ID: 1186480219

View in Genome Browser
Species Human (GRCh38)
Location X:9890959-9890981
Sequence TCCTCCTAGAAAAGAACGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186480219_1186480225 6 Left 1186480219 X:9890959-9890981 CCCTGCGTTCTTTTCTAGGAGGA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1186480225 X:9890988-9891010 TGGGCTGGAGGCCTCACTCCTGG 0: 1
1: 1
2: 4
3: 29
4: 303
1186480219_1186480223 -9 Left 1186480219 X:9890959-9890981 CCCTGCGTTCTTTTCTAGGAGGA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1186480223 X:9890973-9890995 CTAGGAGGAGCGAGCTGGGCTGG 0: 1
1: 0
2: 1
3: 36
4: 248
1186480219_1186480224 -6 Left 1186480219 X:9890959-9890981 CCCTGCGTTCTTTTCTAGGAGGA 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1186480224 X:9890976-9890998 GGAGGAGCGAGCTGGGCTGGAGG 0: 1
1: 1
2: 5
3: 86
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186480219 Original CRISPR TCCTCCTAGAAAAGAACGCA GGG (reversed) Exonic
902417933 1:16253013-16253035 TACTCCTAGAAAAGAAGACAGGG + Intronic
904309292 1:29617020-29617042 TCCTCCTAGCAAAGAAAAAAAGG - Intergenic
905178319 1:36151765-36151787 TCTCCCTAGAAAACAACACAAGG + Intronic
906570394 1:46833075-46833097 TTCTCCAATAAAAGAAAGCAAGG - Intergenic
907604545 1:55803695-55803717 TTCTCCTAGCAAAGCACACAAGG - Intergenic
911258800 1:95662816-95662838 ACCTCCTAGAAGAGAACATAGGG - Intergenic
911885315 1:103290304-103290326 TCATCCTATATAAGAAAGCAAGG + Intergenic
913676206 1:121143041-121143063 AACTCCTAGAAGAGAACACAGGG - Intergenic
913940754 1:125102675-125102697 TAGTACCAGAAAAGAACGCATGG + Intergenic
913943966 1:125139316-125139338 TAGTACCAGAAAAGAACGCATGG - Intergenic
913955228 1:143284438-143284460 TAGTACCAGAAAAGAACGCATGG + Intergenic
914028101 1:143930985-143931007 AACTCCTAGAAGAGAACACAGGG - Intergenic
915060278 1:153176104-153176126 TCCTCCTAGAAATGAAGACTTGG + Intergenic
917958826 1:180126526-180126548 ACATCCTAGAAAAGACCCCAAGG + Intergenic
918877900 1:190073374-190073396 AACTCCTAGAAGAGAACACAGGG - Intergenic
920463572 1:206161879-206161901 AACTCCTAGAAGAGAACACAGGG - Intergenic
920973928 1:210767940-210767962 TCCTCCTATAACAGAATGAATGG - Intronic
923038559 1:230302564-230302586 TCCTCCTACAAATCAACTCAGGG + Intergenic
1063349933 10:5344882-5344904 TCCTTCCAGAGAAGAAGGCAGGG - Intergenic
1064289149 10:14017576-14017598 TCCTCCTGGAAAAGGAAGCATGG - Intronic
1068332260 10:55586360-55586382 TTATTCTAGAAAAGAAGGCAAGG - Intronic
1069470320 10:68682818-68682840 TCCACCTAGAAAAGAAAGCATGG - Exonic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1071792406 10:88969025-88969047 TCCTCCTAAATAAGAAGGAAGGG + Intronic
1071882979 10:89919418-89919440 TCCTGCTATAAAATAATGCAGGG + Intergenic
1073623982 10:105077132-105077154 TCCTACTAGGAAAGAAGGAAGGG - Intronic
1076704785 10:132295261-132295283 TCCTCCTAACAAAGAAACCAGGG + Intronic
1078129471 11:8601505-8601527 TCATCCCAGGAAAGAATGCAGGG + Intergenic
1079740293 11:24050330-24050352 TCCTCCTAGAATCCAAGGCATGG + Intergenic
1079828716 11:25233866-25233888 TCCTCCCAGGAAAGAGCCCAGGG - Intergenic
1086559361 11:88149223-88149245 TCCTCCTAGGAAAGAAAAGATGG - Intronic
1089790905 11:120942729-120942751 TCATCCCAGAAATGAATGCAGGG - Intronic
1091706787 12:2699413-2699435 TGCTCCTAGAAAAGACCTGATGG + Intergenic
1092423856 12:8357342-8357364 TGCTCCCAGAAATGAAAGCAAGG + Intergenic
1094663520 12:32495352-32495374 TTATCTTAGAAAAGAACCCAGGG + Intronic
1095156231 12:38858328-38858350 TTCACCCAGAAAAGAATGCAAGG + Intronic
1095262371 12:40111177-40111199 TCCTCTGAGAAAAAAAGGCAAGG + Intergenic
1096146105 12:49279981-49280003 TGCTCTTAAAAAAGAACTCAGGG + Intergenic
1096813582 12:54187233-54187255 TTCTCCAAGATAAGAACTCAAGG + Intronic
1100745346 12:97639685-97639707 TCATCCTTGAAAAGAAAGAAAGG - Intergenic
1100829831 12:98507785-98507807 TACTCTCAGAAAAGAAAGCAAGG - Intergenic
1101787706 12:107899984-107900006 TCCTGCTAGAGAAAAACGAATGG - Intergenic
1102287419 12:111669926-111669948 TCCTTCAATAAAAGAAAGCATGG - Intronic
1106821433 13:33468746-33468768 TGCTTCTAGAAAAGAATACATGG - Intergenic
1107526187 13:41234003-41234025 TCCACCTAGAACAGAAGGCATGG + Exonic
1107717634 13:43216561-43216583 TCCTCCTCCAAAAGAAAGAAGGG - Intronic
1108489758 13:50969834-50969856 AGCTCCTAGAACAGAACGCAGGG - Intronic
1114826493 14:26087007-26087029 TGCTCCTGGAAATGAACTCAGGG + Intergenic
1115080079 14:29440026-29440048 TCCTCACAGAAAAAAAAGCAAGG - Intergenic
1118043304 14:61939913-61939935 TTCTCCTAGAAAAGAATGACAGG - Intergenic
1122773688 14:104108002-104108024 CCCTCCCCGAAAAGAACCCAGGG - Intronic
1124873245 15:33564749-33564771 TGGTCCTAGAAGAGAAGGCATGG - Intronic
1129102352 15:73277767-73277789 TTCTCCTAGAAAAGCAACCAAGG - Intronic
1131139996 15:89969482-89969504 ATCTCCTAGATAAGAACACAGGG + Intergenic
1131898944 15:97066758-97066780 TCCTCCTAGATAACAGAGCAAGG - Intergenic
1136697775 16:32100830-32100852 TAGTACCAGAAAAGAACGCATGG - Intergenic
1136701544 16:32148358-32148380 TAGTACGAGAAAAGAACGCATGG - Intergenic
1136766119 16:32779106-32779128 TAGTACGAGAAAAGAACGCATGG + Intergenic
1136769807 16:32826786-32826808 TAGTACCAGAAAAGAACGCATGG + Intergenic
1136798272 16:33044112-33044134 TAGTACCAGAAAAGAACGCATGG - Intergenic
1136801979 16:33091272-33091294 TAGTACGAGAAAAGAACGCATGG - Intergenic
1141606477 16:85156834-85156856 TACTCCTGGAAAAAAAGGCAGGG - Intergenic
1203068506 16_KI270728v1_random:1041352-1041374 TAGTACGAGAAAAGAACGCATGG + Intergenic
1203072227 16_KI270728v1_random:1088890-1088912 TAGTACCAGAAAAGAACGCATGG + Intergenic
1145290289 17:21539229-21539251 TTCTCCTATAAAAGAAACCAAGG + Intronic
1145692076 17:26752344-26752366 TAGTACCAGAAAAGAACGCATGG - Intergenic
1149854705 17:60070991-60071013 TTCTTCTAGAAAAGAATTCATGG - Intronic
1150412288 17:64955395-64955417 TCATGCTAGACAGGAACGCATGG + Intergenic
1150661252 17:67081704-67081726 TCCTTCTAGACATGAACACAAGG - Intronic
1203183598 17_KI270729v1_random:89892-89914 TAGTACCAGAAAAGAACGCATGG - Intergenic
1153975239 18:10263254-10263276 TTTTCCAAGAAAAGAACACAGGG + Intergenic
1159745097 18:72223445-72223467 TACTGTTAGAAAAGAATGCATGG - Intergenic
1159858114 18:73613705-73613727 TTCTCCTAGAAAGGAAGGAAAGG + Intergenic
1159868388 18:73732701-73732723 ACCTCCTAGAAAATAAAGAATGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1163772374 19:19198839-19198861 TCCTCCGAGAAGAGCAGGCAGGG - Intronic
1164537275 19:29095246-29095268 TCCCTCTAGAAAAGACTGCAGGG + Intergenic
1164779859 19:30883622-30883644 TTCACCTAGAAAAGAATTCAAGG - Intergenic
1167331180 19:48857358-48857380 TCCTCATAGAGAAGAAAGGAAGG + Intronic
1202671718 1_KI270709v1_random:60427-60449 TAGTACCAGAAAAGAACGCATGG - Intergenic
1202682062 1_KI270712v1_random:15199-15221 TAGTACCAGAAAAGAACGCATGG - Intergenic
925243842 2:2361105-2361127 TTCTCCTATAAAAGAATCCAGGG - Intergenic
929880327 2:45831085-45831107 CCCTCCGAGAAAAGAATGCTGGG + Intronic
930973642 2:57427639-57427661 TTTTCCTAGAAAAGGAAGCAGGG + Intergenic
931673138 2:64667382-64667404 TCCTCAGAGGAAAGAAGGCAAGG - Intronic
933797924 2:85936295-85936317 TCCTCCAATAAAAGAAACCAGGG - Intergenic
936376114 2:111942694-111942716 TGCTCCTACAAAAGAACGAGGGG + Intronic
936953462 2:118001614-118001636 TCCTCCTATAGAAGACCACAAGG + Intronic
938153621 2:128908644-128908666 TTCTCCTAGAGAAGGAAGCAGGG - Intergenic
940917745 2:159275871-159275893 TCCTCAAAGAATAGAACTCAAGG + Intronic
946761669 2:223000276-223000298 TCCATCTAGAAAAGACGGCATGG - Intergenic
947014457 2:225602563-225602585 AACTCCTAGAAAAAAATGCAGGG - Intronic
1169181794 20:3575428-3575450 TCCTCCTAGTTATAAACGCAAGG - Intronic
1169862375 20:10166300-10166322 TCCTACTAGAAAATTACGGATGG + Intergenic
1174002388 20:47384333-47384355 CCATCCTAGGAAAGAACTCAGGG + Intergenic
1174047190 20:47741802-47741824 TTCTCCTGGAAGGGAACGCAGGG + Intronic
1175006944 20:55694321-55694343 TCTTCCTGGACAGGAACGCAGGG - Intergenic
1180031119 21:45208815-45208837 TCCTCCTAGAAACCAGGGCAAGG - Intronic
1180864389 22:19107585-19107607 TTATCCTAGAAAAGAAGGGAAGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1184147991 22:42622672-42622694 TCCTCCCAGAAAGGAGCACATGG - Intronic
950538492 3:13595470-13595492 TCCTCATAAAAAAAAACTCAAGG + Intronic
950752754 3:15143836-15143858 TGCTCCCAGAAATGAAAGCAGGG - Intergenic
957067862 3:75540428-75540450 TGCTCCCAGAAATGAAAGCAGGG + Intergenic
957895278 3:86413294-86413316 ACCTCCTCGAAAAGGAGGCAGGG + Intergenic
961585651 3:127920545-127920567 GTTTCCTAGAAAAGAAGGCACGG + Intronic
961735394 3:128999176-128999198 AGCTCATACAAAAGAACGCAAGG + Intronic
966910438 3:184556652-184556674 AGCTCCTAGAAAAGGAAGCACGG + Intronic
969741653 4:9032733-9032755 TGCTCCTGGAAAAGAAAGCAGGG - Intergenic
969801020 4:9565636-9565658 TGCTCCTGGAAAAGAAAGCAGGG - Intergenic
974435655 4:61854256-61854278 TCCTACTAGAAAACAACACATGG - Intronic
976155888 4:82144501-82144523 TCCTACTACAAAATAAAGCAGGG + Intergenic
978028203 4:103904569-103904591 TGCTACTAGAAAAAAACACACGG - Intergenic
978405081 4:108370819-108370841 TCCTCCTCGAAAAGATGTCAAGG - Intergenic
982652423 4:158102998-158103020 TTCGCCCAGAAAAGAATGCAAGG + Intergenic
984177607 4:176438419-176438441 TCCTCCTGGAAAAGAAAGGCAGG + Intergenic
986482692 5:8204748-8204770 TCTTCCAAGAAAAGAAAGAAAGG + Intergenic
986644285 5:9901374-9901396 TCAGCCTAGAAAAGAGGGCATGG + Intergenic
987470925 5:18326304-18326326 CCCTCCTAGGAAAAAAAGCATGG - Intergenic
990417456 5:55599755-55599777 TCTTCCTTGAAAAGGACGCATGG + Intergenic
990621784 5:57567802-57567824 GCCTCCTAGAGAAGAAAGCAGGG - Intergenic
993322659 5:86492505-86492527 TTATCCTAGAAAAGTAAGCAAGG - Intergenic
994315035 5:98323467-98323489 TCCTCCAATAAAAGAAACCAGGG - Intergenic
995401038 5:111741947-111741969 TCCTGCTAGAAAGGAAAGGAAGG + Intronic
997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG + Exonic
998031802 5:138876866-138876888 TCCTCCTAGAAGTGATCCCAAGG + Intronic
998217536 5:140248562-140248584 TCCTCCTACAAAAGTCCGCCAGG + Intronic
1006027120 6:31154239-31154261 TCCTACTAGAAAGGGAAGCAGGG + Intronic
1019318440 7:402480-402502 TCCACCTAGGAAAGAATTCAAGG - Intergenic
1019637372 7:2083201-2083223 TCCTGCTAGAAAGGAATGAAAGG - Intronic
1021350600 7:19589214-19589236 TCCTCCTGGAAAAGACCAGAGGG - Intergenic
1021438326 7:20647787-20647809 TCCTCTTAGAAAAGAATTAAAGG - Intronic
1021860574 7:24901865-24901887 TACTCCTAGAAGACAATGCAGGG - Intronic
1021953986 7:25805433-25805455 TCCTGCTAGAAACCAACTCATGG + Intergenic
1025321341 7:58096965-58096987 TAGTACCAGAAAAGAACGCATGG - Intergenic
1025488401 7:61080748-61080770 TAGTACCAGAAAAGAACGCATGG + Intergenic
1025551452 7:62255250-62255272 TAGTACCAGAAAAGAACGCATGG + Intergenic
1026427810 7:70314027-70314049 TCCTGCTTAAAAAGAAGGCAGGG - Intronic
1028212757 7:88095260-88095282 TCCTCCAAGAGAAGCACCCACGG + Intronic
1028591011 7:92494591-92494613 TCATCAAAGAAAAGAATGCAGGG + Exonic
1033986519 7:147232724-147232746 TATTCCTAGAAAAAAACGTAGGG + Intronic
1034984769 7:155502871-155502893 TTCACCTATAAAAAAACGCAGGG + Exonic
1036788323 8:11702352-11702374 TCCTCCGAGAAAAGAAAGGCCGG + Intronic
1036887415 8:12568670-12568692 TGCTCCTGGAAATGAAAGCAGGG + Intergenic
1037291372 8:17352492-17352514 AACTCCTAGAAAAGAACATAAGG + Intronic
1040004328 8:42605987-42606009 AACTCCTAGAAGAGAACACAGGG - Intergenic
1044296770 8:90536890-90536912 TCATCCTAGAAATGCAGGCAGGG - Intergenic
1045908427 8:107376354-107376376 CTCTCCTGGAAAAGAACTCAGGG - Intronic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1052250822 9:26395150-26395172 ACCTCCTAGAAGATAATGCAGGG - Intergenic
1053373565 9:37584476-37584498 TCCTCCAAGAAAAGCATGTAAGG + Intronic
1057791691 9:98128821-98128843 TCCTCCCAGAAAACAGCTCAGGG + Intronic
1185544865 X:935416-935438 TCCTTCTAGACCAGAATGCATGG - Intergenic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1192979083 X:76319314-76319336 TCCACCTAGAAAAAGACTCAGGG - Intergenic
1195092059 X:101470092-101470114 TTCTCCCAGAAAAGAATTCAAGG - Intronic
1195557814 X:106247289-106247311 TTCTCCAAGAAAATAACTCATGG - Intergenic
1195942648 X:110178469-110178491 TCTTCCTGAAAAAGAACACATGG - Intronic
1195942768 X:110179197-110179219 TCTTCCTAAAAAGGAACCCATGG - Intronic
1200316518 X:155137924-155137946 TCCTCCTAGAAACATACACAGGG - Intronic
1201304350 Y:12537755-12537777 CACTCCTGGAAAAGAACGCAGGG - Intergenic
1201486686 Y:14502307-14502329 TTCTCCAATAAAAGAACCCAGGG - Intergenic