ID: 1186479283

View in Genome Browser
Species Human (GRCh38)
Location X:9883767-9883789
Sequence AAGGAAGCAGAGTCAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 1, 3: 69, 4: 555}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186479278_1186479283 3 Left 1186479278 X:9883741-9883763 CCTTCCGGAGGATTGGCAGGAAA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG 0: 1
1: 0
2: 1
3: 69
4: 555
1186479280_1186479283 -1 Left 1186479280 X:9883745-9883767 CCGGAGGATTGGCAGGAAAAGGA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG 0: 1
1: 0
2: 1
3: 69
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186479283 Original CRISPR AAGGAAGCAGAGTCAGAGCT GGG Intronic
900882833 1:5394208-5394230 AAGGAACCAGAGGCAGTCCTGGG + Intergenic
900938164 1:5780210-5780232 AGGAAAGCAGAGCCAGAGTTGGG + Intergenic
901135416 1:6989904-6989926 AAGGGAGCTGGGTCAGAGCAAGG + Intronic
901333165 1:8425945-8425967 AAGGAAGCTGAGGCACAGATAGG + Intronic
901340587 1:8495291-8495313 ATAGGAGCAGAGGCAGAGCTGGG - Intronic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
903217055 1:21849049-21849071 GAGGAGGCAGGCTCAGAGCTGGG + Intronic
903259124 1:22121744-22121766 AAGGAAGCAGATTCAGCTATTGG - Intronic
903665596 1:25005634-25005656 CAGGAGGCAGAGGCACAGCTGGG + Intergenic
903913813 1:26748589-26748611 AAAGAATCTGGGTCAGAGCTGGG - Intronic
904122809 1:28212845-28212867 CAGGAAGCGGAGGCAGAGATAGG - Intronic
904453569 1:30632511-30632533 AGGAAACCAGAGTCAGAGATGGG - Intergenic
904745153 1:32706127-32706149 AAAGATGCAGAATCACAGCTTGG + Intergenic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
905253964 1:36668085-36668107 AGGGAAGCAGGGTAGGAGCTAGG + Intergenic
906002756 1:42441206-42441228 ACTGAAGCAGAGTCTGAGCTGGG + Intronic
906179908 1:43809404-43809426 AATGAAACAGAGTGAGGGCTGGG + Intronic
906262072 1:44400836-44400858 AAGGAGGCAGAGACAGAAGTGGG - Intergenic
906273278 1:44498057-44498079 AAGCAACCACTGTCAGAGCTCGG - Intronic
906353510 1:45083543-45083565 CAGAAAGAACAGTCAGAGCTGGG - Intronic
906782710 1:48586739-48586761 ATGGAAGCAGAGTAAGATATGGG + Intronic
907548743 1:55286223-55286245 AATGAACTAGAGACAGAGCTGGG + Intergenic
907686646 1:56618346-56618368 AAGGAGGAAGAGTCAGAGTGAGG + Intronic
907733650 1:57091060-57091082 AAGTAAGCAGAGGCAAAACTTGG - Intronic
907806892 1:57829688-57829710 AAGGTGGCAGAGAAAGAGCTGGG - Intronic
907978156 1:59453824-59453846 AAGGAATCAGAATCAGAGGTAGG + Intronic
908053326 1:60256528-60256550 AAGGAAGCACACACAGACCTTGG + Intergenic
910124331 1:83823858-83823880 AAGGAAGCAGCATTAGAGCTAGG + Intergenic
910236383 1:85040748-85040770 AAAGAATCAGAGTTAGGGCTTGG - Intronic
910806167 1:91191496-91191518 AGGGAAGCAGTGGCAGAGATGGG - Intergenic
910850918 1:91649183-91649205 AAGAGAGCAGGCTCAGAGCTTGG - Intergenic
910867689 1:91803142-91803164 CAGGAAGCAGGGCCAGATCTTGG - Intronic
911228742 1:95336990-95337012 AAGAAAGCAGAGCCAGAGCAGGG - Intergenic
911838554 1:102652290-102652312 AGGGGAGCAGAGTCAGAGAGAGG - Intergenic
912206046 1:107510633-107510655 AAAGAAGCCAAGGCAGAGCTTGG + Intergenic
913204005 1:116518770-116518792 CAGGAGCCAGGGTCAGAGCTGGG - Intronic
913547338 1:119882214-119882236 AAGGTAGCAGACTCAGTGCAAGG + Intergenic
913556867 1:119976125-119976147 AAGGTAGCAGACTCAGTGCAAGG - Intronic
914253620 1:145942671-145942693 AAGGAAGGAGAGTGGGAGATGGG - Intronic
914406970 1:147385142-147385164 AGGGAAACAGGGCCAGAGCTTGG - Intergenic
914801718 1:150967242-150967264 AAGAAGGCATAGTGAGAGCTGGG - Intronic
914901137 1:151711750-151711772 AAAGAAGCAGAATCAGAACCAGG + Intronic
916617304 1:166455342-166455364 AAGGAGGCAGAATCTTAGCTGGG - Intergenic
917378310 1:174375072-174375094 AAGGAAGTAGAGACAGACATTGG + Intronic
917520945 1:175748079-175748101 AGGGAAGGAGAGATAGAGCTGGG + Intergenic
918069147 1:181122335-181122357 AGAGAAGCAGAAACAGAGCTGGG + Intergenic
918169494 1:181982894-181982916 AATGAAGCAGAGCAAGATCTGGG - Intergenic
918204896 1:182299864-182299886 AAGGAAGGAGAGAGAGAGCAAGG + Intergenic
918211640 1:182356779-182356801 ACGGTGGCAGAGTCAGGGCTTGG + Intergenic
918332621 1:183473569-183473591 ATGGAAGCTGAGTAAGAGCTTGG + Intronic
919060692 1:192628810-192628832 AGGGAGGCAGAGTCAGGGCTGGG - Intergenic
919237910 1:194870160-194870182 AAGAAAGGAGAGACAGAGATGGG + Intergenic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
920956041 1:210620971-210620993 AAGGAAGCACGGTAGGAGCTGGG + Intronic
921766708 1:218981204-218981226 AATAAAGCAGAGTTAGGGCTCGG - Intergenic
922594939 1:226806370-226806392 CAGGAAACAGAGGCAGAGCAAGG + Intergenic
924665325 1:246064962-246064984 AAGTAATCAGAGTAAGAGGTTGG - Intronic
924800035 1:247322602-247322624 GAGGAGTCAGAGTCAGGGCTGGG - Intronic
1063362411 10:5469187-5469209 AAGGAAGAAGAGACAGAGGAAGG - Intergenic
1064576172 10:16748381-16748403 GAGGAAGGAGGGTCAGAGGTAGG - Intronic
1064712497 10:18141033-18141055 ATGGAAGCCGAGGCAGAGCCAGG - Intronic
1065398529 10:25268698-25268720 ATGGAAGTGGAGTCAGAGATTGG + Intronic
1066291643 10:34019781-34019803 AAGGAAGCTCTGTCAGAACTTGG + Intergenic
1066561787 10:36677667-36677689 TAGGAAGCAGGGACACAGCTTGG - Intergenic
1067309834 10:45102437-45102459 GAGGAAGGAGGGTCAGAGGTAGG - Intergenic
1067973660 10:50999469-50999491 AAGGAAGGAGAGTCTGAATTAGG - Intronic
1068795104 10:61070899-61070921 AAGGAAGGAGAGAGAGAGATAGG - Intergenic
1069707877 10:70470087-70470109 AAAGAAACAGAGTCAGGGCCGGG - Intergenic
1069774328 10:70918028-70918050 AGAGCAGCAGAGTCAGGGCTAGG - Intergenic
1070566960 10:77611011-77611033 AAGGAAGCAGAGGCACAGAGAGG - Intronic
1070638117 10:78145525-78145547 AAGGAACCAGACTCAAACCTAGG - Intergenic
1070752503 10:78972563-78972585 GAGGGAGCAGGGCCAGAGCTGGG + Intergenic
1071061447 10:81574692-81574714 TAGGAAGCAGATTCTGAGATGGG - Intergenic
1071385353 10:85114054-85114076 AAAGATGAATAGTCAGAGCTTGG - Intergenic
1073152174 10:101319574-101319596 AAGGCTGCAGAGACTGAGCTGGG - Intergenic
1073250080 10:102115635-102115657 AAAGAGGCATTGTCAGAGCTAGG + Intronic
1073883407 10:108008917-108008939 CAGCAAGCAAAGACAGAGCTTGG + Intergenic
1074091657 10:110265253-110265275 GAGGAAGAAGAGTCAGAGAGAGG - Intronic
1074425110 10:113343723-113343745 ATGGAAGCAGAGGGAGAGATGGG + Intergenic
1074932440 10:118142765-118142787 TAGGACCCAGAGTCAGAGCTTGG - Intergenic
1074957451 10:118406218-118406240 AAGGAAGCAGATTCTGAGGAAGG + Intergenic
1076294417 10:129373722-129373744 AGGGAGGCAGAGTCATAACTTGG + Intergenic
1076438400 10:130462356-130462378 CAGGGAGCAGAGTCAGGGCTGGG - Intergenic
1077629925 11:3804477-3804499 CAGGAGGCAGTGGCAGAGCTTGG + Intronic
1078987163 11:16607452-16607474 AAGGAAGGGGAGTCGGTGCTAGG + Intronic
1080164127 11:29216238-29216260 GGGGAAGAAGAGTCAGAGTTTGG + Intergenic
1080320935 11:31008342-31008364 AAAGAAACAGAGTAAGAGGTAGG + Intronic
1080424511 11:32143817-32143839 AGGGAGACTGAGTCAGAGCTTGG - Intergenic
1080640342 11:34154887-34154909 AGGGAGGGAGAGACAGAGCTGGG - Intronic
1080670339 11:34370720-34370742 AAGGAAACAGAGGCAAAGCATGG - Intergenic
1080871914 11:36243774-36243796 AAGGAAATACAGCCAGAGCTGGG + Intergenic
1081425934 11:42926554-42926576 CAGGAAGCAGATACAGAGCCAGG - Intergenic
1081586172 11:44385500-44385522 CAGGAAGCAGACCCAGAGCTAGG + Intergenic
1081699588 11:45144752-45144774 AAGGAAGTAATGTCAGAGGTAGG - Intronic
1082067378 11:47911635-47911657 AAAGAAGCAGAGACAGAGGCAGG + Intergenic
1082084143 11:48035230-48035252 AGGCCAGCAGAGTCAGAGCTTGG + Intronic
1082085342 11:48045277-48045299 AAGCGAGCAGAGGCAGAGTTGGG + Intronic
1082280433 11:50265954-50265976 AAGAAAGAAGAGACAGAGCCAGG + Intergenic
1082801190 11:57416186-57416208 AAGGAAGCAGTGATAGAGTTGGG + Intronic
1083397715 11:62402708-62402730 GAGGAAGTAAGGTCAGAGCTGGG - Intergenic
1083412259 11:62502174-62502196 AAGGAGGCAGAGGAAAAGCTTGG - Intronic
1083433610 11:62628021-62628043 AAAGAAGCAGAAGGAGAGCTAGG - Intronic
1083568955 11:63745568-63745590 AAGGTAACAGAGGAAGAGCTTGG - Intronic
1084039089 11:66531210-66531232 AAAGCAGCAGAGGCAGGGCTTGG - Intronic
1085318191 11:75558637-75558659 AACAAGCCAGAGTCAGAGCTGGG - Intergenic
1085329004 11:75631608-75631630 AAGGAAGCAGATTCAAAGGCTGG + Intronic
1085411955 11:76296718-76296740 CAGGAAGCAGGGGCACAGCTGGG + Intergenic
1085472032 11:76764606-76764628 CAGGAAGGAGGGACAGAGCTAGG - Intergenic
1085712165 11:78839935-78839957 AGGCAGGCAGAGGCAGAGCTAGG - Intronic
1086200023 11:84191102-84191124 TAGGCAGTAGAGTCAGGGCTAGG - Intronic
1086252311 11:84830964-84830986 AAAGAAATAGAGACAGAGCTGGG - Intronic
1088418172 11:109612732-109612754 AAGGAAGCACAGTAAGAGGAAGG + Intergenic
1088831895 11:113543999-113544021 CAGGAGGCAGAGGGAGAGCTGGG + Intergenic
1089167320 11:116487206-116487228 TGGGAGGCAGAATCAGAGCTGGG - Intergenic
1089189339 11:116642893-116642915 AAGGAATCAGGGTCAGGGATGGG - Intergenic
1089359751 11:117877826-117877848 AGGGCAGCAGAGGCAGGGCTAGG - Intergenic
1090435873 11:126685964-126685986 AAGGGAACAGAGGCAGAGCCGGG - Intronic
1091220189 11:133926060-133926082 AGGGAAGCAGAGTCAGGGCCCGG + Intronic
1091720877 12:2812619-2812641 AAGGAGGAAGAGGCAGAGATTGG + Exonic
1091952509 12:4606704-4606726 GAGGAAGCTGAGTCAGTTCTGGG - Intronic
1092009422 12:5097227-5097249 GAGGAAGCAGATTCATAGCAGGG - Intergenic
1092652569 12:10650283-10650305 AAAGAACCAGTGTCAGAGTTAGG + Intronic
1092726741 12:11493976-11493998 TGGGAATCAGAGTCAGAGCAGGG - Intronic
1094092132 12:26662059-26662081 AAGGAATAGGAGTAAGAGCTAGG - Intronic
1095840041 12:46682982-46683004 AAGTAGGCAGAGCCAGAGGTTGG - Intergenic
1096814263 12:54191758-54191780 AAGTGAGCAGAGTCGGAGCTAGG - Intergenic
1098179076 12:67826643-67826665 AATGAAGCAAAGTGAGGGCTGGG + Intergenic
1098315228 12:69185610-69185632 AAGGATGCAGGCTCAGAGCATGG + Intergenic
1098753114 12:74321564-74321586 CAGGAAGTGGAGGCAGAGCTGGG - Intergenic
1099392535 12:82098365-82098387 GAGGAAGCAGTGGAAGAGCTTGG - Intergenic
1102096579 12:110246133-110246155 AAGGCAGGAGGGTCAGAGTTGGG - Intergenic
1102454430 12:113063021-113063043 TTGGAGGGAGAGTCAGAGCTGGG + Intronic
1102721774 12:115022602-115022624 AAGAAAGTACATTCAGAGCTGGG - Intergenic
1103004568 12:117410450-117410472 AGAGCACCAGAGTCAGAGCTGGG - Intronic
1103908094 12:124337583-124337605 AAGGAAGCTGAGGCAGGGCTAGG + Intronic
1104909846 12:132235482-132235504 AAGGAAGCTGGGGCACAGCTCGG + Intronic
1104933394 12:132352155-132352177 AAGGAGGCCGAGGCGGAGCTCGG + Intergenic
1105926979 13:25017700-25017722 GTGGAATCAGAGTCATAGCTTGG - Intergenic
1106192678 13:27467338-27467360 CTGGAAGCAGTGTCAGAGCCTGG + Intergenic
1106283903 13:28302548-28302570 AATGTAGAAGGGTCAGAGCTGGG + Exonic
1106310008 13:28545663-28545685 CAGGAAGTAGATTCTGAGCTTGG + Intergenic
1106467049 13:30022839-30022861 AAGGAAGCAGACACAGGCCTAGG - Intergenic
1107032343 13:35866129-35866151 AAGGACACAGAGGCAGGGCTGGG - Intronic
1107654033 13:42574038-42574060 AAGGAAGGGGAGCCAGAGGTGGG + Intronic
1108116007 13:47128966-47128988 AAGAAAGGAGAGGCAGTGCTTGG - Intergenic
1108579762 13:51818418-51818440 CAGGGGGCAGAGTCAGAGCCTGG + Intergenic
1108684945 13:52811075-52811097 AAGGAGGCAGCCTCTGAGCTAGG - Intergenic
1110129354 13:71987807-71987829 ATGGAAGCAGAGGCAGAAATGGG + Intergenic
1110730712 13:78876364-78876386 CAGGAAGCAGTGGCAGGGCTGGG - Intergenic
1110794436 13:79620369-79620391 AAGGAAGCAGACTCTGAAGTGGG - Intergenic
1110868680 13:80424900-80424922 ATGGAAGCAGCTTCAGAACTGGG - Intergenic
1110889315 13:80678778-80678800 AAGGAAGTAGAGGAAGAGATAGG - Intergenic
1112374294 13:98824518-98824540 AAGGAGGGACAGTCAGAGTTAGG + Intronic
1112496772 13:99911466-99911488 AGGGAGGCAGAGTCAGAGGGAGG - Intergenic
1113459319 13:110470868-110470890 AAGGAAACAGGGTCAGGGTTTGG - Intronic
1113586648 13:111470392-111470414 AAGGCAGGAGAGTCAAATCTGGG - Intergenic
1113639883 13:111949651-111949673 AAGGAAGCAGATTCGGAGAATGG - Intergenic
1113682822 13:112256041-112256063 CAGGAAGCAGAGGAAGCGCTGGG - Intergenic
1113802151 13:113092241-113092263 ACGGAAGCAGAGGCTGAGCTTGG - Intronic
1114853065 14:26403912-26403934 AAGGAAGGCGAGTCAGTGCCTGG + Intergenic
1115463553 14:33688520-33688542 ATGCAAGCAGAGTCACAGATGGG + Intronic
1116376927 14:44213889-44213911 AAGGAAGCAGAATCACAGAGGGG + Intergenic
1116867702 14:50044614-50044636 AATGCAGCAGAGTAAGAGCTGGG - Intergenic
1117385205 14:55204994-55205016 AAGGGAGAAGAATGAGAGCTAGG + Intergenic
1117499183 14:56335357-56335379 AAAGAAGGAGAATCAGAGTTTGG + Intergenic
1117761415 14:59032734-59032756 AAGGAAGAACAGTTGGAGCTGGG - Intergenic
1118074215 14:62280876-62280898 AAGGAAGATGAGCTAGAGCTAGG - Intergenic
1118088998 14:62451436-62451458 AAGAATGCAGACTCAGAGCATGG - Intergenic
1118368143 14:65113228-65113250 AAAAAAGCAGGGTCAAAGCTGGG - Intergenic
1118632905 14:67722569-67722591 CAGGAACCTGAGCCAGAGCTGGG + Exonic
1119040756 14:71272213-71272235 AAGGAACCTGGGTCAGAGGTTGG - Intergenic
1119904922 14:78293000-78293022 AAGGAAACAGAGTCTATGCTAGG - Intronic
1120067217 14:80056742-80056764 AAGGAAACAAAATCAGACCTTGG + Intergenic
1121368698 14:93337583-93337605 TAGGAAGCAGTGGCAGGGCTGGG + Intronic
1122417720 14:101558276-101558298 GGGGAAGCAGAGTTAGAACTGGG - Intergenic
1124291423 15:28456380-28456402 AAGGAGGCTGAGGCAGAGCTGGG - Intergenic
1125524289 15:40365401-40365423 AAGGAAGCCGGGTTACAGCTGGG + Intronic
1125577561 15:40765962-40765984 AAGGGAGCAGAGGCAGGTCTAGG - Exonic
1126222465 15:46230246-46230268 GAAGAAGCAGAGTCAGAGGTTGG + Intergenic
1127170376 15:56294356-56294378 AAGGAAGAAGAGTCAAGGTTAGG - Intronic
1127639057 15:60898159-60898181 AAAGAAGCAGAGGCTCAGCTTGG + Intronic
1127910686 15:63413616-63413638 AAGGCAGAAGAGTCACTGCTGGG + Intergenic
1128072692 15:64807430-64807452 AAGCAAGCAGGGCCTGAGCTCGG - Intergenic
1128156358 15:65394288-65394310 AAGGAAGCAGAGTAGGGGTTGGG - Intronic
1128449019 15:67790931-67790953 ACAGAAGACGAGTCAGAGCTAGG + Intronic
1129196838 15:73973474-73973496 AAAGAAGCAGGGACTGAGCTGGG - Intergenic
1129245947 15:74278718-74278740 AAGGAAGCAGAACCAGAGAAAGG - Intronic
1130198827 15:81806673-81806695 AAGAAAGCGGACTCAGAGCATGG - Intergenic
1130745365 15:86647928-86647950 AGGGAGGAAGAGTCAGAGCCAGG + Intronic
1131347865 15:91667544-91667566 AAGGAAGAGGAATCTGAGCTCGG - Intergenic
1131537708 15:93251626-93251648 AAGGAAGGAGAGGCAGAGACTGG + Intergenic
1131642458 15:94307252-94307274 AAGAAAGCAGAGTAGGTGCTGGG + Intronic
1132225363 15:100136648-100136670 AAGGTCACAGAGTCTGAGCTGGG + Intronic
1132233169 15:100200045-100200067 GAGGAAGCGGAGCCAGCGCTGGG + Intronic
1132552079 16:557679-557701 AAGGCAGCGGAGGCAGCGCTCGG - Intergenic
1132684897 16:1158222-1158244 AAGGAAGCAGAGACACAGATGGG + Intronic
1133742742 16:8663621-8663643 AGGGATACAGAGTCAGGGCTGGG - Intergenic
1133858979 16:9576319-9576341 AAGGAAGCAGAGTGTGTGCTGGG + Intergenic
1134125782 16:11615087-11615109 AAGGAAGGAGAGACCAAGCTGGG + Intronic
1134260146 16:12644584-12644606 AAGGAAACAAAGCCAGAGCCAGG - Intergenic
1134643225 16:15846102-15846124 AAAAAAGAAGTGTCAGAGCTGGG + Intronic
1134904981 16:17972370-17972392 AAGTGAGCAGAGGCAGAGATGGG - Intergenic
1136685179 16:31989841-31989863 AAGGAAACAAAGTCAGGGCTGGG + Intergenic
1136785790 16:32933376-32933398 AAGGAAACAAAGTCAGGGCTGGG + Intergenic
1136883979 16:33920428-33920450 AAGGAAACAAAGTCAGGGCTGGG - Intergenic
1138454406 16:57113033-57113055 TGGGTAGCAGAGTCAGACCTCGG + Intronic
1138761659 16:59551519-59551541 CAGGAAGCTGAGGCATAGCTGGG - Intergenic
1138863558 16:60789506-60789528 AAGGAAGAAGATTCATAGCATGG + Intergenic
1138987130 16:62343229-62343251 GAGGAAGCAGAGTCAAAGGCAGG - Intergenic
1139092443 16:63664829-63664851 AGAGATGCAGAGACAGAGCTTGG - Intergenic
1139267686 16:65655731-65655753 AAGGAAGGAGACTCAGAGAGTGG - Intergenic
1139677634 16:68535945-68535967 AAGGAAGCTGAAGCAGAGCCGGG - Intronic
1140026645 16:71296847-71296869 AAGGAAACAGACTCAGAAGTTGG + Intergenic
1140584561 16:76274460-76274482 AAGCAGGCAATGTCAGAGCTTGG - Intergenic
1140952865 16:79835884-79835906 GTGGAAGCAGAGACTGAGCTAGG + Intergenic
1141145118 16:81523808-81523830 AAGGAAGCTGTGTCTGAGCGAGG - Intronic
1141735743 16:85851406-85851428 AAAGCACCAGAGTCAGTGCTGGG - Intergenic
1142418287 16:89955032-89955054 AAGGAGGCACCGTGAGAGCTGGG - Intronic
1203088024 16_KI270728v1_random:1195038-1195060 AAGGAAACAAAGTCAGGGCTGGG + Intergenic
1143488979 17:7272863-7272885 AAGGAAGCAGAATTAGAACCTGG - Intergenic
1143573812 17:7778018-7778040 TTGGAAGGAGAGTTAGAGCTGGG - Intronic
1143658501 17:8311176-8311198 AAGGCTGCAGGGTCAGGGCTGGG - Intronic
1143784889 17:9248737-9248759 AAGGGAGCAGAGGCAGAGGAAGG + Intergenic
1143948334 17:10613914-10613936 AAGGAAGAAGAGTCTGATTTAGG + Intergenic
1144226133 17:13148729-13148751 AAGGAAAAACAATCAGAGCTGGG + Intergenic
1144415130 17:15039195-15039217 AAGGAAGGAGAGAAAGAGATGGG + Intergenic
1144467520 17:15508309-15508331 AAGGAAGGAAAAACAGAGCTGGG + Intronic
1144484871 17:15656173-15656195 CTGGAAGCAGGATCAGAGCTTGG - Intronic
1145913809 17:28558538-28558560 GAGGAAGCTGAGTCAAAGCGGGG + Exonic
1146351967 17:32102567-32102589 ATAGAAGCAGATTCACAGCTGGG + Intergenic
1146473924 17:33146469-33146491 TAGGAAGTTGAGTCAGAGCCAGG - Intronic
1146639072 17:34526525-34526547 CAGGCAGCAGAGCCTGAGCTAGG + Intergenic
1146978115 17:37133429-37133451 AAGGAAGCAGAATCTGGGTTAGG + Intronic
1147146122 17:38485522-38485544 AAGGAAACAAAGTCAGGGCTGGG + Intronic
1147185309 17:38710231-38710253 GAGAAAGCAGAGCCCGAGCTGGG + Intronic
1147385777 17:40081086-40081108 TGGGCAGCAGAGTCAGAACTGGG - Intronic
1147916210 17:43888448-43888470 AGGGTAACAGAGCCAGAGCTGGG - Intronic
1148491866 17:48028515-48028537 AAGGAAGCAGAGTCAAGGGGTGG + Intronic
1148615284 17:48996575-48996597 AAGGAAGAGGAGTGATAGCTAGG - Intergenic
1148712637 17:49692892-49692914 CAGGAACCAGAGTTAGAACTTGG + Intergenic
1149468496 17:56897913-56897935 AATGGAACAGAGTCAGGGCTGGG - Intronic
1149647072 17:58248616-58248638 AAGCAAGCAGGGACATAGCTAGG - Intronic
1150103275 17:62442594-62442616 AAGGAAGCAGAGTCAGATGGTGG + Intronic
1150587070 17:66528503-66528525 AAGGATGCAGAAGCAGAGTTGGG + Intronic
1150884310 17:69067539-69067561 GAGTAAGCAGAGTGAGACCTTGG + Intergenic
1151223436 17:72631022-72631044 CAGGGAGCAGATTCAGAGTTGGG + Intergenic
1151329444 17:73398275-73398297 AAGGCAGCAGCCTCAGGGCTGGG - Intronic
1151464180 17:74273972-74273994 AAGGAAGAATAGTCAGTGCTTGG - Intergenic
1151993776 17:77595924-77595946 AAGGAAGGAGAGTCTGTGCTTGG + Intergenic
1152474169 17:80507037-80507059 AAGGAAGAAAATTCAGAGGTCGG + Intergenic
1152868110 17:82736115-82736137 AAAGAAGCAGAGACATGGCTGGG + Intronic
1152916555 17:83039728-83039750 AAGGAAACGGAGGCAGAGCGAGG + Intronic
1153308471 18:3654271-3654293 CAGGAAGCAGAGTGACTGCTTGG - Intronic
1153643323 18:7173995-7174017 AAGGAAGAAGAGGCAGAGGCAGG - Intergenic
1153693034 18:7612931-7612953 ATGGAAGCAGAATAGGAGCTGGG - Intronic
1153810730 18:8749594-8749616 AAGAAAGCAGAGCCTGAGCTTGG + Intronic
1154036218 18:10805012-10805034 AAGGTAGCAGAGAGAGAGCCGGG - Intronic
1154412812 18:14150506-14150528 GGGGAAGCAGAGGCTGAGCTGGG - Intergenic
1155001172 18:21688155-21688177 AAAGTAGCAGACTCTGAGCTTGG + Intronic
1155535101 18:26808985-26809007 AAGGAATTAGAGTCAGGCCTTGG + Intergenic
1156182395 18:34620672-34620694 AAGGAAGAAGAGAGAGAGCAGGG + Intronic
1156867234 18:41902631-41902653 AAGGAAAAAGAGTAATAGCTGGG + Intergenic
1157014989 18:43701118-43701140 AAGGAAGGAGAGAAATAGCTTGG - Intergenic
1157141636 18:45113834-45113856 AAGGAAGCAAAATTAGAGTTTGG - Intergenic
1157446850 18:47752812-47752834 AAACACTCAGAGTCAGAGCTGGG + Intergenic
1157743895 18:50117915-50117937 AAAGGAGCAAAGTCAGTGCTGGG + Intronic
1157916085 18:51665120-51665142 AAGGAACCAGAGGCAGACTTGGG - Intergenic
1157958412 18:52125197-52125219 AAGGCAGGAAAGTCAGAGCCAGG - Intergenic
1158065743 18:53405860-53405882 AAGCAAGAAGTGGCAGAGCTAGG + Intronic
1160660043 19:293666-293688 AAGGTGGCAGAGCCAGTGCTGGG - Intergenic
1160882595 19:1328320-1328342 AGGGAATTAGTGTCAGAGCTGGG + Intergenic
1161426528 19:4206683-4206705 TAAGAGGCAGAGTCAGATCTAGG - Intronic
1161447871 19:4328250-4328272 ATGGGGGCGGAGTCAGAGCTGGG - Intronic
1161483826 19:4524231-4524253 AAGGAGACTGAGTCAGGGCTGGG - Intronic
1161819418 19:6520391-6520413 TAGCCAGCAGAGGCAGAGCTGGG + Intergenic
1161842876 19:6693436-6693458 AAGGCCGCAAAGGCAGAGCTGGG + Exonic
1162050759 19:8031211-8031233 AAGGTTTCAGAGTCAGGGCTTGG + Intronic
1162154946 19:8671315-8671337 AAGAAAACACAGTAAGAGCTGGG - Intergenic
1162325406 19:9996268-9996290 AAGACAGAGGAGTCAGAGCTTGG + Intronic
1163668897 19:18616276-18616298 AAGAAAGCAGAGTCAAGGCATGG - Intronic
1163883228 19:19945278-19945300 AAAGAAGTAGAGCCAGAGCGGGG - Intergenic
1163958520 19:20665620-20665642 AAGGGAACAGAGGCCGAGCTGGG - Intronic
1164170360 19:22719696-22719718 AGGGAAGAAGAGTCATTGCTGGG + Intergenic
1164455005 19:28399583-28399605 AACCAAGCAGAGTGAGAGCATGG - Intergenic
1164594253 19:29523564-29523586 AAGGAAGCAGAGTGAGGGCCTGG + Intergenic
1165170803 19:33890329-33890351 GCAGAAGCAGAGTCAGAGCAGGG + Intergenic
1165623592 19:37268032-37268054 AAGGAAGCATAGTCTGAGGCTGG + Intergenic
1165786890 19:38466997-38467019 CAGGAATCAGAGTCAAAGGTGGG - Intronic
1166266250 19:41686423-41686445 AAGGAACCTGTGTCAGGGCTGGG - Intronic
1166313733 19:41977153-41977175 AGGAAGGCAGAGTCAGAGATAGG + Intronic
1166387788 19:42391671-42391693 AGGGAAGCAGCATTAGAGCTGGG + Intergenic
1167356078 19:49005096-49005118 AAGGAAGAAGAGGAACAGCTGGG - Intronic
1167844202 19:52147224-52147246 AAGAAAGCAGAGAGAGAACTTGG - Intergenic
1168098196 19:54127348-54127370 ACAGAAGCAGAGTCAGAGAGAGG - Intronic
925288497 2:2730961-2730983 AAGGGAGGAAATTCAGAGCTGGG + Intergenic
925774628 2:7322609-7322631 AAGGGAACAGAGTCAGAGTCAGG - Intergenic
927082282 2:19642413-19642435 ATGGAAGAATAGTCAGAGCTTGG - Intergenic
928092205 2:28381835-28381857 AGGGCACCAGAGGCAGAGCTGGG - Intergenic
928142296 2:28740238-28740260 AATGAAGCAGGGTAAGAGGTTGG - Intergenic
930423759 2:51187410-51187432 GAGAAAGAAGAGTGAGAGCTAGG - Intergenic
931218350 2:60266413-60266435 AAGGAAGCAGAGGAAGAGGGAGG + Intergenic
932260474 2:70322655-70322677 AAGGAAGTTGAGTCAGGGCATGG + Intergenic
933860183 2:86458755-86458777 AGAGAAGCAGGGTCAGAGATAGG + Intronic
934052093 2:88219606-88219628 CAGGCAGCAGAGTAACAGCTGGG + Intergenic
934746930 2:96765444-96765466 ACAGCACCAGAGTCAGAGCTGGG + Intronic
935689968 2:105722207-105722229 AGGGAAGCACAGTCAGAGAAAGG - Intergenic
937289175 2:120771742-120771764 AAGGCAGAAGACTCAGTGCTTGG - Intronic
937366554 2:121266257-121266279 AAGGAAGGAAGGTCAGAGATGGG - Intronic
937414856 2:121706181-121706203 TAGGCAGAAGAGTCAAAGCTTGG - Intergenic
937871827 2:126791699-126791721 AAGGGGACAGAGGCAGAGCTGGG + Intergenic
937941775 2:127291677-127291699 AAGGAGTCAGATTCAGACCTTGG - Intronic
938185129 2:129224853-129224875 TAGTAAGTAGAGGCAGAGCTGGG - Intergenic
939451867 2:142385037-142385059 ATTGAAGCAGAGTCAGGGTTTGG + Intergenic
939720556 2:145644844-145644866 AGGGAATCAGAGTCAGAAGTAGG + Intergenic
940969620 2:159881568-159881590 AAGGCAGCAGAGTCATACCAGGG - Intronic
941302494 2:163821027-163821049 AAGGAAGAAGATTTAGAGTTTGG - Intergenic
942047549 2:172108615-172108637 AAGCAAAGAGAGTGAGAGCTGGG + Intergenic
942091248 2:172493578-172493600 AAGGAAGCAGACTCAGAGAGGGG + Intronic
942312261 2:174666866-174666888 AAGAAACTAGAGGCAGAGCTAGG - Intronic
943533052 2:189111480-189111502 AAGGAAGGAGAGGTAGTGCTGGG - Intronic
944928076 2:204485680-204485702 GAGGAAGCAGAGTGAGAGGTGGG - Intergenic
945183878 2:207120099-207120121 AAGGAAGTAAAGTTAGAGATGGG - Intronic
946312359 2:218889841-218889863 AAGGAAACAGAGTCAAAGAAGGG - Intronic
946471800 2:219967361-219967383 GAGGAAGCAGAGGAAGGGCTGGG - Intergenic
946862736 2:224015304-224015326 ATGGAAGCAGAGGCACACCTGGG + Intronic
947811309 2:233005579-233005601 AAGGCAGAAGAGTCAGAGAGAGG + Intronic
948504044 2:238415865-238415887 CAGGAAGCAGCGACAGGGCTGGG - Intergenic
948895580 2:240925431-240925453 AAGGTTGCAGAGCCAGAGCCAGG + Intronic
1168871913 20:1136285-1136307 AAAGAGGCAGAGCCAGGGCTGGG + Intronic
1169411444 20:5373903-5373925 AGTGAAGCAGAGTGAGAGCCTGG + Intergenic
1169556873 20:6760650-6760672 AAGGAAGCTGAGTCAGAGTGGGG - Intergenic
1170048675 20:12115119-12115141 AGGGAAGCAAAGACAGAGCAGGG + Intergenic
1170191681 20:13651043-13651065 AGAGAAGCAGAGCCAGAGATGGG + Intergenic
1170248105 20:14246561-14246583 AAGGAATCAGAAGCAGAACTAGG - Intronic
1170854897 20:20043165-20043187 AAGGTGGAAGAGTCAGAGATTGG - Intronic
1171265714 20:23770999-23771021 GAGGAAGCAGCTTCAGAGCTGGG - Intergenic
1172586802 20:36091403-36091425 CAGGAAGGAGAGGCAGGGCTTGG - Intergenic
1173298358 20:41779185-41779207 AAGAAAGAAGTGGCAGAGCTAGG - Intergenic
1173557090 20:43973929-43973951 AAGGAAGCAGAGTCATTCCTGGG + Intronic
1173970814 20:47150787-47150809 AAGGAGGCAGAGACAGAGAAGGG + Intronic
1174414116 20:50356032-50356054 CAAGAAGGAGAGGCAGAGCTGGG + Intergenic
1174530513 20:51209125-51209147 AAGGAAGCTGAGACAGAGAATGG - Intergenic
1174757102 20:53170400-53170422 AAGGAAGCAGACTCAGATTTTGG - Intronic
1174762319 20:53217922-53217944 TAGAAAGGAGAGTCAGACCTAGG + Intronic
1175092799 20:56518817-56518839 AAGATAGCAGAGTCATAGTTGGG + Exonic
1175460140 20:59146260-59146282 AGAGAAGCAGAGGCAGAGATGGG + Intergenic
1175523562 20:59618435-59618457 AAGGCAGCAGAGTGAGACCAGGG + Intronic
1175712698 20:61233471-61233493 TGGGGAGCAGTGTCAGAGCTTGG + Intergenic
1176690734 21:9905042-9905064 CAGGAAGAAGAGTGAGAGGTGGG + Intergenic
1177950910 21:27535696-27535718 AAGCATCCAGAGCCAGAGCTAGG + Intergenic
1179135998 21:38680333-38680355 AATGAAGGAGAGTAACAGCTTGG + Intergenic
1179334519 21:40437868-40437890 AAAGAAGAAGAGCCAGAACTGGG + Intronic
1180608567 22:17080553-17080575 CAGGAATCAGAGTCAGGGATTGG - Intergenic
1181334097 22:22116267-22116289 AGGGAGGCCGAGGCAGAGCTGGG - Intergenic
1183481244 22:38066689-38066711 ATGCAATCAGAGTCAGAGGTGGG - Intronic
1183782808 22:40009519-40009541 AAAGGAGGAGAGTCCGAGCTGGG + Intronic
1184090876 22:42292438-42292460 GAGGAATCCGAGGCAGAGCTGGG + Intronic
1184507071 22:44910288-44910310 AAGGGAACCGAGTCTGAGCTTGG + Intronic
1184746391 22:46458572-46458594 GAGGAAGCAGGATCAGAGCAGGG + Intronic
1185364874 22:50432867-50432889 GGGGAAGCAGAGGCCGAGCTGGG + Intronic
949346174 3:3078883-3078905 AAAAAAGCAGTGTTAGAGCTGGG - Intronic
949483702 3:4517767-4517789 AAGGAGGGAGAGTCAGAGGCAGG - Intronic
949855887 3:8460694-8460716 AATAAAGCATAGTCAGAACTTGG - Intergenic
950103819 3:10375757-10375779 AAGCAAGGAGTGGCAGAGCTGGG - Intronic
950127568 3:10519420-10519442 AAGAGAGAAGAGTCACAGCTGGG + Intronic
950312467 3:11970467-11970489 AAGGAGGCAAAGTAAAAGCTGGG - Intergenic
950410300 3:12831819-12831841 ATGGAAGGAGAGACAGAGGTGGG - Intronic
950616602 3:14165092-14165114 AAGGAGGTAAAGTCTGAGCTGGG - Intronic
950721532 3:14886308-14886330 GAGGAAGCTGAGTGAAAGCTGGG + Intronic
951365673 3:21779091-21779113 AATCAACCACAGTCAGAGCTGGG + Intronic
951925569 3:27905653-27905675 AAAAAATCAGAGACAGAGCTGGG + Intergenic
952646057 3:35660406-35660428 GTGGAAGCAGAGTAAGAGTTTGG - Intronic
953262996 3:41358447-41358469 AAGGATGCAGAGGCAGAGAAAGG + Intronic
953557318 3:43956822-43956844 AAGAAAGCAGAGCCTGAGATGGG + Intergenic
953805790 3:46066217-46066239 AAAGAAGCAGAGAGAGAGCGAGG - Intergenic
953814281 3:46141692-46141714 AATGTAGAAGGGTCAGAGCTGGG + Intergenic
954214336 3:49116074-49116096 TAAGAGGCAGAGTCAGCGCTGGG - Exonic
954412802 3:50378339-50378361 AAGGAAGGAGAGGCAGAGGTGGG + Intronic
954419233 3:50409882-50409904 AGGGAATCTGAGGCAGAGCTTGG - Intronic
954440801 3:50521007-50521029 AGGGAAGGAGGGTCTGAGCTGGG + Intergenic
954516100 3:51178557-51178579 GAGAAAGCAGAGCCAGAGCTGGG + Intronic
954733657 3:52686355-52686377 AAGGAAGCAGCGTCTGAGCCAGG + Intronic
954990611 3:54837750-54837772 ATGGAAACAGAGGCAGAGATTGG - Intronic
955818519 3:62873738-62873760 AAGGCAGCAGTGGCAGGGCTTGG + Intronic
955939615 3:64135008-64135030 TAGGCAGCAGAGTCACTGCTAGG + Intronic
957432810 3:80134728-80134750 AAAGATGCAGTGTCAGAGCCAGG + Intergenic
960061891 3:113331256-113331278 CTGGAAGCAGAGGCACAGCTTGG - Intronic
960265941 3:115621283-115621305 GAGGAAGCTGATTCTGAGCTGGG + Intergenic
960551474 3:118981006-118981028 AGGGAAGCAGAGTAACATCTGGG + Intronic
960645214 3:119872936-119872958 AATTAAGCAGAGACAGAGATTGG - Intronic
961049263 3:123733222-123733244 GAGGAAGCAGACTCAGAGGTGGG - Intronic
961371920 3:126436456-126436478 GAGGAAGCAGAGACTGGGCTGGG + Exonic
961541451 3:127602813-127602835 AAGGCGGCATAGTCAGAGATGGG + Intronic
961717827 3:128870735-128870757 AAGGACACAGAGTCAGAGGTTGG + Intergenic
962727047 3:138240079-138240101 AAGGATGTACAGTCAGAGGTGGG - Intronic
963782271 3:149498426-149498448 AAGGAAGCAGAGGCACAGAGAGG - Intronic
965234195 3:166093924-166093946 AAGGAGGCAGAGGGAGAGATTGG + Intergenic
965609577 3:170530450-170530472 AAGTCACCAGAGCCAGAGCTTGG + Intronic
966322224 3:178713721-178713743 GTGGAAGCAGCGTCAGAGCATGG - Intronic
966472958 3:180312340-180312362 AAGGAAGGAGAGAAAGAGCAAGG - Intergenic
968646472 4:1743648-1743670 AGGGAAGCAGAGGCTGAGTTGGG + Intronic
969249951 4:5960737-5960759 ATGGAGGCAGTGTCTGAGCTCGG + Intronic
969341286 4:6543341-6543363 TAGGAGGCAGAGGCTGAGCTGGG - Intronic
969486778 4:7476766-7476788 ATGGAAGCAGAGGGAGAGCGTGG - Intronic
969539971 4:7782187-7782209 ATGGAAGCAGAGACAGGGCCTGG + Intronic
969662525 4:8538540-8538562 AAGACAGCAGAGTGAGAGCAGGG + Intergenic
970495973 4:16626595-16626617 AATGAAGCTTAGCCAGAGCTGGG - Intronic
971524992 4:27605536-27605558 AAGGAGGCAAAGCCAGTGCTTGG + Intergenic
971665019 4:29472272-29472294 GAGGAAGCAGAGAGAGAGGTGGG + Intergenic
972916220 4:43883311-43883333 AAGGTAGTAGAGGCACAGCTTGG + Intergenic
973256527 4:48118831-48118853 TAGGAAGCAGATTCAGAGTTGGG - Intronic
974010448 4:56601731-56601753 CAGGCAGCAGAGTAAGACCTTGG + Intronic
974599798 4:64063373-64063395 AAGAAAGAGGGGTCAGAGCTAGG - Intergenic
974775366 4:66473297-66473319 AAGGGGGCAGGGTCAGAGATTGG + Intergenic
974940275 4:68459903-68459925 AAGGAAGAAGAGTCAGTTTTGGG + Intronic
976326754 4:83780249-83780271 AAGGAAGCAGAGTGTGAGGTGGG + Intergenic
976677399 4:87718425-87718447 AAGGAAGCTGGGTCAGGGGTGGG + Intergenic
978061562 4:104345590-104345612 TAGGAAGCAGTGGCAGAGCTGGG + Intergenic
978165580 4:105602868-105602890 TAGGAAGCAGAGCCAGTTCTGGG - Intronic
978672103 4:111261926-111261948 AAAGAAGCAGAGTCAGCAGTTGG - Intergenic
979101475 4:116621146-116621168 TTTGTAGCAGAGTCAGAGCTTGG - Intergenic
980067099 4:128201673-128201695 AAGGAAGCAAGGTCTAAGCTGGG - Intronic
981116139 4:140993288-140993310 AAGGAAGCAGAGTCCGAATGAGG - Intronic
982072862 4:151710680-151710702 AAGGCAGCAGAAGCTGAGCTAGG - Intronic
982122264 4:152154585-152154607 AAGGAAGTCGAGTCAGAGAAGGG + Intergenic
982249332 4:153388801-153388823 TTGGAAGCAGAATAAGAGCTCGG - Intronic
983040798 4:162923537-162923559 AAGAATGCAGACTCAGAGCATGG - Intergenic
983316536 4:166139554-166139576 AGGGAAGCAGAGCAAGAGCAAGG - Intergenic
983653296 4:170054923-170054945 AAAGAAGAAAAGTCAGAGATAGG - Intergenic
984423850 4:179558605-179558627 GAGGAAGCAGAGACAGATCCTGG + Intergenic
984642992 4:182190648-182190670 AAAAAAGAAAAGTCAGAGCTTGG - Intronic
985123136 4:186663751-186663773 AAGGAAGCTGAGTCACAGAAAGG - Intronic
986510694 5:8503528-8503550 CAGGAAGAAGAGTGAGAGCAGGG + Intergenic
988373814 5:30407464-30407486 AAGGAATCAGTTTCAGAGCTGGG + Intergenic
990008177 5:50966433-50966455 GGGGAAGGAGAGGCAGAGCTCGG + Intergenic
990647294 5:57858782-57858804 CAGGAAGCAGACTCTGAGATGGG + Intergenic
990690644 5:58359862-58359884 AAGGAAGGAAAGTCAGGTCTTGG + Intergenic
990950404 5:61293037-61293059 AATGAGGCAGAGGCAGAGCTGGG + Intergenic
991400931 5:66250885-66250907 AAGTCAGCAGAGTCTGAGCTAGG - Intergenic
991548283 5:67807848-67807870 AAGGAAGCATGGTTGGAGCTTGG - Intergenic
992085307 5:73273081-73273103 ATGGAAGCTGGGTCAGAGATGGG + Intergenic
992102016 5:73417344-73417366 ATTGAAGCAAAGACAGAGCTGGG + Intergenic
992857932 5:80882909-80882931 CATGAAGCAGAGTTAGTGCTTGG - Intergenic
993115346 5:83714004-83714026 AAGGAAACAAAAACAGAGCTGGG + Intronic
993238544 5:85347932-85347954 AAGAATGCAGAGTCAAAGCTGGG - Intergenic
993640347 5:90396120-90396142 AAGGAAGTAGAAAGAGAGCTGGG + Intronic
993955779 5:94230783-94230805 TAGGAAGCATGGACAGAGCTAGG + Intronic
994164593 5:96595592-96595614 AAAGAAGCAGAGACAGTGATGGG + Intronic
996563772 5:124858216-124858238 AAGGAAACAGAGTCAGTTCATGG + Intergenic
996927712 5:128847533-128847555 AAGGAGGCAGAGAAAGAGTTAGG + Intronic
997436968 5:133882557-133882579 CAGGAAGGAGAGGCAGAGCTGGG - Intergenic
997592924 5:135086648-135086670 AAGGAGGAGGAGTGAGAGCTGGG + Intronic
997616897 5:135252756-135252778 AAGGAAGCAGAGGCACAGCCTGG + Intronic
998092384 5:139378946-139378968 AAGAATGCACAGTCAGAGCCGGG + Intronic
999798318 5:155008934-155008956 AAGGACACAGAGCCAGAGCAGGG + Intergenic
999972951 5:156883199-156883221 AAGGAAGCAGGCTGAGAGCTGGG + Intergenic
1000128448 5:158270723-158270745 AAGAAAACAGAGGCAGAGCATGG + Intergenic
1000299986 5:159947663-159947685 AAAGAAGCAAAGTCATAGCCAGG - Intronic
1001094869 5:168768267-168768289 CAGGAAGCAGCGTCAGAGAGAGG + Intronic
1001108029 5:168872045-168872067 TGGGAAGCTGAGTCAGGGCTTGG + Intronic
1001819290 5:174697088-174697110 AAGGCAGCAGAGACAGAAGTGGG - Intergenic
1002361447 5:178674617-178674639 AATGAAGCTAAGACAGAGCTTGG - Intergenic
1003073567 6:2963626-2963648 GAGGCAGCAGGGACAGAGCTTGG + Intronic
1003352214 6:5328539-5328561 TAGGAAACAGAGGCAGAGATTGG - Intronic
1004566144 6:16799630-16799652 AAAGAAGCAGGGACAGAGCCTGG + Intergenic
1005357272 6:24996564-24996586 AAGGAAGCAGAAACAGTGGTGGG - Intronic
1006173277 6:32107644-32107666 CAGGAAGCTGAGTCACAGTTTGG - Intronic
1006424681 6:33956609-33956631 CAGGAAGCCCAGGCAGAGCTGGG - Intergenic
1006456515 6:34134987-34135009 ATGGAAGCTGAGTCAGGGCTTGG + Intronic
1006707939 6:36038116-36038138 AGGGAAGGAGAGTGAGTGCTAGG + Intronic
1006847825 6:37075093-37075115 AAGGATGCAGAGAAAGATCTTGG - Intergenic
1007244405 6:40450177-40450199 AAGGATGCAAAGTCAGTGGTGGG - Intronic
1007547844 6:42707950-42707972 AAGGAAGCAGAGGCAGGGAGAGG - Intronic
1008133010 6:47739842-47739864 AAGGAGGCAGAGGCAGAACTTGG + Intergenic
1008721800 6:54363038-54363060 GAGGAAGTAAAGTCTGAGCTGGG + Intronic
1009310876 6:62151059-62151081 AAGGTAGCAGGGTCAGGGGTGGG + Intronic
1009944538 6:70327940-70327962 AAGCATGAACAGTCAGAGCTAGG + Intergenic
1010588892 6:77689566-77689588 AAGGGTGCACAGTCAGGGCTTGG + Intergenic
1010835247 6:80579065-80579087 AAGGAAGTAGAGACAGAAATAGG + Intergenic
1010884061 6:81215308-81215330 AGGGCAGAAGAGTCAGAGCAGGG + Intergenic
1010981003 6:82369458-82369480 AAGGAAAAAGAGTAGGAGCTTGG + Exonic
1011459240 6:87586384-87586406 AAGTAAATAGAGTGAGAGCTTGG - Intronic
1011987282 6:93464426-93464448 AAGGAAGCAGTTTGGGAGCTTGG + Intergenic
1012132857 6:95518997-95519019 CAGGAAGCAGTGGCAGGGCTGGG - Intergenic
1012545333 6:100412814-100412836 AAGGAAGGAAAGTCACAGCTGGG + Intronic
1012754569 6:103210032-103210054 CAGGCATCAGAGTAAGAGCTGGG - Intergenic
1012794746 6:103745016-103745038 AACCAAGGAGAGACAGAGCTGGG + Intergenic
1013334159 6:109138107-109138129 ACTGAAGGAGAGTCAGAGTTGGG + Intronic
1016834037 6:148459296-148459318 AAGGAGGGAGAATCAGATCTGGG - Intronic
1017620322 6:156289972-156289994 AAGGAGCCAGAGACAGTGCTGGG - Intergenic
1018131173 6:160733547-160733569 AAGGAAGAAGAGGCTGAGCATGG + Intronic
1018366640 6:163127185-163127207 CAGGAGAAAGAGTCAGAGCTGGG - Intronic
1018783662 6:167091741-167091763 AAGGAAGCAGCATCAGAGCCAGG + Intergenic
1019341563 7:511121-511143 CAGGCAGCAGAGGCTGAGCTGGG + Intronic
1019563664 7:1669682-1669704 AAGGAAGCGGGGCCAGGGCTGGG + Intergenic
1019645515 7:2126730-2126752 AAGGAAGCAGAGTGACCGCTGGG + Intronic
1020279967 7:6645138-6645160 GAAGGAGCAGAGCCAGAGCTGGG - Intronic
1020676283 7:11188755-11188777 AAAGAAGCTGAGTAAGTGCTGGG + Intergenic
1021313526 7:19118469-19118491 AAGGCAGCAGAGCCAGAGGGGGG + Intergenic
1021444681 7:20719651-20719673 AGGGAAGCAGAGCCAGAGCAGGG + Intronic
1024589092 7:50865537-50865559 AAGGAAGCAGATTCTGAAATTGG + Intergenic
1024979443 7:55145172-55145194 ACAGAGGCACAGTCAGAGCTGGG - Intronic
1026087656 7:67275657-67275679 AAGGAAGCAGGGGCGCAGCTTGG + Intergenic
1026443262 7:70461854-70461876 ATTGACGCAGAGTCAGAGTTAGG - Intronic
1026503967 7:70966430-70966452 GAGGAGGCTGAGTCAGAGCAGGG - Intergenic
1026535861 7:71238091-71238113 CAGCAAACAGAGCCAGAGCTGGG + Intronic
1026726576 7:72874574-72874596 AAGGAAGCAGGGGCGCAGCTTGG - Intergenic
1027245686 7:76365733-76365755 AAGGAAGCAGAGACACAGAGAGG + Intergenic
1027263196 7:76479447-76479469 CAGGGAGCAGGGGCAGAGCTGGG - Intronic
1027314580 7:76977552-76977574 CAGGGAGCAGGGGCAGAGCTGGG - Intergenic
1029720240 7:102359023-102359045 AAGGAAGCAGGGGCGCAGCTTGG - Intergenic
1030085832 7:105814696-105814718 AAGGAAGAAGAGTCAGAAAGGGG + Intronic
1030948994 7:115765742-115765764 AAGAAAGCAAGGTCAGTGCTGGG - Intergenic
1031468124 7:122138841-122138863 AAGGACACAGAGACAGAGCTCGG + Intronic
1032032466 7:128495767-128495789 AAGGAAGCAGAGTCAGATGGTGG + Intronic
1032238459 7:130143214-130143236 AATGAGGCAGAGCCAGGGCTAGG + Intergenic
1032270827 7:130403383-130403405 AATGAGGCAGAGGAAGAGCTGGG + Intronic
1032301028 7:130687170-130687192 AAGAAAGAAGATTCAGGGCTGGG - Exonic
1032401343 7:131626389-131626411 CAGGAAGCAGGGTCAGGGCCAGG + Intergenic
1032571694 7:133007266-133007288 AAGCAAGCAGGGGCAGACCTAGG + Intronic
1032893176 7:136221909-136221931 AATGAGGCAGAGTCAGCACTAGG + Intergenic
1033427227 7:141255203-141255225 AAGGCATCAGAGGCAGAGCTGGG + Intronic
1034526753 7:151668849-151668871 TTGGAAGCAGAGCCTGAGCTGGG - Intronic
1035055101 7:156030059-156030081 AAAAAAGAAAAGTCAGAGCTTGG + Intergenic
1035170220 7:157013198-157013220 GGGGAGGCAGAGTCACAGCTAGG - Intergenic
1035983674 8:4401866-4401888 AAGACAGAAGAGTCAAAGCTGGG - Intronic
1036539034 8:9685572-9685594 AAGGCAGCTGGGACAGAGCTTGG - Intronic
1037040868 8:14231108-14231130 TAGGAAGCAAAGTCAGAGTCAGG - Intronic
1037645156 8:20786553-20786575 AAAGAAGCAGAGTCAGACTAGGG + Intergenic
1037690563 8:21178004-21178026 AAGGTAGCAGTGAAAGAGCTAGG - Intergenic
1038390954 8:27200484-27200506 AAGGATGCTGATTCAGAGCTGGG - Intergenic
1039640145 8:39210489-39210511 GAGGAGGCAGAGTAAGAGCACGG - Intronic
1040486687 8:47879634-47879656 ATGGAAGAAGAGTGACAGCTTGG + Exonic
1040607828 8:48951998-48952020 TGGGAAGAAGAATCAGAGCTGGG - Intergenic
1042113418 8:65405741-65405763 AAGAAGGCTGGGTCAGAGCTTGG + Intergenic
1042113818 8:65410171-65410193 AAAGAGACAGAGGCAGAGCTGGG - Intergenic
1042470579 8:69183074-69183096 GAGAAAACAGAATCAGAGCTAGG + Intergenic
1042488505 8:69372946-69372968 AAGGAAGTGGAATCTGAGCTTGG - Intergenic
1042902293 8:73741463-73741485 AAGCAAGCAGAGTAAGATATTGG + Intronic
1043186278 8:77154617-77154639 AAGAAAGCAGAGTAAGAGGCAGG - Intergenic
1043528041 8:81117800-81117822 AAGCAAGCAGAGCCAGATGTTGG + Intergenic
1044300012 8:90572842-90572864 AAGGAAGCAGAGAAAGAGAGAGG + Intergenic
1044599035 8:93985448-93985470 AAGGAATCAGAGTCATTTCTTGG - Intergenic
1045696294 8:104812320-104812342 AAGGAAGCAATGGAAGAGCTGGG - Intronic
1045894068 8:107193383-107193405 AAGGAAGAAGAATATGAGCTTGG + Intergenic
1046974180 8:120255125-120255147 AAAGCTGCATAGTCAGAGCTGGG - Intronic
1047476936 8:125241656-125241678 GAGGAAGCAGAGTCAGAGGTTGG + Intronic
1047486584 8:125336420-125336442 AGGGATTCAGAGTCAGACCTGGG - Intronic
1047857742 8:128930841-128930863 TGGGGAGAAGAGTCAGAGCTGGG + Intergenic
1047867590 8:129044086-129044108 AAGAAAGGAGAGTCAAAGGTGGG - Intergenic
1048767798 8:137863094-137863116 AAGGAATCAGAGACCCAGCTGGG - Intergenic
1049102659 8:140590472-140590494 AAGGAAGCAGAGGCACAGATGGG + Intronic
1050102500 9:2133748-2133770 TAGGAAGCAGAGACAGGGCAGGG + Intronic
1050166019 9:2765435-2765457 AAGAATGCAGACTCAGAGCATGG - Intronic
1050331451 9:4550095-4550117 CAGGAAGCAGAATCAGTACTAGG - Intronic
1050614906 9:7391853-7391875 AGGAAAGTAGAGGCAGAGCTGGG + Intergenic
1051326985 9:15982653-15982675 AAGGAAGCAGAGGCACAGAAAGG - Intronic
1051744271 9:20280093-20280115 TAAGAAGCAGAGTCTGAGATGGG + Intergenic
1053005541 9:34601932-34601954 AAGGAAGCAAAGACAGGGCTAGG + Intergenic
1053122142 9:35555416-35555438 GAGGCAGAAGAGTCAGTGCTGGG - Exonic
1053627466 9:39889556-39889578 CAGGAAGAAGAGTGAGAGGTGGG + Intergenic
1053778525 9:41576465-41576487 CAGGAAGAAGAGTGAGAGGTGGG - Intergenic
1053887474 9:42654941-42654963 AGGGAAACAGAGTCAGATGTGGG + Intergenic
1054166487 9:61786709-61786731 CAGGAAGAAGAGTGAGAGGTGGG - Intergenic
1054216421 9:62361147-62361169 CAGGAAGAAGAGTGAGAGGTGGG - Intergenic
1054226496 9:62462392-62462414 AGGGAAACAGAGTCAGATGTGGG + Intergenic
1054671060 9:67794196-67794218 CAGGAAGAAGAGTGAGAGGTGGG + Intergenic
1054974651 9:71128127-71128149 CAGTAAGGAGAGTCAGAGGTGGG - Intronic
1055075885 9:72214613-72214635 AAGGAAGCTGAGTCTGACATAGG + Intronic
1055264806 9:74482454-74482476 AAGGATTCAGAGTCAGAGACTGG - Intergenic
1056129754 9:83572526-83572548 GAGGAGGCAGCGTCAGAGTTTGG + Intergenic
1056278823 9:85019795-85019817 AAGGAAGTAGAGTCACTGGTTGG + Intronic
1056590068 9:87959734-87959756 AAGGAAGCTGAGGCAGAGAAAGG + Intergenic
1056729665 9:89154749-89154771 AAGGAAGCTGAGTCAGAGAGAGG + Intronic
1057948778 9:99353122-99353144 AAGGCAGCAGAGGCAGAGGCTGG + Intergenic
1058646531 9:107136132-107136154 ATGGAGGCAGAGTCAGAGAGAGG + Intergenic
1058777455 9:108298630-108298652 AAGAAACCAGAGTCAGAGAGAGG + Intergenic
1058981313 9:110173270-110173292 AAGAAACCAGAGTAAGAGTTTGG - Intergenic
1058981508 9:110174914-110174936 AAGAAACCAGAGTAAGAGTTTGG + Intergenic
1059269202 9:113061458-113061480 GAGGCAGGAGAGTTAGAGCTGGG - Intergenic
1059270337 9:113066907-113066929 GAGGCAGGAGAGTTAGAGCTGGG - Intergenic
1059271473 9:113072357-113072379 GAGGCAGGAGAGTTAGAGCTGGG - Intergenic
1059272604 9:113077801-113077823 GAGGCAGGAGAGTTAGAGCTGGG - Intergenic
1059273739 9:113083243-113083265 GAGGCAGGAGAGTTAGAGCTGGG - Intergenic
1059274873 9:113088689-113088711 GAGGCAGGAGAGTTAGAGCTGGG - Intergenic
1059453857 9:114387617-114387639 AAGAGATCAGAATCAGAGCTAGG + Intronic
1059676122 9:116541653-116541675 ATGGAAGCAGAGACAGAACAAGG + Intronic
1060555065 9:124503835-124503857 AAGGAGGCAGAGACAGAGTCCGG + Intronic
1061149366 9:128820251-128820273 AAGGAAGCTGGGTCAGAGGTTGG - Exonic
1061500922 9:131001420-131001442 AAGGAGGAAGCATCAGAGCTGGG + Intergenic
1061685797 9:132276663-132276685 AAGGAAGTAGTGACAGAGGTTGG - Intronic
1062360704 9:136186607-136186629 AAAGAGGCTGAGCCAGAGCTGGG - Intergenic
1062378990 9:136277690-136277712 CAGCATTCAGAGTCAGAGCTGGG - Intergenic
1062622103 9:137427780-137427802 CAGGAAGCTGAGTCTGAGCTGGG + Intronic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1186541023 X:10400182-10400204 AAGGAAGGAGAGGCCAAGCTAGG - Intergenic
1186613931 X:11166694-11166716 AAGGAAGGGAAGTCAGTGCTAGG + Intronic
1187933619 X:24315234-24315256 AGGGGAGCTGAGTCAGAGATGGG + Intergenic
1188581473 X:31718966-31718988 AAGGGGGCAGAGCCAGTGCTTGG + Intronic
1189273943 X:39771276-39771298 GAGGAAACAGAGGCTGAGCTGGG - Intergenic
1189712179 X:43824730-43824752 AAGAAAGCAGAGTAACAGCTGGG + Intronic
1190093723 X:47462329-47462351 AAGGGAGCAGGGACAGATCTGGG - Intronic
1190334216 X:49252753-49252775 AAGGAGTTAGAGTAAGAGCTGGG + Intronic
1190757228 X:53411756-53411778 AAGAAAGTAGAGACAGAGGTGGG - Exonic
1191849929 X:65578636-65578658 AAGGAAGCAGAGGGAGAGAGAGG + Intergenic
1191865307 X:65698940-65698962 AAGGAATCAGTGGCAAAGCTAGG + Intronic
1192073342 X:67963806-67963828 AAGGAGGCAGAGAAAGAGATAGG + Intergenic
1192204047 X:69084401-69084423 AAGGAAGGTGAGTGAGAGATGGG - Intergenic
1192233490 X:69281627-69281649 GAGGAAACAGACTCAGAGTTGGG - Intergenic
1192435489 X:71141126-71141148 GAGGAAGCAGGGTGGGAGCTCGG - Intronic
1192846539 X:74911634-74911656 AAAGAAGCAGTTTCAGAGTTAGG - Intronic
1194285518 X:92006200-92006222 AAGGAAGTAGAGAAAGAGATAGG - Intronic
1195134813 X:101894377-101894399 GAGGTAGAAGAGTCACAGCTTGG + Intronic
1195301251 X:103532093-103532115 CAGGACGTAGAGTCAGGGCTGGG - Intergenic
1195383933 X:104296059-104296081 AAGGAGGGAGAGGCAGAGCCAGG + Intergenic
1196634280 X:117983098-117983120 AAGGCAGAAGAGACAGAGCTAGG + Intronic
1197833831 X:130673262-130673284 AAGGAACCAGTGTAAGAACTCGG + Intronic
1199013555 X:142785303-142785325 AAGGCAGAAGAGTCAGAACTAGG - Intergenic
1199308859 X:146298902-146298924 CACTAAGCAAAGTCAGAGCTGGG + Intergenic
1199456280 X:148032849-148032871 AAGAAATCAGAGCCAGAACTAGG - Intergenic
1200122651 X:153798443-153798465 AAGGAAGCAAGGGCAGGGCTGGG - Exonic
1200153785 X:153964544-153964566 AAGGAGGCAGAGTGAGAACCTGG + Intronic
1200603085 Y:5230738-5230760 AAGGAAGTAGAGAAAGAGATAGG - Intronic
1200624476 Y:5494589-5494611 ATGGCAGAATAGTCAGAGCTAGG + Intronic
1201144590 Y:11057034-11057056 GGGGAGGCAGAGTCAGAGCCAGG + Intergenic
1202082032 Y:21093280-21093302 AGGGAATCAGAGACAGAACTTGG + Intergenic