ID: 1186480243

View in Genome Browser
Species Human (GRCh38)
Location X:9891069-9891091
Sequence GGACCAGGAAGGACAGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186480243_1186480249 -1 Left 1186480243 X:9891069-9891091 CCAGCGGCTGTCCTTCCTGGTCC 0: 1
1: 0
2: 1
3: 15
4: 223
Right 1186480249 X:9891091-9891113 CGGCCGACACCACGCGAGGTAGG 0: 1
1: 0
2: 0
3: 1
4: 18
1186480243_1186480247 -5 Left 1186480243 X:9891069-9891091 CCAGCGGCTGTCCTTCCTGGTCC 0: 1
1: 0
2: 1
3: 15
4: 223
Right 1186480247 X:9891087-9891109 GGTCCGGCCGACACCACGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 30
1186480243_1186480255 25 Left 1186480243 X:9891069-9891091 CCAGCGGCTGTCCTTCCTGGTCC 0: 1
1: 0
2: 1
3: 15
4: 223
Right 1186480255 X:9891117-9891139 CCATTCCCGTCCAGGATGCCAGG 0: 1
1: 0
2: 0
3: 2
4: 118
1186480243_1186480252 17 Left 1186480243 X:9891069-9891091 CCAGCGGCTGTCCTTCCTGGTCC 0: 1
1: 0
2: 1
3: 15
4: 223
Right 1186480252 X:9891109-9891131 GTAGGCACCCATTCCCGTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186480243 Original CRISPR GGACCAGGAAGGACAGCCGC TGG (reversed) Exonic
900288563 1:1914166-1914188 GGCCCAGGAATGTCAGACGCTGG + Intergenic
900514510 1:3074878-3074900 GGACCAGGGATGTCAGCAGCCGG - Intronic
900760565 1:4467473-4467495 AGACTAGGAAAGGCAGCCGCCGG - Intergenic
900981902 1:6050459-6050481 GGACCAGTGAGGGCAGCCTCGGG - Intronic
901068941 1:6507783-6507805 GGGCCAGGGAGGACAAACGCAGG + Intronic
901339029 1:8478505-8478527 GGAGCAGGAAGGACAGGAGTGGG + Intronic
901450318 1:9332641-9332663 GGAGCAGGAAGAACAGGCGGAGG + Intronic
901615462 1:10535951-10535973 GGAACAGGAAGGATCGTCGCAGG + Intronic
904507950 1:30974650-30974672 GGCTCAGCAAGGACAGCAGCAGG - Exonic
904774896 1:32900788-32900810 AGGCCAGGAAGGAAAGCCGTGGG - Intronic
905105718 1:35562493-35562515 GGACGAGGAAGGGCAGCAGCTGG - Exonic
905356946 1:37391383-37391405 GGACCAGGCAGGCCAGCAGGAGG + Intergenic
910760397 1:90726762-90726784 GGAGCAGGAAGGAGAACCTCTGG - Intergenic
913174775 1:116263503-116263525 GGACCAGCAAGGATTGCCCCTGG - Intergenic
916123538 1:161549930-161549952 GGACCAGGAAGGAAAGAGCCTGG + Exonic
918309633 1:183276376-183276398 GGACCAGGGAGAAGAGCCCCAGG - Intronic
920061960 1:203233074-203233096 GGGCCAGGGAGGGCAGCCCCAGG - Intronic
922340692 1:224652685-224652707 GGAGCAGGAAGGACAGCAAGGGG + Intronic
922606573 1:226893343-226893365 GGAGCAGGAGGGACACCTGCAGG + Intronic
923331666 1:232931061-232931083 AGGCCAGGAAAGACAGACGCAGG - Intergenic
924944785 1:248838754-248838776 GGACCAGCGAGGACAGGCGGAGG - Intronic
1062859982 10:803480-803502 GGACAGGGCAGGACAGCCGATGG - Intergenic
1065020868 10:21500734-21500756 GGGCCAGGATGGAAGGCCGCAGG - Intergenic
1065198619 10:23291655-23291677 GGACCAGGACGGGCAGCGCCAGG + Intronic
1067089389 10:43258869-43258891 GGCCCGGGAAGGACAGCTGGGGG + Intronic
1067677685 10:48399146-48399168 GGACAATGAAGGAAAGCGGCAGG - Intronic
1071145101 10:82559552-82559574 GGACCCAGAAGGACAGCAGCTGG + Intronic
1071983993 10:91032459-91032481 GAACAAGGAAGGACAGCAGAAGG + Intergenic
1072310650 10:94151028-94151050 GGACATGGAAGAACAGCTGCTGG - Intronic
1073474775 10:103745742-103745764 GAATCAGGAAGGGCAGCCGCAGG - Intronic
1073681402 10:105708020-105708042 GGGCCAGGAAGCACAGGCGTTGG + Intergenic
1077096694 11:802004-802026 GGACCCGGAATGACAACAGCTGG - Exonic
1077117866 11:893449-893471 TGACCAGGAGGGCCAGCAGCCGG + Exonic
1079030361 11:16982001-16982023 ACACCAGGAAGGACAGACGGTGG + Intronic
1083674801 11:64319291-64319313 GGAAGAGGAAGGGCAGCGGCAGG - Intronic
1083902634 11:65650993-65651015 GGACCAGTCAGGACAGGCCCTGG + Intergenic
1084398770 11:68931707-68931729 GGAGCAGGGAGGACAGGCGTGGG + Intronic
1084462274 11:69302619-69302641 GTGCCAGGTAGGGCAGCCGCTGG + Intronic
1084533485 11:69743196-69743218 GGTCCAGGAAGGAAAGGTGCTGG + Intergenic
1084534074 11:69746523-69746545 GGACAAGGAGGGACAGGAGCCGG + Intergenic
1084883869 11:72190754-72190776 GGAGCAGGAAAGAGAGCTGCTGG + Intronic
1087944077 11:104137038-104137060 GGACCAGGAAGGAGGGGCTCTGG - Intronic
1091237805 11:134033441-134033463 GGACCAGCGAGGACTGCCCCAGG - Intergenic
1091836016 12:3586329-3586351 AGACTAGGAAGGAAAGCCACTGG - Intronic
1091896752 12:4111082-4111104 AGACCAGAAAGGACAGTTGCTGG - Intergenic
1092218782 12:6699629-6699651 GGTCCAGGCAGGACAGCCAGAGG + Intronic
1092226528 12:6751934-6751956 GGACCAGGCCTGCCAGCCGCCGG - Exonic
1092934492 12:13347855-13347877 GCCCCAGGAAAGACAGCCTCAGG - Intergenic
1093706384 12:22279317-22279339 GGACCTGGAAGGGCAGCCTGGGG - Intronic
1094569319 12:31627951-31627973 GCACCAGGAAAGAGAGCTGCAGG + Intergenic
1095780131 12:46049687-46049709 GGGCCATGAAGGACAGGGGCAGG - Intergenic
1097187136 12:57202015-57202037 GGCCCAGGAAGCCCAGCAGCAGG - Intronic
1100113569 12:91275037-91275059 GGACTAGGAAGGAGACCAGCTGG - Intergenic
1102511479 12:113418482-113418504 GGAACAGGAAGGTCAGCCAGGGG + Intronic
1103561937 12:121797407-121797429 GGACCAGCAGGAACAGCAGCAGG + Intronic
1104437758 12:128769315-128769337 TGAACAGGAAAGACAGCCCCTGG - Intergenic
1107098276 13:36560197-36560219 GACCCAGGGAGGACAGCAGCAGG - Intergenic
1108002381 13:45916050-45916072 GGACCTGGGAGGCCAGCCTCAGG - Intergenic
1113751287 13:112778040-112778062 GGAACAGGAAGGAGTGCCACAGG - Intronic
1114055566 14:18964907-18964929 GCACCAGGAAGGACAGTCTGGGG - Intergenic
1114106980 14:19436856-19436878 GCACCAGGAAGGACAGTCTGGGG + Intergenic
1118823095 14:69357885-69357907 GCACCAGGAAGGAGAGCTGGAGG + Intergenic
1120789191 14:88563378-88563400 GGAAATGGAAGGACAGGCGCAGG + Intronic
1123017476 14:105382271-105382293 GGACCAGGGAGGGCAGCAGAAGG - Intronic
1124141700 15:27082801-27082823 AGACCAGCCAGGACAGCAGCAGG + Intronic
1125722816 15:41853287-41853309 GCGGCAGGAAGGACAGCAGCTGG - Exonic
1128766743 15:70255719-70255741 AGCCCAGGGAGGACAGCAGCTGG + Intergenic
1129191820 15:73941924-73941946 GGAACAGGACGGACAGGCCCCGG + Intronic
1129367514 15:75065600-75065622 GGGCCAGGAAGTGCAGCTGCAGG + Intronic
1129451788 15:75655191-75655213 GGACCAGGCAGGAAAGAGGCTGG + Intronic
1132551775 16:556568-556590 GGCCCAGGAAGGCCAGCCCCGGG + Intergenic
1132608688 16:804411-804433 GGTCCTGGAAGGACAGAAGCAGG + Intergenic
1132892029 16:2209281-2209303 GCACCAGGGAGGACAGCTGCTGG - Exonic
1132907239 16:2288985-2289007 GGACCAGGAAGGAAAGAAGCTGG - Intronic
1133124950 16:3640818-3640840 GGCCCAGGAGTGACAGCCACAGG - Intronic
1133255014 16:4511416-4511438 AGACCAGGAAGGACAGTGGCAGG + Exonic
1137057021 16:35750792-35750814 GGGCCAGGACGGACAGCCCGGGG - Intergenic
1137563744 16:49520498-49520520 GGACCAGGAAGTGCTGCTGCAGG - Intronic
1139679758 16:68552419-68552441 GGCCCAGGGAGGAGAGCTGCTGG + Intronic
1139971555 16:70779197-70779219 GGTCCAGCATGGACAGCTGCTGG + Intronic
1141461147 16:84179513-84179535 GGAAGAGGAAGGGCAGCGGCTGG - Exonic
1141699100 16:85634343-85634365 GGCCGAGGAAGGACAGAGGCAGG - Intronic
1142618137 17:1148518-1148540 GAACCAGGATGCACAGCCGGAGG + Intronic
1143280086 17:5747452-5747474 GGACCAGGACAGACAGCCAGAGG + Intergenic
1143384910 17:6523450-6523472 GGACGAGGAAGCACAGCGGGAGG - Intronic
1143565585 17:7718418-7718440 GGATGAGGAAGGAGAGCCACAGG + Exonic
1143659550 17:8316085-8316107 GTAGCAGGAAGGACGGCAGCGGG - Exonic
1143728669 17:8867434-8867456 GGACCTGGAAGGGGAGCCCCTGG - Intronic
1143734449 17:8900677-8900699 GGGCCAGGCAGGGCAGCAGCTGG - Intronic
1143772365 17:9176856-9176878 GGACCAGAAAAGACAACTGCAGG - Intronic
1145916864 17:28579206-28579228 GGCCCAGGAAGAACAGCATCAGG - Exonic
1147313719 17:39608842-39608864 AGACCAGGAGAGAAAGCCGCTGG - Intronic
1147770832 17:42866855-42866877 GGAAAAGAAAGGAGAGCCGCAGG + Intergenic
1148074785 17:44928975-44928997 GGAGCAGGGAGTACTGCCGCTGG + Exonic
1148861672 17:50607797-50607819 GGAGCAGGAAGGACAGGCGGAGG - Intronic
1151331322 17:73410897-73410919 GGGCCAGGAAGGCCAGCCCATGG - Intronic
1151758952 17:76089960-76089982 GGACCAGGCAGTTCTGCCGCCGG - Intronic
1152039645 17:77894552-77894574 GGGCCAGAAAGGACACACGCAGG + Intergenic
1152508072 17:80765713-80765735 GGACAAGGACGGAGAGCCCCAGG - Intronic
1152782651 17:82233004-82233026 GCTCCAGGCAGGACAGCCCCAGG + Intronic
1154148728 18:11888512-11888534 GCACCAGCAAGGACAGCCTAAGG + Intronic
1157319126 18:46620776-46620798 TGACCAAGAAGGACAGACTCTGG + Intronic
1157319376 18:46622589-46622611 GGACCAGGGTGGTCAGCTGCTGG + Intronic
1157844785 18:50993095-50993117 GCACCAGGAAGGTCAGATGCAGG - Intronic
1158401387 18:57124342-57124364 AGCCCAGGAAGCACAGCCTCTGG - Intergenic
1158810083 18:61021778-61021800 GAACCAGGCAGCACAGCAGCAGG + Intergenic
1158893383 18:61893543-61893565 GCTCCTGGAAGGACAGCGGCAGG - Exonic
1160266258 18:77342670-77342692 GGACCAGGGAGCACAGCCCATGG + Intergenic
1160575789 18:79853082-79853104 TGACCAGGACGCACTGCCGCAGG - Intergenic
1160809711 19:1008093-1008115 GGGCCAGGTGGGACAGCCCCAGG - Intronic
1161570864 19:5030329-5030351 GGCCCAGGAAGGACAGGGCCTGG - Intronic
1161768316 19:6218633-6218655 GAGCCTGGAAGGACAGCTGCAGG - Intronic
1162043101 19:7982153-7982175 GGACCAGAGGGGACAGCCTCTGG + Intronic
1162043322 19:7983480-7983502 GGACCAGAGGGGACAGCCTCTGG + Intronic
1162493282 19:11007904-11007926 GGAGGAGGAAGAGCAGCCGCAGG + Exonic
1162738100 19:12757780-12757802 GGAGTAGAAAGGACAGGCGCCGG - Exonic
1164581434 19:29437817-29437839 AGACCAGGAAGGACAGACTCAGG - Intergenic
1165321944 19:35091002-35091024 GGAGCAGGCAGGGCGGCCGCGGG - Intergenic
1167627766 19:50603977-50603999 GGAGAAGGAAGGAAAGACGCTGG - Intergenic
1168687555 19:58357794-58357816 GGAGCAGGAAGGCCAGCAGGCGG + Intronic
928140479 2:28724172-28724194 GGAATAGGAAGGACAGCAGTGGG + Intergenic
928217441 2:29373723-29373745 GAACCAGGAAGGAAATTCGCTGG - Intronic
928332546 2:30368693-30368715 GGACCAGGAGGGACCGGAGCTGG + Intergenic
932329289 2:70888518-70888540 AGAGCTGGAAGGACAGCCGAGGG - Intergenic
933078001 2:77954103-77954125 GGAGAAGGAAGGAAAGACGCTGG + Intergenic
933613411 2:84459785-84459807 GGACCCGGAAGGGTTGCCGCTGG + Intronic
933893483 2:86790777-86790799 GGAGCAGCAAGGCCAGCGGCAGG + Exonic
934089978 2:88542820-88542842 GGAACAGGAAGGGCAGACCCTGG + Intergenic
934553641 2:95276554-95276576 TGACCAGGAAGGGCAGCCTCAGG + Intronic
934658689 2:96131791-96131813 GGAGCAGGAAGGCCTACCGCAGG - Intronic
934717151 2:96550727-96550749 GGACCAGGTAGGCCTGCGGCTGG + Exonic
934728402 2:96639897-96639919 AGACCAGGAGGGAGAGCCCCGGG + Intronic
934759175 2:96844077-96844099 GGACAGGGAAGGACTGGCGCAGG + Intronic
935046772 2:99489909-99489931 GGACCAGGGAGGAGGGCCGGGGG + Exonic
935545338 2:104394954-104394976 GGCCTGGGAAGGACAGCAGCTGG + Intergenic
935828700 2:106976985-106977007 GGAGCAGGAAAAACAGCCTCAGG - Intergenic
938473732 2:131589481-131589503 GGACCAGGAAGGACAGTCTGGGG - Intergenic
943555672 2:189401190-189401212 GGATAATGAAGGACAGCCTCAGG - Intergenic
945867538 2:215193513-215193535 GGAAAAGGAATGACAGCAGCTGG + Intergenic
947854106 2:233311664-233311686 GCAACAGGAAGGACAGGGGCAGG - Intronic
947874890 2:233461469-233461491 GCGCCAGGAAGGACTGCAGCCGG - Intronic
948640804 2:239375053-239375075 CGGGCAGGAAGGGCAGCCGCAGG + Intronic
948767727 2:240232159-240232181 TGACCAGGAGGGACCGCGGCAGG + Intergenic
948804297 2:240446852-240446874 GGACCAGGGTGGGCAGCCCCTGG + Intronic
948854340 2:240723118-240723140 GGACCCGGAAGGAGAGTCGCGGG - Intronic
948901088 2:240957230-240957252 GGAGCTGGAAGGACAGAGGCAGG - Intronic
1168908256 20:1423890-1423912 GGACCAGGAAGTAAGTCCGCTGG - Intergenic
1170930194 20:20762649-20762671 GGACCAGGGAAGAAAGACGCTGG + Intergenic
1172510515 20:35497766-35497788 GGCCCAGGAAGCACAGCTGCTGG + Exonic
1172787675 20:37479915-37479937 GGACCAGAGAGGAAAGCAGCAGG - Intergenic
1173228025 20:41173376-41173398 GGAGCAGGAAGGACAATCCCAGG + Intronic
1173499105 20:43539503-43539525 AGACCAGGAAGCAAAGCCACAGG + Intronic
1174440361 20:50546779-50546801 GGACCATGGAGGGCAGCAGCTGG + Intronic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1180474043 22:15687459-15687481 GCACCAGGAAGGACAGTCTGGGG - Intergenic
1181725185 22:24806413-24806435 GGACAAGAAACGAGAGCCGCGGG - Intronic
1182154220 22:28054135-28054157 GGATCATGAAGGATAGCTGCAGG - Intronic
1182620932 22:31618184-31618206 GGACCAGGAAGTAGAGCAGCAGG + Exonic
1183385170 22:37510095-37510117 GGATCAGGAAGGCCTGCAGCAGG - Intronic
1183530537 22:38351159-38351181 GGACAAGGAAGGACACAGGCAGG - Intronic
1184247555 22:43243328-43243350 GGAGAAGGAAGGCCAGGCGCAGG + Intronic
1184278902 22:43426197-43426219 GGCCCAGCAAGGAGAGCCCCGGG - Intronic
1185116345 22:48940417-48940439 GGCCCAGGAAGCACAGCCTGAGG + Intergenic
950195981 3:11009584-11009606 GGACCAGGAAGGAGACCAGCTGG + Intronic
950863858 3:16173708-16173730 GGACCATGCAGGACACCCCCTGG - Intergenic
954295184 3:49670520-49670542 GGGCCAGGAAGGACAGTCCATGG - Exonic
961463833 3:127069728-127069750 GGACCAGGAAGGAGAGAGGAAGG + Intergenic
962044317 3:131739437-131739459 GAAACAGGAAGCACAGCCACAGG - Intronic
967557625 3:190877116-190877138 GGAGAAGGAAGGAAAGACGCTGG + Intronic
972367292 4:38388118-38388140 GGAACAGGAAGGACTGTCTCAGG - Intergenic
975715265 4:77199468-77199490 AGAGCAGGAAAGACAGCCCCAGG + Intronic
975741572 4:77434425-77434447 GGATCCGGAAGGACAGCTGGAGG - Intergenic
978799974 4:112745910-112745932 AGACCAGGAAGGGCAGCCAGTGG - Intergenic
981081712 4:140643969-140643991 GGACCCGGAGGAAGAGCCGCTGG - Intronic
984616985 4:181909535-181909557 GGATCTGGAAGAACAGCAGCCGG - Intergenic
984617935 4:181919622-181919644 GGACTAGGAAGGGCACCCGAAGG - Intergenic
985828923 5:2213538-2213560 GGACCAGGAAGGGGAGGGGCCGG + Intergenic
986372905 5:7098574-7098596 GGCTCAGTAAGGACAGCTGCTGG + Intergenic
990955221 5:61333060-61333082 GGGCCAGTGAGGACACCCGCAGG - Intronic
991542352 5:67743759-67743781 GAACCAGGCAGCACAGCAGCAGG + Intergenic
995834018 5:116382684-116382706 GGACAAGGAAGGAGAGCCAGAGG + Intronic
998141025 5:139699589-139699611 GTGCCAGGAAGGACTGCCACAGG - Intergenic
1000003630 5:157163462-157163484 GGAGCAGCAAGGACAGCAGGTGG - Exonic
1000812153 5:165876736-165876758 GAACCAGGAAGGGCAGCCAGAGG + Intergenic
1001396102 5:171420419-171420441 GTACCTGGAAGCACAGCAGCAGG - Exonic
1001544661 5:172563561-172563583 GGAACAGAAAGGAGAGCCCCCGG + Intergenic
1001881593 5:175249472-175249494 GTATTAGGAAGGACAGCAGCAGG + Intergenic
1002334780 5:178470241-178470263 GGACCAGGAGGGACAGACGCTGG - Intronic
1002519445 5:179783117-179783139 GGACCAAGAAGGTCAGCAGGAGG + Intronic
1002780441 6:361075-361097 GAGCCAGCAAGGACAGCTGCGGG + Intergenic
1003525004 6:6890233-6890255 CGACAAGGAAGCACAGCCACAGG + Intergenic
1005093010 6:22078968-22078990 GGACCAGCAAGGAGACCCCCTGG + Intergenic
1005716915 6:28558098-28558120 GGCCCAAGAAGTACAGCAGCTGG + Intergenic
1006167525 6:32073779-32073801 GGACAAGGACGGGCAGCCCCAGG - Intronic
1006278092 6:33022155-33022177 GGATCAGGGAGGAGAGGCGCGGG + Intergenic
1007288972 6:40769950-40769972 GGACTAGGAAGCAGAGCAGCTGG - Intergenic
1007777661 6:44232805-44232827 AGCCTGGGAAGGACAGCCGCTGG + Exonic
1008030411 6:46688173-46688195 CGTCCACGAAGGACACCCGCAGG - Exonic
1008625455 6:53311211-53311233 CTACCAGGTAGGACAGCCACAGG - Intronic
1010047147 6:71458535-71458557 GGACCCAGAAGAACAGCAGCTGG - Intergenic
1011393450 6:86879753-86879775 GGAGCAGAAAGGACAACCACTGG + Intergenic
1013391016 6:109686555-109686577 GGCCCAGGAAGCAAAGCCTCTGG - Intronic
1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG + Intronic
1018883731 6:167913417-167913439 TGACCAGGTAGGACATCTGCTGG + Intronic
1018899657 6:168044648-168044670 GGTCCAGGAGGGTCAGCAGCCGG - Intronic
1021153451 7:17180034-17180056 AGACCAGGAAGGAAAGGCACAGG - Intergenic
1029537008 7:101162980-101163002 GGACCGGGAAGGGCAGTCACGGG + Exonic
1033597699 7:142868589-142868611 GGCCCAGGAAGGTCATCTGCAGG - Exonic
1034271096 7:149803738-149803760 GGACCAGGCTGACCAGCCGCAGG - Intergenic
1034457481 7:151178891-151178913 GGGCCAGGAAGGACAGAGACGGG - Intronic
1036954757 8:13175848-13175870 TGACCAGGAAGGAAAGCAGGAGG - Intronic
1039163942 8:34655088-34655110 CCACCAAGAAGGACAGCCACGGG + Intergenic
1040947096 8:52895052-52895074 GGAAAAGGATGGACAGCCACTGG - Intergenic
1042243251 8:66686027-66686049 GGACCAGGCTGGACAGACACTGG + Intronic
1044838398 8:96317169-96317191 GGACCTGGAAGGCCACCCGTAGG - Intronic
1046410378 8:113834114-113834136 TGACCAGGTAGGACAGCCTGAGG - Intergenic
1048495237 8:134929801-134929823 TCACAAGGAAGGACAGCCGGGGG - Intergenic
1049279333 8:141736443-141736465 GGACCGGGAAGGACCCCCGAGGG + Intergenic
1049356211 8:142189765-142189787 GCACCAGGCAGACCAGCCGCTGG + Intergenic
1049638094 8:143700159-143700181 CTACCAGGAAGGGCAGCCGAAGG - Intronic
1049681807 8:143922176-143922198 GGAGCAGGAACGGCAGCGGCTGG - Exonic
1049732566 8:144185938-144185960 GGACCAGCAAGGGCCGCCGAGGG + Intronic
1053174178 9:35910352-35910374 GGAGACGGAAGGAGAGCCGCCGG + Intergenic
1055266069 9:74497554-74497576 GGAGGAGGAAGGGCAGCAGCAGG - Exonic
1057472085 9:95367060-95367082 GGAGCAGCAGGGACAGCCCCTGG - Intergenic
1057476470 9:95407171-95407193 TGACCAGGGAGGACAGAGGCAGG + Intergenic
1060093539 9:120766178-120766200 GGACAAGGAAGAACAGCTGAAGG + Intronic
1060375605 9:123113286-123113308 GGACCAGGAGGGCCAGGCTCAGG - Intronic
1060978121 9:127777250-127777272 GGACTGGGAAGGACAGACACAGG + Intronic
1061733809 9:132638190-132638212 GGACAATCAAGGACAGCCACCGG + Intronic
1061848343 9:133400579-133400601 GGCCCAGGAGGCACAGCTGCAGG - Intronic
1062191375 9:135249569-135249591 GGCCCAGGAAGGAAGGCCGAGGG + Intergenic
1062285594 9:135771226-135771248 AGACCAGGCAGGACAGGGGCAGG + Intronic
1185760349 X:2685857-2685879 GGAACAGGAAGGAAAGCATCGGG - Intergenic
1186480243 X:9891069-9891091 GGACCAGGAAGGACAGCCGCTGG - Exonic
1187230203 X:17414668-17414690 GGACCTGGAAGGTGAGCCACTGG + Intronic
1189626704 X:42904830-42904852 GGATCAGGAAGAACAGCCAATGG - Intergenic
1191942897 X:66499444-66499466 GAACCAGGAGGGACAGAGGCTGG - Intergenic
1201282833 Y:12356138-12356160 GGATCAGGGAGGAAAGCAGCTGG + Intergenic
1201304372 Y:12537862-12537884 AGGCCAGGAAGGGCAGCAGCTGG - Intergenic