAAGAGG - Intergenic
1149488917 17:57067906-57067928 CAGCTGTGCTTGGCTAGAAGGGG + Intergenic
1151699593 17:75736273-75736295 CAGATGCCCTGGGGTAGGAGGGG - Exonic
1152181834 17:78827119-78827141 AGGCTGCCCTTGGGTAGACGTGG - Intronic
1154101616 18:11479663-11479685 CAGCTTCCTTTGGCTAGAAGAGG + Intergenic
1154145510 18:11863220-11863242 CAGCTGCCCGAGGGTCGAAGGGG - Intronic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157859650 18:51129375-51129397 CAGTTGCCCTTGGGGAAGGGTGG + Intergenic
1158236536 18:55322169-55322191 CAACTGCCTTAGGGTAAAAGTGG + Intronic
1158567623 18:58568479-58568501 CAGCTGACCCTGGGTAACTGAGG - Intronic
1160567704 18:79797749-79797771 CAGCTGCCCTTGGGGGCAGGAGG - Intergenic
1161029083 19:2049762-2049784 CTGCTGCCCTAGGGGAAAACTGG + Intronic
1162035540 19:7936553-7936575 CAGCTGCTCATTGGTAAAATGGG + Intronic
1162604744 19:11697921-11697943 TGGCTGCCCTTGGGGAATAGGGG - Intergenic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1163297126 19:16419637-16419659 CAGCTCTCTTTTGGTAAAAGGGG - Intronic
1164126730 19:22325187-22325209 CAGCAGCCCTTGGATTCAAGAGG + Intergenic
1165341310 19:35214223-35214245 CAGCTGCCCTGGGGAATGAGGGG + Intergenic
1165446484 19:35859639-35859661 CAGCTGGCCCTGGGAAAGAGGGG + Intronic
1167998372 19:53425250-53425272 CAGCAGCTCTGGGGAAAAAGTGG + Intronic
1168562742 19:57397221-57397243 GAGCTGCCTTTGGGTAAAAAGGG - Intronic
927029110 2:19102176-19102198 CATCTGGCCTTGGGTCAGAGAGG + Intergenic
927560016 2:24063733-24063755 CAGGTGCCCTTGGGAAAGAGTGG + Intergenic
928223049 2:29421040-29421062 CAGCTGCCCTGGGATGAACGTGG - Intronic
929450671 2:42034964-42034986 AAGCTGCCCTTGAGGGAAAGTGG + Intergenic
929916704 2:46142573-46142595 CAGCTGCCCTTGGCTATGACTGG - Intronic
932870033 2:75389556-75389578 CAGCAGCCCTTGGATTCAAGAGG + Intergenic
933976269 2:87514630-87514652 CAGGTGCCCTCGGGGAAATGTGG - Intergenic
934104280 2:88681641-88681663 CAGCAGCCCTTGGATTCAAGGGG - Intergenic
935798717 2:106671114-106671136 CAGCTACTCCTGGCTAAAAGGGG + Intergenic
936317553 2:111436176-111436198 CAGGTGCCCTCGGGGAAATGTGG + Intergenic
936492396 2:112983531-112983553 CAGCTGGCCTTGGGAAGATGTGG + Intronic
938874494 2:135518488-135518510 CAGCTTCCCTTGGCTAAGGGAGG + Intronic
940079021 2:149779028-149779050 CTGCTGCCCATGGGTCGAAGAGG + Intergenic
940417889 2:153443279-153443301 CAGCTTCCGTTGGCTAAAGGAGG + Intergenic
940720778 2:157279725-157279747 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
945053929 2:205851301-205851323 CAGCTACCCTTGCGTTTAAGTGG - Intergenic
945945135 2:215988303-215988325 CAGCTTCCCTTGGCTAAGAGAGG - Intronic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
946892545 2:224293161-224293183 CATCTGTCCTTGGCCAAAAGAGG + Intergenic
948023708 2:234758686-234758708 CAGCTGGCCTTTCCTAAAAGTGG + Intergenic
948535615 2:238644293-238644315 CAGCTGCCCTTGGTGACAGGAGG + Intergenic
1169006182 20:2209016-2209038 CAGCTACCCTTTGTTGAAAGAGG - Intergenic
1170355968 20:15491762-15491784 AAGGAGCCCTTGGGTAAAAGGGG + Intronic
1173401093 20:42726545-42726567 CAGATGGCCTTTGGCAAAAGGGG + Intronic
1176718173 21:10372164-10372186 CAGCTGCAGATGTGTAAAAGTGG + Intergenic
1178864516 21:36316907-36316929 CAGCTTCCCTTGGGTAGAGGAGG + Intergenic
1180299400 22:11025076-11025098 CAGCTGCAGATGTGTAAAAGCGG + Intergenic
1183582568 22:38734666-38734688 CAGCTGCTCTTGGGCAGATGAGG - Intronic
1184303746 22:43580182-43580204 CAGAGGCCCTTGGGCAAGAGTGG - Intronic
949173945 3:1035359-1035381 CAGCTTCCCTTGGATAGGAGAGG + Intergenic
950990005 3:17424325-17424347 CAGCTGCCCTTGGGAAGAGGAGG + Intronic
951347306 3:21561377-21561399 CAGCTTCCCTTGGCTAGGAGAGG + Intronic
951741616 3:25931390-25931412 CAGCTTCCCTTGGCTAGGAGAGG - Intergenic
951772310 3:26272102-26272124 TGGCTGCCTTTGGGCAAAAGGGG - Intergenic
953673392 3:44981344-44981366 CTGCTTCCCTTGTGTAAAATGGG + Intronic
954212154 3:49103953-49103975 CAGCTGCCCTTGAGTATGTGCGG - Exonic
954488365 3:50876543-50876565 CAGCTGCATTTGGGGAAGAGGGG + Intronic
954524877 3:51261324-51261346 CAGCTTCCCTTGGGTAGGGGAGG - Intronic
954701024 3:52451026-52451048 AAGCGGCCATTGGGTAAGAGTGG + Intergenic
956916415 3:73876518-73876540 CGGCTGGCTTTGGGAAAAAGGGG + Intergenic
958736402 3:98014470-98014492 GAGCTGCCTTTGGGTAAGAAAGG + Intronic
958873458 3:99589082-99589104 CAGCTTCCCTTGGCTAGAAAGGG - Intergenic
959170860 3:102842189-102842211 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
959723836 3:109521995-109522017 CAGCTTCCCTTGGCTAGGAGAGG - Intergenic
962987095 3:140545739-140545761 CACTTGCACATGGGTAAAAGTGG + Intronic
963048519 3:141122850-141122872 CAGCTTCCCTTGGCTAGAAAAGG + Intronic
967760940 3:193225804-193225826 CAGTCGCCCTCGGGTAACAGTGG + Intergenic
968128561 3:196178124-196178146 GAGCTGCACTTGGGTCAAAGAGG + Intergenic
968408641 4:365238-365260 CAGCTTCCCTTGGCTAGGAGAGG + Intronic
968509388 4:988691-988713 CAGCTGCCCTGGGGAAACCGGGG - Exonic
968582011 4:1399552-1399574 CAGCCTCCCTTGGCTAAGAGAGG + Intergenic
969057715 4:4412548-4412570 CAGCTGCCCTTGGCCAAAGCTGG + Intronic
969076038 4:4578574-4578596 CAGAAGCCTTTGGGTAAAATAGG - Intergenic
969927902 4:10602398-10602420 CAGATGATCTTGGGTTAAAGTGG + Intronic
971168855 4:24212811-24212833 CAGCTTTCCTTGGGTAAGAATGG - Intergenic
973947447 4:55973186-55973208 CAGCTGACCATGTATAAAAGTGG - Intronic
974528546 4:63077268-63077290 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
974838027 4:67274110-67274132 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
975685327 4:76915362-76915384 CATCTGCCCTTGGGTTATACTGG - Intergenic
976263058 4:83164280-83164302 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
976506495 4:85853383-85853405 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
977425475 4:96862752-96862774 CAGCTTCCCTTGGCTAGAAGAGG - Intergenic
977633045 4:99264044-99264066 CTGCTTCCCTTGGGTAAGGGAGG + Intergenic
977897883 4:102384540-102384562 CAGCTTCCCTTGGGTAGGGGAGG + Intronic
978019027 4:103785790-103785812 CAGAAGCCCTTGGATAACAGTGG - Intergenic
978197166 4:105984963-105984985 CAGCTGCCCTTGGCTAGGAAAGG + Intronic
978694837 4:111565365-111565387 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
979417388 4:120460547-120460569 CAGCTTCCCTTGGTTAGGAGAGG - Intergenic
979461673 4:120990927-120990949 CAGCTTCCCTTGGCTAGAGGAGG + Intergenic
980053957 4:128062085-128062107 CAGCTGGCCCTGCGGAAAAGCGG + Intronic
981254757 4:142648405-142648427 CAGCTTCCCTTGGGTAGGAAAGG - Intronic
981629635 4:146804156-146804178 CAGCTTCCCTTGGCTAGATGAGG - Intronic
983388128 4:167092202-167092224 CAGCTTCCCTTGGCTAGGAGAGG - Intronic
984157889 4:176213928-176213950 AAGCTGCTTTTGGGTAAAACAGG - Exonic
984902878 4:184600602-184600624 CAGCTTCCCTTGGCTACAGGAGG - Intergenic
986877150 5:12125866-12125888 CAGCTGCCCTTGGCTAGGAAAGG - Intergenic
987962801 5:24832073-24832095 CAGATGACTTTGGGTAGAAGGGG + Intergenic
988860772 5:35275793-35275815 CAGTTGCCCTTGGGTAAAAGGGG - Intergenic
988931334 5:36038409-36038431 CAGCTGTCAGTGGATAAAAGAGG - Intronic
989111169 5:37907763-37907785 CTGCTGCCCTTGAGAAAATGTGG - Intergenic
990213264 5:53503704-53503726 CAGCTGGCTTTGGGTGACAGAGG - Intergenic
991105430 5:62837305-62837327 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
993864167 5:93172445-93172467 CAGCTTCCCTTGGCTAGAAAGGG + Intergenic
994233601 5:97336618-97336640 CAGCTTCCCTTGGGTAAGGGAGG + Intergenic
996100409 5:119439383-119439405 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
996547133 5:124691800-124691822 CAACTGTCGGTGGGTAAAAGGGG + Intronic
999426583 5:151492768-151492790 CAGTTGCCTTTAAGTAAAAGAGG + Intergenic
999530983 5:152463489-152463511 CGGCTGTCCTTGGATAAAGGAGG - Intergenic
1000996171 5:167960930-167960952 CAGCTTCCCTTGGCTAGAGGAGG + Intronic
1003228175 6:4225176-4225198 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1004696252 6:18035923-18035945 TAGATGCCCTTAGGCAAAAGTGG - Intergenic
1006680135 6:35791162-35791184 CCGCTGCCCTATGGGAAAAGTGG + Intronic
1006844131 6:37050925-37050947 CAGCTGCCCTTGGATATATCAGG - Intergenic
1007034304 6:38658981-38659003 CTGCTGTCCTAGGGTAGAAGTGG + Intergenic
1008053763 6:46925958-46925980 GAGCTGACCTTGGGTCAAAAGGG - Intronic
1008767974 6:54942701-54942723 CAGCAGCCTATGGGTAAGAGGGG - Intergenic
1010039218 6:71361563-71361585 CAGCTTCCCTTGGCTAGGAGAGG + Intergenic
1010665902 6:78629591-78629613 CAGCTGCCCTGTGGGAAAAGCGG - Intergenic
1011251573 6:85377425-85377447 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1011298995 6:85854134-85854156 CAGCTCCCCTTGGCTAAGGGAGG + Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1014177097 6:118342774-118342796 CAGCTTCCCTTGGCTAAGGGAGG + Intergenic
1014964090 6:127724969-127724991 CATTTGCCCTTGGGGAGAAGGGG - Intronic
1016510014 6:144831791-144831813 CATCTGCCCTTGGGTGACACTGG + Intronic
1016690191 6:146929127-146929149 AAGGTGCCCTTGGGAAAAAAGGG + Intergenic
1022615565 7:31926699-31926721 CAGCTTCCCTTGGCTAGAGGAGG - Intronic
1023066079 7:36379006-36379028 CAGCTGCCCTTGGCTAGGAAAGG + Intronic
1026237214 7:68537823-68537845 CATCCGTCCTTGGCTAAAAGGGG + Intergenic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1028909130 7:96188253-96188275 CAGCTGGCCTTGCTTAAAAGAGG - Intronic
1029105041 7:98167992-98168014 CAGCTGTGCTTGGGGAGAAGTGG + Intronic
1029845320 7:103406412-103406434 CAGCTTCCCTTGGCTAAGGGAGG + Intronic
1030166422 7:106560347-106560369 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1030705701 7:112690394-112690416 CAGCTTCCCTTGGGTAGGGGAGG + Intergenic
1032588331 7:133169252-133169274 CAGCTGCATTTGGGTTAGAGGGG + Intergenic
1033287773 7:140057317-140057339 CAAATGCCCTTGGCTAAAAGGGG + Intronic
1033351338 7:140564906-140564928 GGGCTGCCCATGGGTAAGAGAGG - Intronic
1037050169 8:14362602-14362624 CAGCTTCCCTTGGGTAGGAAAGG + Intronic
1039552222 8:38451418-38451440 CAGCTGCCTTTGGCCCAAAGGGG - Intronic
1040995591 8:53398167-53398189 CAGTTGACATTAGGTAAAAGAGG - Intergenic
1041378227 8:57223943-57223965 CAGAAGCCTTTGGGTAACAGTGG + Intergenic
1041810366 8:61902178-61902200 CAGCAGCCCTTGGATTCAAGAGG + Intergenic
1041943536 8:63416171-63416193 CAGTTGCCTTTGAGTAAAGGAGG - Intergenic
1043366389 8:79537671-79537693 CAGCTTCCCTTGTCTAGAAGAGG + Intergenic
1043371927 8:79604740-79604762 CAGCAGACTTTGGCTAAAAGAGG + Intergenic
1043511268 8:80952581-80952603 CAGCTTCCCTTGGCTAAAGGAGG - Intergenic
1045391614 8:101720885-101720907 TAGGTGCCCTTAGGGAAAAGGGG - Intronic
1047507054 8:125488261-125488283 CGTCTGCCCTTTGGTAAAATGGG + Intergenic
1047823838 8:128551547-128551569 CTGCTGCCCTTGGCTTAAATTGG - Intergenic
1048944426 8:139431194-139431216 CAGTTTCCCCTGGATAAAAGGGG + Intergenic
1049162400 8:141105750-141105772 TAGCTGCCTTTGGGAGAAAGGGG - Intergenic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1051199369 9:14599356-14599378 CAGCTTCCCTTAGCTAAGAGAGG - Intergenic
1053563073 9:39216333-39216355 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053674038 9:40403920-40403942 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1053828863 9:42054277-42054299 CAGCTGCCCCTGTGGAAAACTGG + Intronic
1053923841 9:43030287-43030309 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054134074 9:61402722-61402744 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1054385142 9:64543989-64544011 CAGCTACTCTGGGGGAAAAGAGG - Intergenic
1054510587 9:65972370-65972392 CAGCTACTCTGGGGGAAAAGAGG + Intergenic
1054601696 9:67133175-67133197 CAGCTGCCCCTGTGGAAAACTGG - Intergenic
1055210251 9:73782950-73782972 CAGCTTCCCTTGGCTAGAGGAGG - Intergenic
1055338717 9:75259584-75259606 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1055342476 9:75298945-75298967 CAGCTGCCATTATGTAAATGTGG - Intergenic
1056594353 9:87993949-87993971 TAGCTGGCTTTGGGGAAAAGGGG - Intergenic
1058559081 9:106204279-106204301 CAGCTTCCCTTGGCTAGAAAAGG + Intergenic
1059463704 9:114451883-114451905 CAGCTGCCCATCTGTAAAATAGG + Intronic
1059734491 9:117087746-117087768 CAGTTTCTCTTGGGTAAAGGAGG - Intronic
1186068696 X:5794098-5794120 CACCTCCCCTTGGCTAACAGAGG - Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1187380461 X:18797074-18797096 GAGCTGACATTGGGTAAAATGGG + Intronic
1188340722 X:28997999-28998021 CAGCTGCACTGAGGGAAAAGGGG - Intronic
1188811964 X:34661666-34661688 CAGCTAGCCTCGGGTAAAGGAGG - Intergenic
1189210875 X:39280935-39280957 CAGCTTCCCTTGGCTAGAGGAGG + Intergenic
1190385243 X:49878472-49878494 CAGCTGGCCTTGGAGAGAAGAGG + Intergenic
1190554817 X:51623358-51623380 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1191788833 X:64946328-64946350 CAGCTTCCCTTGGCTAGAACAGG + Intronic
1191809940 X:65175799-65175821 CAGCTTCCCTTGGCTAGGAGAGG - Intergenic
1192064346 X:67864982-67865004 CAGCTGCCTTTGGCTAGGAGAGG + Intergenic
1192568565 X:72183571-72183593 GAGGTGGCCTTGGGTAAAAGTGG + Intronic
1193001539 X:76568252-76568274 CAGCTTCCCTTGGCTAGAAAAGG - Intergenic
1193949265 X:87778321-87778343 CAGCTTCCCTTGGCTAAGGGAGG - Intergenic
1194203178 X:90979295-90979317 CAGCTTCCCTTGGTTAAGGGAGG + Intergenic
1194805963 X:98328387-98328409 CGGCTGGCTTTGGGGAAAAGGGG + Intergenic
1196571215 X:117268276-117268298 CGGCTTCCCTTGGCTAAAGGAGG - Intergenic
1197446775 X:126560136-126560158 CAGTTACAGTTGGGTAAAAGTGG - Intergenic
1201333504 Y:12853442-12853464 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
1201730043 Y:17193010-17193032 CTGCTGCCCTGGAGTAAAGGCGG + Intergenic
1201924298 Y:19267988-19268010 CAGCAGCCCTTGGATTCAAGAGG + Intergenic