ID: 1186473539

View in Genome Browser
Species Human (GRCh38)
Location X:9839349-9839371
Sequence CACCCACATCTCCCTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186473534_1186473539 28 Left 1186473534 X:9839298-9839320 CCTCTGTGGTGTGGGTGCATTAT 0: 1
1: 0
2: 0
3: 2
4: 126
Right 1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG 0: 1
1: 0
2: 2
3: 27
4: 267
1186473533_1186473539 29 Left 1186473533 X:9839297-9839319 CCCTCTGTGGTGTGGGTGCATTA 0: 1
1: 0
2: 0
3: 3
4: 118
Right 1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG 0: 1
1: 0
2: 2
3: 27
4: 267
1186473536_1186473539 -2 Left 1186473536 X:9839328-9839350 CCATTGGTCATCTTTTCTTGTCA 0: 1
1: 0
2: 1
3: 28
4: 372
Right 1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG 0: 1
1: 0
2: 2
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186473539 Original CRISPR CACCCACATCTCCCTGGGTC TGG Intronic
900414198 1:2527657-2527679 CACCCAGGCCTCCCTGGGGCAGG - Intergenic
900461989 1:2805999-2806021 CACCCTCATCTCCCAGTGCCTGG + Intergenic
900540000 1:3197826-3197848 CACAGAGGTCTCCCTGGGTCAGG + Intronic
900705728 1:4078863-4078885 CATCCATGTCTCCCTGGGTCTGG - Intergenic
901924968 1:12560404-12560426 CACCCAAATCTCTATGGCTCGGG - Intergenic
902707192 1:18213646-18213668 CACGGCCATCTTCCTGGGTCTGG + Intronic
903130891 1:21279050-21279072 CACCCAGACCCCCCTGGGCCTGG + Intronic
903282500 1:22257887-22257909 CACTCACAGCTCCCTGGGCATGG + Intergenic
903752731 1:25637071-25637093 AACCTTCATCTCCCTGGTTCAGG - Intronic
905772764 1:40649014-40649036 CGCCCACCTCTCCCTGAGTGGGG - Intronic
905944362 1:41889470-41889492 CACCCCCTTCTCCTTGGGACTGG + Intronic
906102865 1:43274191-43274213 CCCTCACCTCTCCCTGGGACTGG - Intergenic
906211283 1:44013581-44013603 CACCCACTTCTGCTTGGGCCTGG + Intronic
906636722 1:47415360-47415382 CACTCACATCTCACTGGGGATGG - Intergenic
908525089 1:64980330-64980352 CACACAAAGCTCCCTGGGTTTGG + Intergenic
910518361 1:88088617-88088639 CACCCTAATCTCCCTGGGTGGGG - Intergenic
911090140 1:94011316-94011338 CCCCCACTTCTGCCTGGGCCGGG - Exonic
911950899 1:104172551-104172573 CACCCACCTCCCCGTGGGGCAGG + Intergenic
912625575 1:111202987-111203009 CACACAGATGTCCCAGGGTCTGG + Intronic
912855615 1:113166449-113166471 CACACACATCTACCTGGGAAGGG - Intergenic
915345056 1:155193129-155193151 CACCAACCACTCCCTGGCTCCGG + Intergenic
915543697 1:156583907-156583929 CACCCCCATCTCCTTGTCTCAGG - Intronic
915569503 1:156736699-156736721 CACCAAGATGCCCCTGGGTCAGG + Exonic
916019219 1:160777868-160777890 CCCCCAAATCCTCCTGGGTCTGG - Intergenic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
918088421 1:181265077-181265099 TACCTACCTCTCCCTGGGCCCGG + Intergenic
919939453 1:202276318-202276340 CAACCTCATCTCCCTGGTCCCGG + Exonic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
921175559 1:212591077-212591099 CAGCCACATGTCCCTGGTACAGG - Intronic
921177390 1:212607117-212607139 CACCCACCTCTCCACGGGCCTGG - Intronic
921211189 1:212900092-212900114 CACCCCCATCTCCCTGAGGCTGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924440590 1:244082303-244082325 CACCCCCTTATCCCTGGGTAAGG - Intergenic
1066105617 10:32154430-32154452 AACCTCCATCTCCCTGGTTCAGG + Intergenic
1067166472 10:43869732-43869754 CACAGACCTCTCCCTGAGTCAGG + Intergenic
1067238180 10:44469096-44469118 CTCCCAGATGTCCCTGGGGCAGG - Intergenic
1067852281 10:49761691-49761713 CTCCCACATCTCCCGGGGGGCGG + Intronic
1069488553 10:68841991-68842013 CACACACACCTCCCTGGGTGCGG - Intronic
1069776337 10:70929340-70929362 CCCCCACATCTTCCTGGGGTGGG + Intergenic
1069913002 10:71771242-71771264 CACCCATCTCACCCTGAGTCAGG + Intronic
1071494927 10:86161679-86161701 CAGCCACATCACCCTGGTTCTGG + Intronic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1075564745 10:123495082-123495104 CTCACACATCTTCCTGGGTTGGG + Intergenic
1075727243 10:124616889-124616911 CAGCCACACCTCCCAGGCTCGGG + Intronic
1075958577 10:126546582-126546604 CACTGACATCTCCCTGGGTGGGG - Intronic
1076715305 10:132361030-132361052 CTCCCAGGTCTCCCTGGTTCTGG + Intronic
1076995707 11:296579-296601 TGCCCACATCACCCTGGCTCTGG - Intergenic
1077089478 11:771940-771962 CAGCCACCTCTCCCTGCCTCAGG + Intronic
1077116009 11:884937-884959 CACCCAGCTCTCCCTGGGCCAGG - Intronic
1077430356 11:2513140-2513162 CACTCACATCACACAGGGTCAGG - Intronic
1077917892 11:6622888-6622910 CACCCACACCGCACTGGGCCTGG - Exonic
1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG + Intronic
1081252310 11:40850751-40850773 AACTCCCATCTCCCTGGGACAGG - Intronic
1081976643 11:47239590-47239612 CAGCCACATTTCCCTGTGTCTGG - Exonic
1083362359 11:62119359-62119381 CACCCCTATCTCCCAGAGTCTGG - Intergenic
1083726616 11:64631723-64631745 CACCCCCACCTCCTTGAGTCAGG - Intronic
1084302396 11:68260090-68260112 CACCAAGATCTCCCTGGGCTAGG - Intergenic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1088104005 11:106185496-106185518 CTCCTACATCTGACTGGGTCAGG + Intergenic
1089016465 11:115169136-115169158 CACCCACAAGTCCCTGGCTATGG - Intergenic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090449136 11:126790784-126790806 CAGCCACATCTGCTTGGGTGGGG + Intronic
1090478595 11:127047435-127047457 CACCCACATTTCACAGGGTAGGG - Intergenic
1092187673 12:6493245-6493267 CGCCCACAGCTGCCTGGGTAAGG - Exonic
1095128356 12:38508519-38508541 AACCCTCATCTCCCTGGGATAGG + Intergenic
1096725327 12:53556755-53556777 CACCCACAGCCCCCTGGCTTAGG - Intronic
1097918727 12:65048264-65048286 CACCCACCTCTCCCAGTCTCTGG - Intergenic
1102426881 12:112850686-112850708 CACCCACACTTCCCTGGGAGGGG + Intronic
1103446664 12:120999440-120999462 CCCCCACATCCCCCGGGCTCAGG + Intronic
1104572004 12:129933905-129933927 CTCCCACATCTCCCTGGATTGGG - Intergenic
1104585363 12:130044343-130044365 CTCCCGCATCTCCCTGGATGGGG + Intergenic
1104875273 12:132029555-132029577 CACCCACATCCCCATGTGACTGG + Intronic
1104898005 12:132173661-132173683 CCCGCACACCTGCCTGGGTCCGG - Intergenic
1105273031 13:18895312-18895334 CACCCAGATCACCCTGTATCAGG - Intergenic
1105857828 13:24387629-24387651 CACCCACCTCTCCTGGGATCTGG + Intergenic
1106219214 13:27731199-27731221 CAACCACATCTCGCTAGGCCTGG - Intergenic
1106361854 13:29038664-29038686 AACTCCCATCTCCCTGGGACAGG - Intronic
1108520933 13:51246567-51246589 CACTTACATGTCCCTGGTTCAGG + Intronic
1113097295 13:106679530-106679552 CAGCCACATTTCCCTAGGCCTGG + Intergenic
1113366601 13:109682419-109682441 CACCAGCATCTCCCAGAGTCTGG - Intergenic
1114393780 14:22338273-22338295 CACCCAGGTCTCCCTGGGAGAGG + Intergenic
1115307106 14:31944599-31944621 CACCCACCTCTGCCTGGGTGTGG + Intergenic
1117149936 14:52875914-52875936 CACCCACATATACGTGGGTGGGG + Intronic
1120764485 14:88316141-88316163 CCTCCCCATCTCCCTGGCTCTGG + Intronic
1121253066 14:92513839-92513861 CGCCCGCATGTCCCTGGCTCTGG - Exonic
1122659876 14:103288079-103288101 CACACACATCCCCCAGGGCCTGG + Intergenic
1122771212 14:104098738-104098760 GTCCCACCTCCCCCTGGGTCTGG + Intronic
1124004608 15:25785849-25785871 CACCCACCTCGCCCAGGGGCAGG + Intronic
1125978812 15:43980797-43980819 CACCCACAACCCACTGTGTCTGG - Intronic
1127389362 15:58492780-58492802 AACCCAAATATCCCTGGGACAGG + Intronic
1127520480 15:59738792-59738814 CACCCACACCTAGCTGGGTGAGG - Intergenic
1127526078 15:59792696-59792718 CTCCCACTTGTCCCTGGCTCTGG + Intergenic
1128382349 15:67122341-67122363 CACCCACAGCTGACAGGGTCTGG - Intronic
1129059707 15:72851048-72851070 CACCCACAGCTCACTGGACCAGG - Intergenic
1129170920 15:73807367-73807389 CGCCCACACCTCCCAGGCTCAGG - Intergenic
1129194239 15:73954706-73954728 CACACACCCCTCCCTGGGCCTGG - Intergenic
1130656235 15:85793885-85793907 CACCCACAGTTCGTTGGGTCAGG + Intronic
1132056564 15:98655101-98655123 CACCCCCATCCCCGAGGGTCTGG + Intronic
1137725768 16:50655542-50655564 CAGCCTGATCTCCCTGTGTCAGG + Intergenic
1138267723 16:55671867-55671889 CAGCCACCTCTCCTTGGGTGTGG - Intronic
1138376700 16:56569193-56569215 CACCCACATGTACCTGTGACAGG + Intergenic
1138544451 16:57707380-57707402 CCCAGACATCTCCCTGGGGCTGG - Intronic
1141646363 16:85370099-85370121 CACCCAGAACCTCCTGGGTCCGG - Intergenic
1141663103 16:85452371-85452393 CCCCCACCTCTCCCTCTGTCTGG + Intergenic
1141886048 16:86893057-86893079 CACACTCATAGCCCTGGGTCAGG + Intergenic
1141901071 16:86990905-86990927 CACGCACATCTCCCAGGGGATGG + Intergenic
1144762434 17:17714975-17714997 CACCCACATCACCCTCTGTTAGG + Intronic
1147040036 17:37711382-37711404 CATCCACATCTGCCTGTGTGTGG - Intronic
1147661187 17:42117934-42117956 CAGCAACAGCTCCCTGAGTCTGG - Exonic
1150494989 17:65600889-65600911 CACCCAACTCCCCCTGTGTCAGG + Intronic
1151632274 17:75319007-75319029 CTCCCACATCCCACTGGATCTGG - Exonic
1152266465 17:79297635-79297657 GACCCCCATCTCCCTGGGAAAGG - Intronic
1154980537 18:21499394-21499416 CTCCCACCCCTCCCTGTGTCAGG - Intronic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1158009076 18:52707844-52707866 CACCCACCTATCCCAGGGTCTGG - Intronic
1160659331 19:291058-291080 GACCCCCATCCCCCTGGGCCTGG + Exonic
1160939762 19:1614752-1614774 CACCCCCATTTCCCAGGGCCAGG - Intronic
1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG + Intronic
1161657809 19:5526494-5526516 GACCAACATCTCCCTGGGAGAGG + Intergenic
1161847578 19:6720526-6720548 AACCCACCTCCCCCTGGCTCTGG - Exonic
1162524958 19:11201690-11201712 CTCCCAGGTCTCCCTGGGTCTGG + Intronic
1162746271 19:12800429-12800451 CACCCACCCCACCCTGGGTTGGG + Intronic
1163153411 19:15427844-15427866 CACCCACATCTGCCCCTGTCTGG - Intronic
1163365508 19:16873776-16873798 CAGCTGCATCTCCCTGGGCCAGG + Intronic
1163406562 19:17126557-17126579 CAGCCACATCGGTCTGGGTCTGG - Intronic
1164271965 19:23680670-23680692 CACCTCCATCTCCCAGGTTCAGG - Intronic
1165455740 19:35909528-35909550 CACCCACCGCTCCTTGGGCCTGG + Intergenic
1165919859 19:39289679-39289701 CAGCCTCATCTCCCTGTCTCAGG + Intergenic
1166101214 19:40572441-40572463 CAGCCCCATCACTCTGGGTCAGG - Intronic
1166107903 19:40606390-40606412 CATCCACATCTGCCAGGGTTGGG - Exonic
1166214196 19:41325143-41325165 CTCCCAGTTCTCCCGGGGTCGGG + Intronic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1167618067 19:50547106-50547128 CATCCACATCTCCCTTGAGCAGG - Intronic
1168346386 19:55652103-55652125 CACCCTCGTCTCCCTGCCTCAGG - Intronic
1168349924 19:55669878-55669900 CACCAACATCTCCCATGGCCCGG - Intronic
1168721724 19:58558203-58558225 CTCCCACATCACCCTGCCTCAGG + Intronic
927188481 2:20499636-20499658 CACCCACCTCTCCCTGCACCTGG - Intergenic
927709095 2:25314196-25314218 CACCCCACCCTCCCTGGGTCAGG + Intronic
927712815 2:25336286-25336308 CACCCCCATTTCCCTGGCACTGG + Intronic
928415763 2:31090300-31090322 CACTCAGAGCTCCCTGGGACTGG + Intronic
928458230 2:31444332-31444354 CACCCACAACTCTTTGAGTCTGG + Intergenic
929463568 2:42124799-42124821 AACCTCCATCTCCCTGGTTCAGG + Intergenic
931318209 2:61152081-61152103 CTCCCAGGTCTCCCAGGGTCAGG + Intronic
933898346 2:86831726-86831748 CACCCGTGTCTCCCTGGGGCAGG - Intronic
934662770 2:96152079-96152101 CACACACATCTCTGTGGCTCTGG + Intergenic
934678526 2:96266323-96266345 CCCCCACCTCCCCCTGCGTCGGG + Exonic
935396893 2:102619323-102619345 CACCCACAGTTCGCTGGCTCTGG + Intergenic
936369856 2:111894863-111894885 CACCTCCCTGTCCCTGGGTCTGG - Intergenic
937859711 2:126698125-126698147 CACCCACATCTTCCAGGTTTGGG + Intergenic
938108590 2:128549773-128549795 CACCCACCCCACCCTGGGGCTGG + Intergenic
938985833 2:136575266-136575288 CACCAACATCTCCATTGTTCTGG - Intergenic
940445646 2:153773096-153773118 CAATCAGATCTCACTGGGTCTGG + Intergenic
941250463 2:163155373-163155395 CACCCACCTCTCCGCTGGTCTGG + Intergenic
942124698 2:172811687-172811709 TAACCAGATCTCCATGGGTCAGG - Intronic
943908714 2:193534577-193534599 CACCCACATCTCACTCTGTGGGG + Intergenic
944757132 2:202774773-202774795 CACCCATATCACACTGGGCCAGG + Exonic
946191813 2:218011511-218011533 CTCCCCCATCCCCCTGGGGCTGG + Intergenic
947791395 2:232871286-232871308 CACCCAGACCTCCCAGGGTGTGG - Intronic
948176684 2:235949082-235949104 CAGCCCCTTCTCCCTGGGTGAGG + Intronic
948937660 2:241178087-241178109 CACCCAGACAGCCCTGGGTCAGG - Intronic
1169328067 20:4693112-4693134 CACCGCCATCTCCCTGGTTATGG + Intronic
1172368904 20:34371840-34371862 CACTTAAATCTCCCTGGGCCTGG + Intronic
1173417209 20:42867487-42867509 CACCCACATATCACTGGGGCTGG + Intronic
1173618117 20:44416037-44416059 CACCCAAACCTCCCTGGCTGGGG + Intronic
1174263330 20:49313383-49313405 CAGCCACCTCTCCATGGGTCTGG - Intergenic
1174553160 20:51375828-51375850 CACCCTCAGCTCTCTGGGCCTGG - Intergenic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175384717 20:58586939-58586961 CAACCCCACCTCCCCGGGTCTGG + Intergenic
1175911574 20:62407599-62407621 CACCCACGCCGCCCTGGGTCCGG - Intergenic
1175956723 20:62614445-62614467 CACCCAGGGCTCACTGGGTCTGG - Intergenic
1179783689 21:43718425-43718447 CATCCACAGGTGCCTGGGTCTGG - Intergenic
1180924506 22:19544434-19544456 CACCCACACCCCTCTGGGGCTGG + Intergenic
1181063258 22:20292028-20292050 CACCTGCATCTCCCTGGGGTGGG + Intergenic
1182718136 22:32376475-32376497 CACCCACTTCTTCCCAGGTCTGG + Intronic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1183680751 22:39327914-39327936 CAGCCTCATGTCCCTGGGGCAGG + Intergenic
1184033824 22:41909437-41909459 CAGCCACTTCCCCCTGGCTCTGG + Intergenic
1184214823 22:43059664-43059686 GGCCCAGATCTCCCTGGGGCAGG - Intronic
1184325801 22:43783372-43783394 CACACACCTCTCCCTGGGAATGG - Intronic
949090488 3:22225-22247 CAGCCTCATCTCCCAGGCTCAGG - Intergenic
949536472 3:5000018-5000040 CACCCATTTCACCCTGGGGCAGG + Intergenic
950499477 3:13354595-13354617 CACCGACATGTGCCTGGGTGGGG - Intronic
951400277 3:22224803-22224825 CACCCACTGCTCCCTGCGTGGGG + Intronic
952186560 3:30975794-30975816 CACCACCAGCTCCCTGGTTCTGG + Intergenic
953982615 3:47420229-47420251 CCACCACATTGCCCTGGGTCGGG - Intronic
954215514 3:49122233-49122255 CATCCACATCTGCCAGGCTCCGG + Exonic
954745186 3:52783812-52783834 CCCGGACATCCCCCTGGGTCAGG - Intronic
956383027 3:68686076-68686098 AACTCCCATCTCCCTGGGACAGG - Intergenic
961484348 3:127206802-127206824 CACACACCTCGCCCTGGGCCTGG + Intergenic
961670458 3:128524558-128524580 AGCCCACTTCTCCCTGGGGCAGG - Intergenic
962051217 3:131817550-131817572 CATCCACATCTCCATAGGACAGG - Intronic
962828417 3:139119467-139119489 CACCCACTCATCCCTGGGCCAGG - Intronic
964829678 3:160870096-160870118 CACACACTTCTCCCATGGTCAGG - Intronic
966895423 3:184441300-184441322 CAGCCATTTCCCCCTGGGTCTGG - Intronic
967640801 3:191860830-191860852 CATCCTCATGTCCCTTGGTCTGG - Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
968563892 4:1299267-1299289 CCCCTCCATCTCCCTTGGTCAGG + Intronic
968871513 4:3245079-3245101 CACCCCCTTCTCCCTGGTCCAGG + Intronic
969533498 4:7741944-7741966 GAACCTCATCTCCCTGGGTCGGG + Exonic
971430029 4:26556143-26556165 AACTCCCATCTCCCTGGGACTGG - Intergenic
971445668 4:26745586-26745608 CAACCTCACCTCCCTGGTTCAGG + Intronic
971559355 4:28055960-28055982 CACACACATCTCAGTGGGGCAGG + Intergenic
972503446 4:39698414-39698436 CCCCCACCTCTGCCTGGGGCGGG + Intronic
973164269 4:47057022-47057044 CAACCTCGTCTCCCAGGGTCAGG - Intronic
973228956 4:47820004-47820026 CAGCCCCATCTCCCAGGGTTTGG + Intronic
973608015 4:52606980-52607002 CACACTCATCTCCCTGCCTCTGG - Intronic
975209350 4:71680738-71680760 CAGGCAAATTTCCCTGGGTCAGG + Intergenic
975952165 4:79787422-79787444 GACACAAATCTCTCTGGGTCTGG + Intergenic
977983075 4:103348966-103348988 CACTCACTTTTCCCTGGGCCTGG + Intergenic
979182745 4:117752279-117752301 CACTCACAGCTCCATGTGTCTGG - Intergenic
985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
986775198 5:11007898-11007920 CACCCACATCTCCCTGTCTAGGG - Intronic
986796228 5:11214974-11214996 CACTGACATCTCTCTGGGTGAGG - Intronic
988035557 5:25823453-25823475 CAGCCACTTCTCCGTGGGGCAGG - Intergenic
989808504 5:45642615-45642637 CACCCACATGTCTTTGGTTCTGG - Intronic
990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG + Intergenic
996405554 5:123099428-123099450 CACCCAGATCTGCCTGGTACCGG - Intronic
996977094 5:129448035-129448057 CACCCAAATCTCTGTGGGTCAGG + Intergenic
997096913 5:130923791-130923813 CACCCTAACCTCCCTGGGTGGGG + Intergenic
997594118 5:135094984-135095006 CACCCTCCTCTGCCTGGGGCTGG + Intronic
997882069 5:137600285-137600307 CAACCAGAGCTCCCTGGGGCAGG + Intergenic
999305155 5:150514859-150514881 CTCCCACTTTTCCCAGGGTCAGG - Intronic
1001197551 5:169686999-169687021 CACCTAGATCTTCCTGGGTGAGG + Intronic
1002676950 5:180924591-180924613 CACCCACATCTGCCTGTCTGAGG + Intronic
1005865129 6:29931772-29931794 CACCCACCTCCCTCAGGGTCAGG + Intergenic
1005867448 6:29946860-29946882 CACCCACCTCCCTCAGGGTCAGG + Intergenic
1006345015 6:33473863-33473885 CACACACATCTAGCTGGTTCTGG + Intergenic
1007488226 6:42197341-42197363 CCCACACATCTCACTGGGGCCGG - Intergenic
1008785146 6:55158823-55158845 AACTCCCATCTCCCTGGGACAGG + Intronic
1011910656 6:92433351-92433373 AACCTCCATCTCCCTGGTTCAGG + Intergenic
1014811767 6:125894459-125894481 CATTCACATCTGCCTGGTTCTGG - Intronic
1015466001 6:133549487-133549509 CACGCCCAACTCCCTGTGTCAGG + Intergenic
1018866662 6:167751747-167751769 CAGCACCATCTCCCTGGATCTGG - Intergenic
1019023776 6:168941294-168941316 CTCCCTCATCTCTCTGGGTCAGG + Intergenic
1019052657 6:169195076-169195098 CTCCCACCTCTCCCTGGGTCTGG + Intergenic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019559833 7:1650547-1650569 CAGCCTCATCTGCCTGGCTCGGG - Intergenic
1021955227 7:25817825-25817847 CACAGACATCTCCCTGTGTCTGG + Intergenic
1022282268 7:28923376-28923398 CAACCATATCTGCCTGGGCCTGG - Intergenic
1022496949 7:30859337-30859359 CTCCCTCAACTCCCTGGGGCTGG + Intronic
1022517636 7:30986180-30986202 CACCCAGATCACGCAGGGTCAGG + Intronic
1025101296 7:56137239-56137261 CTTTCACAACTCCCTGGGTCAGG + Intergenic
1032659708 7:133969966-133969988 AACTCCCATCTCCCTGGGACAGG - Intronic
1033200145 7:139360760-139360782 CCCCCTCCTCTTCCTGGGTCAGG + Intronic
1034190016 7:149206806-149206828 AACCCTCATGTCCCTGGGTAAGG + Exonic
1034721533 7:153298590-153298612 CACTTACATCACCCTGGCTCCGG + Intergenic
1035297348 7:157874593-157874615 CACAGACAGCTCCCGGGGTCCGG + Intronic
1035375003 7:158401980-158402002 TTCCCACCTCTCCCTGGCTCTGG - Intronic
1037507651 8:19547881-19547903 CACCCAAATCCCTCAGGGTCTGG - Intronic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1041851254 8:62395348-62395370 CACCACCACCTCCCTCGGTCTGG - Intronic
1045504734 8:102770310-102770332 CACCCACATGTCCCAGGAACGGG - Intergenic
1047295428 8:123566616-123566638 AACCCACATCTTCCAGGTTCAGG - Intergenic
1048664943 8:136650449-136650471 CACCCACATCTTCCTGTTTTTGG + Intergenic
1049580637 8:143409047-143409069 GTCCCAAATCTCCCTGGTTCTGG - Intergenic
1049676054 8:143889724-143889746 CACGCACATCTCCCAGAGCCCGG - Intergenic
1049734917 8:144199745-144199767 CATCAACATCTCCCTGGAGCTGG + Intronic
1049828420 8:144685146-144685168 CACTCACACCTCCCTCGGGCAGG + Intergenic
1049828427 8:144685173-144685195 CACTCACACCCCCCTGGGGCCGG + Intergenic
1049979666 9:892523-892545 CCCCCACATGTCCCTGGAACAGG + Intronic
1051863354 9:21651475-21651497 AACTCCCATCTCCCTGGGACAGG - Intergenic
1053278999 9:36805166-36805188 CACCCACACCTCGCTGGGAGTGG - Intergenic
1054835534 9:69672127-69672149 CACCCACCCCTCCCTGGCTGTGG + Intronic
1056765589 9:89442826-89442848 GACTCACATCTGCCCGGGTCTGG - Intronic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1060038985 9:120283566-120283588 CACCTGCATCTCCCAGGGTCAGG - Intergenic
1060295302 9:122339149-122339171 TCTCCTCATCTCCCTGGGTCTGG + Intergenic
1060806916 9:126583496-126583518 CAGCCAGATCTCCCTGGGGGTGG + Intergenic
1061052700 9:128205576-128205598 CACCCACACGTCCCTGTGCCTGG - Intronic
1061057730 9:128233246-128233268 CAGCCACATCTGCCCGGCTCTGG - Intronic
1061766161 9:132882715-132882737 CTCCAACATCTCCCTTGGACTGG + Intronic
1062038876 9:134395191-134395213 CTCCCACATGTCCATGGGGCTGG + Intronic
1062056807 9:134473039-134473061 CACCCCCATCTCCAGGGGGCTGG + Intergenic
1062263733 9:135677069-135677091 CAGCCCCATCTCCCTCGTTCGGG + Intergenic
1062342140 9:136098490-136098512 CACCCCAATATCCCTGGCTCAGG + Intergenic
1062460804 9:136661841-136661863 CACCCCCATTTCCCTGGCCCTGG - Intronic
1062658302 9:137615271-137615293 CGCCCTCTTCTCCCTGGGGCTGG + Exonic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1185595948 X:1307093-1307115 CACCCACCTCTCTCCGGCTCAGG + Intronic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1187755568 X:22521737-22521759 CAACCACAACTCCCTGTCTCAGG - Intergenic
1187934324 X:24321250-24321272 GACCCACATCTCCATGGATGGGG + Intergenic
1189023492 X:37366942-37366964 CACACACATCTACCTGAGTGTGG + Intronic
1190107710 X:47571569-47571591 CCCCCTCATCTCCCAGGGTGGGG - Exonic
1190732125 X:53233338-53233360 CACACACACCTCGCTGGGGCAGG - Exonic
1190775030 X:53545763-53545785 CACCCCCATGTCCCTAAGTCTGG - Intronic
1192329112 X:70159972-70159994 CACCCCCACCTCCCTGGATCTGG - Intronic
1193164344 X:78264183-78264205 CTGCCCCATCTCCCTGGCTCTGG + Intergenic
1194003830 X:88465995-88466017 CAGGCAGATCACCCTGGGTCAGG + Intergenic
1194559585 X:95403918-95403940 AACTCCCATCTCCCTGGGACAGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198599772 X:138270027-138270049 CACCCTTATCTCCCTTTGTCAGG - Intergenic
1202174183 Y:22082464-22082486 CACCAACATCTCTCTAGGCCTGG - Intronic
1202217177 Y:22503918-22503940 CACCAACATCTCTCTAGGCCTGG + Intronic
1202326009 Y:23692141-23692163 CACCAACATCTCTCTAGGCCTGG - Intergenic
1202544762 Y:25977913-25977935 CACCAACATCTCTCTAGGCCTGG + Intergenic