ID: 1186478467

View in Genome Browser
Species Human (GRCh38)
Location X:9877656-9877678
Sequence AGAGCCACAGGCTATTTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186478462_1186478467 21 Left 1186478462 X:9877612-9877634 CCTGGGCAGGTCTTGAATGGATC 0: 1
1: 1
2: 1
3: 10
4: 128
Right 1186478467 X:9877656-9877678 AGAGCCACAGGCTATTTCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186478467 Original CRISPR AGAGCCACAGGCTATTTCGC TGG Intronic
900689486 1:3971686-3971708 AGGACCAAAGGCTATTTCCCCGG + Intergenic
902828947 1:18997344-18997366 AGAGCCACAGGGTGTGTCCCAGG + Intergenic
908416278 1:63916127-63916149 AGAGCCAGAGGATATTTCAAGGG - Intronic
908775467 1:67635273-67635295 AGAGGCACAGGGTAATTTGCAGG + Intergenic
922135876 1:222825800-222825822 AGAGATACAGGCTATTCAGCTGG - Intergenic
922649025 1:227320739-227320761 AGTGCCACAGGCTGCCTCGCAGG + Intergenic
922668487 1:227491973-227491995 TGAGCCACAGCCTCTTTCCCAGG - Intergenic
1069859592 10:71462085-71462107 AGAGACACAGGCGATGTCTCAGG - Intronic
1073876571 10:107929758-107929780 ATAGCGACAGGCTATGTCGAGGG + Intergenic
1079024606 11:16936374-16936396 AGAGTCTCACGCTATTTCCCAGG - Intronic
1089789877 11:120934862-120934884 AGAGCCACAGGGTAGGTCTCCGG - Intronic
1090927607 11:131262624-131262646 AGAGCCACATGGTTTTTCTCAGG + Intergenic
1092279608 12:7089500-7089522 AGAGCCACAGGGCATTACGGGGG + Intronic
1092847002 12:12592878-12592900 AGAGCCTCAGTCTATTGCCCTGG - Intergenic
1094350284 12:29516719-29516741 AAAGCCACAAGCCATTTCACTGG - Intronic
1109743674 13:66590518-66590540 AAATCCACATGCTATTTAGCAGG + Intronic
1113193590 13:107778831-107778853 AGAGCCACAGGCTGTTTTCAGGG - Intronic
1119725466 14:76919466-76919488 AGAGACACAGGCCATTTCTCTGG - Intergenic
1122248826 14:100424060-100424082 TGTGCCACAGGCCATCTCGCAGG + Intronic
1122301433 14:100733541-100733563 GGATCCACAGGCTATTGTGCAGG - Intronic
1126396847 15:48227469-48227491 AGACCCACTGGCTCTCTCGCAGG + Intronic
1134745875 16:16587842-16587864 AGACCCACATTCTATTTCACAGG - Intergenic
1134999604 16:18765900-18765922 AGACCCACATTCTATTTCACAGG + Intergenic
1138540307 16:57683836-57683858 AGAGCCATAGGCTATTGGGGTGG + Intronic
1143689470 17:8549457-8549479 AGAGCCAAAGAATATTTCTCAGG + Intronic
1152540613 17:80972531-80972553 AGAGCCACAGAGTTTGTCGCTGG + Intergenic
1153979642 18:10297922-10297944 AGAGCCACAGGTTGTTTCCTGGG - Intergenic
1157188918 18:45564282-45564304 AGAGCCAGAAGCTACTTGGCGGG - Intronic
1157299683 18:46470574-46470596 AGAGCCACAGGCTATGTTGATGG - Intergenic
1161315982 19:3617928-3617950 AAAGCCACAGGCTCTTTCCTAGG + Intronic
928703777 2:33926088-33926110 AGAAATACAGGCTATTTCACAGG - Intergenic
942453474 2:176122709-176122731 CGAGCCACCGACTAGTTCGCAGG - Exonic
944282282 2:197911793-197911815 AAAGGCACAGGCTATGTTGCAGG - Intronic
946406836 2:219496370-219496392 ACAGCCACTGGCTTTTTGGCAGG - Intronic
1175679866 20:60978052-60978074 AGACCCACAGGCTATACTGCAGG - Intergenic
1175961452 20:62638827-62638849 AGAGCCTCAGGTCATGTCGCAGG + Intergenic
960506355 3:118499621-118499643 AGAGCCACAGATTATTCCTCTGG - Intergenic
967321516 3:188199480-188199502 AGAGCCACAGGGTATGCAGCAGG + Intronic
970963802 4:21904658-21904680 AGTAACACAGCCTATTTCGCTGG + Intronic
977698998 4:100000198-100000220 AGATCCACAAGATATTTCTCAGG + Intergenic
980184239 4:129441796-129441818 AGAGCCTCCTGCCATTTCGCTGG + Intergenic
986234381 5:5893641-5893663 AGAGCCACAGGCTGCTGCCCTGG + Intergenic
992013330 5:72552454-72552476 AGTCACACAGGCTATTTCCCAGG - Intergenic
1002311572 5:178318370-178318392 TAAGCCACAGGCCATTTCTCAGG + Intronic
1006803261 6:36772635-36772657 AGAGCCACAGTCTGTTCCACAGG - Intronic
1015152095 6:130051622-130051644 AGAGGCAGAGGCTGTTTTGCAGG - Intronic
1017094776 6:150795064-150795086 AGAGCCACAGATTATTTTGGTGG - Intronic
1019780563 7:2937329-2937351 AGAGCCACAGACGATGTGGCTGG - Intronic
1021249289 7:18304521-18304543 GGACCCTCAGGCTATTTAGCAGG + Intronic
1034546503 7:151793242-151793264 AGAGCCACAGGGTGTTTGGACGG + Intronic
1038867680 8:31457283-31457305 AAAGATACAGGCTATTTCCCAGG - Intergenic
1040284756 8:46094060-46094082 AGAGCCACAGACTATTGCCCAGG + Intergenic
1040329722 8:46379668-46379690 AAAGCCGCAGGCTTTTTAGCCGG + Intergenic
1045107598 8:98908006-98908028 AGAGCCACCTACTATTTCCCAGG - Intronic
1049534213 8:143170590-143170612 AGAGCCACAGGCTTTGTAACCGG - Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1186478467 X:9877656-9877678 AGAGCCACAGGCTATTTCGCTGG + Intronic
1188128332 X:26399154-26399176 AAAGCCACAGGCTATTCATCAGG + Intergenic
1192174608 X:68877997-68878019 AGAGCCACAGGCTTTCCTGCAGG - Intergenic
1193970227 X:88041346-88041368 GGAGACACAAGCTATTTCTCAGG + Intergenic
1194566946 X:95500784-95500806 ACAGCCACAGCCTATTCTGCAGG - Intergenic
1194774113 X:97942211-97942233 AAAGCCACAGGCAATTGCTCTGG + Intergenic
1201646903 Y:16243688-16243710 AGAACCACATGCAATTTCACTGG - Intergenic
1201655908 Y:16341614-16341636 AGAACCACATGCAATTTCACTGG + Intergenic