ID: 1186480397

View in Genome Browser
Species Human (GRCh38)
Location X:9892386-9892408
Sequence AGAGCCCAGTGTATTTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186480392_1186480397 6 Left 1186480392 X:9892357-9892379 CCCTAAAGTGACAAAAGATGATG 0: 1
1: 0
2: 4
3: 22
4: 189
Right 1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG 0: 1
1: 0
2: 2
3: 17
4: 257
1186480393_1186480397 5 Left 1186480393 X:9892358-9892380 CCTAAAGTGACAAAAGATGATGG 0: 2
1: 0
2: 0
3: 25
4: 221
Right 1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG 0: 1
1: 0
2: 2
3: 17
4: 257
1186480391_1186480397 7 Left 1186480391 X:9892356-9892378 CCCCTAAAGTGACAAAAGATGAT 0: 1
1: 0
2: 2
3: 17
4: 196
Right 1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG 0: 1
1: 0
2: 2
3: 17
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186480397 Original CRISPR AGAGCCCAGTGTATTTTTTG GGG Intronic
901174772 1:7290999-7291021 AGAGTGCAGTGTCTTTTGTGTGG + Intronic
902710348 1:18235076-18235098 AGACAACAGTGTATTTTTAGTGG - Intronic
903799721 1:25957656-25957678 AGAGCCCAATAGAATTTTTGAGG + Intergenic
904248603 1:29205979-29206001 AGAGCCAAGTGTTTTTATTTGGG - Intronic
907267793 1:53273217-53273239 AGAGGCCAGAGTAGTATTTGCGG + Intronic
909009627 1:70319839-70319861 AGAGACCAGTGAATATTCTGTGG - Intronic
909245706 1:73279673-73279695 TGAGGCCACTGTATTTTCTGTGG - Intergenic
909943190 1:81634306-81634328 AGATCACTGTGGATTTTTTGTGG - Intronic
910321496 1:85950105-85950127 AGAGCACAGCATTTTTTTTGTGG - Intronic
912599991 1:110920551-110920573 AGAGCACAGAGGATTTTTTATGG + Intergenic
913205651 1:116536027-116536049 AGAGTACACTGTATTTTTTGTGG + Exonic
916554074 1:165878107-165878129 AGAGCACAGGGGATTTTTTAGGG - Intronic
918783681 1:188734904-188734926 AGAGCCCATTGTGTGTTTTATGG + Intergenic
919730417 1:200910154-200910176 AGTGCACAGTGTCCTTTTTGTGG - Intronic
919983607 1:202657834-202657856 AGAGCTCAGGGTATGTTTGGTGG + Intronic
921271936 1:213477999-213478021 AGAGCGCAGAGGATTTTTTAGGG - Intergenic
921685260 1:218082490-218082512 AGAGCACAGGGAATCTTTTGGGG - Intergenic
921956616 1:220991581-220991603 AGTGACCTGTGTAATTTTTGAGG + Intergenic
922023342 1:221726741-221726763 AAAACCCAGTGTTTCTTTTGGGG - Intronic
922336176 1:224619779-224619801 AGCGCCCAATTCATTTTTTGGGG - Intronic
922805049 1:228381708-228381730 AGAGCCTTTTGTCTTTTTTGAGG + Intergenic
923487859 1:234453073-234453095 AGAGCACAGAGAATTTTTGGGGG + Intronic
924161888 1:241241392-241241414 TGAGCCCAATTTATTTTTTAAGG - Intronic
924294542 1:242572023-242572045 AGAACCCAGTGAATTTTTTTAGG - Intergenic
1063262404 10:4405024-4405046 AGAGCACAGAGTAGTCTTTGTGG + Intergenic
1063386093 10:5617113-5617135 AGAGCCAAGTGTAAATTGTGTGG + Intergenic
1067371382 10:45686520-45686542 AGACCTCAGTGTATTATCTGGGG + Intergenic
1067388402 10:45839629-45839651 AGACCTCAGTGTATTATCTGGGG - Intronic
1067417665 10:46117328-46117350 AGACCTCAGTGTATTATCTGGGG + Intergenic
1067445867 10:46344949-46344971 AGACCTCAGTGTATTATCTGGGG + Intergenic
1067486171 10:46652776-46652798 AGAGGCGAGTGGATTTCTTGAGG - Intergenic
1067503079 10:46824216-46824238 AGACCTCAGTGTATTATCTGGGG + Intergenic
1067591513 10:47515792-47515814 AGACCTCAGTGTATTATCTGGGG - Intronic
1067608584 10:47688879-47688901 AGAGGCGAGTGGATTTCTTGAGG + Intergenic
1067638628 10:48023868-48023890 AGACCTCAGTGTATTATCTGGGG - Intergenic
1067874853 10:49996434-49996456 AGACCTCAGTGTATTATCTGGGG + Intronic
1067941545 10:50660862-50660884 AGAGCCCAATGATTTTTTTAAGG - Intergenic
1068053727 10:51983664-51983686 AGAGCCCAGAGTGTTTGGTGTGG - Intronic
1068979094 10:63042522-63042544 AGGGCCACGTGTATGTTTTGGGG - Intergenic
1070135231 10:73688307-73688329 AGACCTCAGTGTATTATTTGGGG - Intronic
1070862782 10:79685822-79685844 AGAGCCCAATGATTTTTTTAAGG - Intergenic
1071624166 10:87150526-87150548 AGAGGCGAGTGGATTTCTTGAGG + Intronic
1073887689 10:108059325-108059347 AGAGCTCAATGTATTTTTTGAGG - Intergenic
1074733736 10:116405802-116405824 AGAGCTCAGCTTATTTTATGAGG + Intergenic
1075573142 10:123559494-123559516 AGAGGCCAGTGTCTTTGGTGGGG + Intergenic
1075882104 10:125861622-125861644 AGTGCCCAGGGTTTTTATTGAGG - Intronic
1079497170 11:21058667-21058689 AGTGCCAAGTGCATTTTCTGTGG + Intronic
1079773905 11:24498669-24498691 AGAGCCCATTTTAATATTTGTGG + Intronic
1080392544 11:31861485-31861507 TAAGCTCAGTGTGTTTTTTGGGG + Intronic
1083182813 11:60998769-60998791 AAAGCCCTGTGTATTTATTTGGG + Intronic
1084916363 11:72431982-72432004 TGAGTCCAGTGTATTTGGTGAGG - Intronic
1086266214 11:85001626-85001648 AGAGCACAGAGGATTTTTTAAGG + Intronic
1087230140 11:95652042-95652064 CCAGCCCAGTGTATTTTCTGAGG + Intergenic
1090153001 11:124404871-124404893 AAAGCCCATTGGAATTTTTGTGG + Intergenic
1090921748 11:131212656-131212678 AGAGCACAGAGGATTTTTAGTGG - Intergenic
1091029016 11:132167462-132167484 ACAGCACAGTGTATTGTTTCTGG - Intronic
1091898472 12:4123551-4123573 AGGTGCCTGTGTATTTTTTGTGG + Intergenic
1092084656 12:5745874-5745896 AGAGCCCAGTTTATGTCTTCTGG + Intronic
1093259906 12:16923080-16923102 AGAGCCCACAGTATGTTTGGGGG + Intergenic
1094544792 12:31394594-31394616 AGAGCACAGGGTAACTTTTGGGG - Intronic
1095655743 12:44667868-44667890 AGGGCCCAGGGTCTCTTTTGTGG - Intronic
1098703993 12:73664717-73664739 AGAGCCCAGCGTGTTTGGTGTGG + Intergenic
1099339367 12:81409181-81409203 AGAGCCTAGGGAATATTTTGAGG - Intronic
1100681683 12:96930533-96930555 AGTGCCCAGGGTTTTTATTGGGG + Intronic
1101071151 12:101077151-101077173 AGTGCCCAGGGTTTTTATTGGGG - Intronic
1101325246 12:103709853-103709875 AGAGCCTATTGTATTTATTCTGG - Intronic
1102928757 12:116846579-116846601 TGTGCCCAGTTTCTTTTTTGTGG + Intronic
1103624782 12:122209664-122209686 AGAGCTCATTTTTTTTTTTGGGG - Intronic
1104369028 12:128206138-128206160 AGTGCCCAGGGTGTTTATTGGGG + Intergenic
1106688191 13:32084753-32084775 AGACCATAGTGTATTTTTTATGG + Intronic
1107158924 13:37202533-37202555 AGAGTACAGTGTATTTTTTCTGG - Intergenic
1107389880 13:39952949-39952971 AGAGCCCAGTGTATGTTCTGTGG + Intergenic
1108526676 13:51291463-51291485 AGAGCCCAAGGTATGTTTGGTGG - Intergenic
1110090059 13:71433879-71433901 ACAGCACAATGTATTTTTAGGGG - Intergenic
1113541364 13:111112397-111112419 AGAGCCCAACGTATCTTTTGGGG - Intergenic
1114330043 14:21627534-21627556 AGAGGCCTGTGCATGTTTTGTGG + Intergenic
1115033115 14:28822339-28822361 AGAGTCCAGTTTCATTTTTGTGG - Intergenic
1115490291 14:33951811-33951833 AGAATACAGTGTATCTTTTGGGG - Intronic
1116834323 14:49754848-49754870 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1117473880 14:56074192-56074214 AGAGCCCAGTCTTTTTAATGTGG + Intergenic
1117885838 14:60362004-60362026 ATTGCCCCCTGTATTTTTTGAGG + Intergenic
1120370045 14:83621868-83621890 AGTGCTCAGTGTTTTTATTGGGG + Intergenic
1120613483 14:86673020-86673042 ATAGCCCAGTGTCTTTTCTTGGG - Intergenic
1120757491 14:88257743-88257765 AGAGCTCAGAGAATATTTTGTGG - Intronic
1120774433 14:88417827-88417849 AGTGCCCAGTTTATTTTATGAGG - Intronic
1120795936 14:88632820-88632842 AGAGTCCAGAGTTTTTATTGGGG - Intronic
1120875384 14:89370698-89370720 AGAGCCCAGTGTCATTCTTCTGG + Intronic
1121172933 14:91869496-91869518 TTAGCCCAGTGTTTTCTTTGAGG - Intronic
1122220653 14:100237771-100237793 AGAGCCTAGATTTTTTTTTGTGG - Intergenic
1125792336 15:42377047-42377069 AGTTCCCAGTGGATTTTTTTGGG + Intronic
1126338261 15:47610430-47610452 AGAGCCCAGAGTTTTTCTTGAGG - Intronic
1126422564 15:48490213-48490235 AGAGCCTGGGGTTTTTTTTGAGG - Intronic
1126485829 15:49179789-49179811 AATGCTCATTGTATTTTTTGGGG + Intronic
1128588308 15:68871477-68871499 AGAGCACAGAGAATTTTTAGGGG - Intronic
1129183384 15:73891147-73891169 ACAGCCCAGTGTTATTTTTAAGG - Intergenic
1132761373 16:1510109-1510131 CAGGCCCAGTGTATTTTTAGCGG - Exonic
1134012742 16:10867305-10867327 AGAGCCCACTGTGTGTGTTGGGG + Intergenic
1134098801 16:11437181-11437203 AGAACCCAGAGGATTTTTTAGGG + Intronic
1136581884 16:31157402-31157424 ACAGCCCAGATTATTTTTCGAGG - Intergenic
1138090662 16:54171291-54171313 AGAGCCCAGTGGTTTTATTTTGG + Intergenic
1138397724 16:56718706-56718728 AGAGCACAGGGAACTTTTTGAGG - Intronic
1139145896 16:64325189-64325211 AGAGGACAGTGTTTTCTTTGGGG + Intergenic
1144343762 17:14332194-14332216 AGAGCCCAGGCTGTTTTTGGGGG + Intronic
1144892361 17:18501308-18501330 TGACCCCAGTGTCTTCTTTGTGG + Intergenic
1145139853 17:20442980-20443002 TGACCCCAGTGTCTTCTTTGTGG - Intergenic
1146615572 17:34354843-34354865 TGAGCCCAGAGAATGTTTTGTGG + Intergenic
1148938686 17:51187490-51187512 AGAGTTCAGAGTATTTTTTTTGG - Intronic
1150461718 17:65359233-65359255 AGAGCCCAGTGAAATTATTTAGG - Intergenic
1153030209 18:706718-706740 AGAGCCCTTTGTTTTCTTTGGGG - Intronic
1153283449 18:3435632-3435654 TGACCTCAGTGTATCTTTTGAGG + Intronic
1157193795 18:45603422-45603444 AGAGTTCACTGTATTTATTGGGG + Intronic
1158099903 18:53819184-53819206 AGAGCCCAGAGTGTTTGGTGTGG + Intergenic
1160413703 18:78692385-78692407 AGAGCCATTTGTATTTTTTCAGG + Intergenic
1161331210 19:3688564-3688586 AGAGCCGCGTGTGTTTTTTGCGG + Intronic
1163363850 19:16865314-16865336 AGAGACCAGAGGATTTTTTTGGG - Intronic
1163492399 19:17624569-17624591 AGAGTCCATTGTATTTTCTCTGG - Intronic
1164981359 19:32616850-32616872 AGAGCCCAGTGGTGTTTGTGAGG - Intronic
1165551664 19:36591866-36591888 AGAGGACAGTTCATTTTTTGAGG + Intronic
1167163590 19:47783038-47783060 GGAGCATAGTTTATTTTTTGAGG + Intronic
1167876168 19:52414429-52414451 AGAGCCCTTTGTATTTTATTGGG + Intronic
1168373816 19:55858870-55858892 AGAGCACATTGGATTTTTTTGGG + Exonic
926690916 2:15732776-15732798 CGAGCCCAGTGTATCTCTTGAGG + Intronic
926973326 2:18488291-18488313 AGAGGCTAGTGTTTATTTTGTGG + Intergenic
929132088 2:38586445-38586467 ACAACCCAGTTTATTCTTTGGGG + Intronic
929862379 2:45690771-45690793 AGAGACCAATGTACTTTTTTAGG + Intronic
929868686 2:45739718-45739740 GGGGCCCAGGGAATTTTTTGAGG + Intronic
930319654 2:49838253-49838275 AGAGCTGAGTCTATTATTTGAGG + Intergenic
930484037 2:51989510-51989532 ACAACCCAGTGTGATTTTTGTGG + Intergenic
933566359 2:83955160-83955182 AGATCACAGTGTAGTTGTTGTGG + Intergenic
933599925 2:84318719-84318741 AGCTCCCAGTGTGTGTTTTGAGG - Intergenic
933699596 2:85245048-85245070 AGTGCCAAGTCTATATTTTGAGG - Intronic
933888173 2:86739721-86739743 AGTGCCCAGGGTTTTTATTGGGG - Intronic
933922005 2:87056985-87057007 AGTGCCCAGGGTTTTTATTGGGG + Intergenic
934991154 2:98922500-98922522 AGAGCCCATTGTAGTTTGAGAGG - Intronic
936245468 2:110822784-110822806 AAAGCACAGGGTATTATTTGGGG - Intronic
936542058 2:113360732-113360754 AGAGCACAGTGTATTAAATGTGG + Intergenic
938126567 2:128677799-128677821 AGAGCCAATTGATTTTTTTGGGG + Intergenic
938511828 2:131956215-131956237 AGCACCAAGTGTATTTTATGGGG - Intergenic
938573342 2:132582572-132582594 AGAGCCCAGGGGATTCTTAGCGG + Intronic
938654216 2:133414147-133414169 AGAACTCACTGTATTTTATGTGG - Intronic
939024305 2:136993969-136993991 TGAGCTAAGTGTATTTTCTGAGG + Intronic
939099764 2:137881900-137881922 AGAGACCAGTGCATGATTTGAGG - Intergenic
942250791 2:174046203-174046225 GGTGCCCAGTGTATGTGTTGGGG + Intergenic
945403424 2:209417364-209417386 GGAGTACAGTGTATTTTTTAAGG + Intergenic
945833661 2:214813354-214813376 AGGGCACAGTTTTTTTTTTGCGG + Intergenic
947243325 2:228019531-228019553 AGAAACCACTGTATCTTTTGTGG + Exonic
947762113 2:232610575-232610597 CCAGCCCAGTATATTTTTTCGGG - Intronic
947786579 2:232827402-232827424 AGAGCCTAGTGTTTTCTTTGTGG + Intronic
948134817 2:235628535-235628557 AGAGCCCAGGGTATCTTTGGGGG + Intronic
1169353771 20:4891207-4891229 AGAGCCCAGGGAAATGTTTGGGG + Intronic
1169811686 20:9615195-9615217 AGAGCACAGAGGATTTTTTAGGG + Intronic
1170057756 20:12225678-12225700 AGAGCCCAGTGAGTTTGCTGTGG + Intergenic
1170787586 20:19480947-19480969 AGAACCCAAAGTATTTTTAGAGG - Intronic
1172391900 20:34571132-34571154 TGAGACCAGTGGATTTCTTGAGG - Intronic
1172496212 20:35386927-35386949 AGGGTCGAGTGAATTTTTTGCGG - Intronic
1174161284 20:48552467-48552489 TGAGCCCAGTGAAGTGTTTGAGG - Intergenic
1174698512 20:52584400-52584422 TCAGCCCACTGTATTTTTTATGG - Intergenic
1175353540 20:58344076-58344098 AGAGCACTGTGTATAATTTGGGG + Intronic
1176091942 20:63322102-63322124 AGGGCCCAGGGTAAGTTTTGGGG + Exonic
1182890997 22:33818788-33818810 GGAGCCCAGTGGCTTTTTCGAGG + Intronic
949982981 3:9514631-9514653 AGAGCACAGAGGATTTTTTAGGG - Intronic
958605736 3:96356093-96356115 AGAGCCCAGAGAATTTGGTGTGG + Intergenic
959021602 3:101193264-101193286 AAAGCCAAGTGAAGTTTTTGTGG + Intergenic
962464977 3:135649499-135649521 AGAGCCCAGAGTGTTTGGTGTGG - Intergenic
962829543 3:139128069-139128091 AGAGGCCAGTTTATCATTTGGGG - Intronic
964214223 3:154261356-154261378 AGAGCACAGAGGATTTTTTAGGG + Intergenic
964334308 3:155638977-155638999 AAAGTCCAGTTTACTTTTTGGGG - Intronic
964370503 3:155995053-155995075 ATCACTCAGTGTATTTTTTGAGG + Intergenic
965000065 3:162941865-162941887 AGAACCTGGTGTATTCTTTGAGG - Intergenic
966023918 3:175251708-175251730 AAAGCACATTGAATTTTTTGAGG - Intronic
966771253 3:183505904-183505926 AGAGCCTGGTGTTTTCTTTGTGG - Intronic
968174956 3:196541414-196541436 TGAGCCCAGAGGATTGTTTGAGG + Intergenic
970396302 4:15670643-15670665 ATTGCCCAGTGTTTCTTTTGTGG - Intronic
970547477 4:17144523-17144545 AATTCCCTGTGTATTTTTTGAGG - Intergenic
972270185 4:37503059-37503081 AGAGCCCAGAGTGTTTGGTGTGG - Intronic
973628545 4:52796832-52796854 AGAGACCAGTATATATTCTGTGG + Intergenic
976843864 4:89464230-89464252 AAAGTCCAATTTATTTTTTGTGG - Intergenic
977482163 4:97592904-97592926 AGAGCCCAGAGTGTTTGTGGTGG + Intronic
978054115 4:104241695-104241717 AGTGTCAAGTGTATATTTTGAGG - Intergenic
978596113 4:110379252-110379274 AGAGCCCAGAGGATTTGGTGCGG + Intronic
978948562 4:114528444-114528466 TGATGCCAGTATATTTTTTGGGG - Intergenic
982016849 4:151163045-151163067 AGTGCCCAGGGTTTTTATTGGGG - Intronic
982331805 4:154189179-154189201 AGATTCCAGTGTATTATTTGGGG - Intergenic
982536623 4:156615151-156615173 AGAGCACTCTGTCTTTTTTGTGG - Intergenic
982712792 4:158774707-158774729 AGAGCCCAGTGTAGTCTTCCTGG + Intronic
985640999 5:1063495-1063517 AGAGCCCCGTGTGTTGCTTGTGG - Intronic
987829141 5:23073762-23073784 AGGGCCCAGGGTTTTTATTGGGG - Intergenic
988337518 5:29925756-29925778 AGAGTACTGTGGATTTTTTGAGG + Intergenic
991964942 5:72081597-72081619 AGAGCACAGTGCTTTTTCTGGGG + Intergenic
992315963 5:75555274-75555296 GGAGCACAGAGTATTTTTTTAGG - Intronic
992324764 5:75649975-75649997 AGTGCTCAATATATTTTTTGTGG + Intronic
993177027 5:84499829-84499851 AGATCCCAGTGTATTGGTTTTGG - Intergenic
998276028 5:140753976-140753998 AGAGCCCAGAGGGTTTGTTGTGG - Intergenic
998636881 5:143965326-143965348 AGTGCTCACTATATTTTTTGTGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1002067700 5:176660370-176660392 AGAGCCCAGTATCTTGTTGGAGG + Intergenic
1003815476 6:9835664-9835686 ATAGCCCAGTGTATTTCTTTGGG + Intronic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1004792685 6:19044871-19044893 AGAGCACACAGTATTTTTAGGGG - Intergenic
1005360421 6:25026323-25026345 AGAGCCAAGTTCATTATTTGAGG + Intronic
1005718222 6:28573601-28573623 AAACCACAGTGTATTATTTGTGG - Exonic
1006047579 6:31309979-31310001 TAAGCCCAGTGTAATTTATGAGG + Intronic
1006704871 6:36011147-36011169 AAAACCCATTCTATTTTTTGAGG + Intronic
1007452772 6:41952769-41952791 TGAGCACAGTGTATTTATTTGGG - Intronic
1010655139 6:78503110-78503132 AGAGCCCAGAGTGTTTGGTGTGG - Intergenic
1011265149 6:85509789-85509811 AGAGCAGAGAGGATTTTTTGGGG - Intronic
1011575744 6:88796654-88796676 AGAGAAAAGTGTATTTTTTATGG - Intronic
1013276050 6:108585797-108585819 TGAGCCCAGTGTGTTTTAAGTGG - Intronic
1013980561 6:116122463-116122485 AGAGCTCAGAGTATATTCTGAGG - Intronic
1015137853 6:129894065-129894087 AGTGCCAAATGTACTTTTTGAGG + Intergenic
1016216686 6:141612718-141612740 AGTGCCCAGTGTATGTTCTGAGG + Intergenic
1017151090 6:151281465-151281487 AGTGCCCACTTTATCTTTTGAGG + Intronic
1018287284 6:162254504-162254526 AGTTCCCAGTGTGTTGTTTGAGG + Intronic
1018374171 6:163195502-163195524 AGAGCCCAGTGTTTTCAATGTGG + Intronic
1022789897 7:33676727-33676749 GGAATCCAGTGTACTTTTTGGGG + Intergenic
1022827737 7:34033667-34033689 AGAGCCCTGGGCATTTTCTGAGG + Intronic
1023087874 7:36590361-36590383 AAATCCCAGTATATTTTTTAAGG + Intronic
1023608381 7:41950207-41950229 AGAGCACAGTATATTCTCTGAGG - Intergenic
1024169203 7:46766714-46766736 AGAACTCAGTATGTTTTTTGTGG + Intergenic
1024878605 7:54057279-54057301 AGAGCTCAGAGTGTTTATTGTGG - Intergenic
1027133636 7:75609264-75609286 AGAGCCCACTCTATGGTTTGGGG + Intronic
1027216766 7:76188795-76188817 GGAGGCCAGGGTGTTTTTTGAGG + Intergenic
1028021296 7:85777413-85777435 AGAGCCCAGTAAATCATTTGTGG + Intergenic
1028599005 7:92580439-92580461 AGTGCCCAGGGTTTTTATTGAGG - Intronic
1028722523 7:94050078-94050100 AGGACCAAGTATATTTTTTGAGG + Intergenic
1034551473 7:151823371-151823393 AGACTCCAATGTCTTTTTTGCGG - Intronic
1034724582 7:153323433-153323455 AATGCCCAGGGTATTATTTGAGG - Intergenic
1036488531 8:9201997-9202019 GGAGCCCTGTGTCTTTTTTTTGG + Intergenic
1036728230 8:11239395-11239417 AGGCCCCAGTGTACTTTTTTTGG + Intergenic
1037072994 8:14675580-14675602 GGAGCTCAGTGTATATTTTTTGG - Intronic
1037079816 8:14770413-14770435 AGAGGTCAGTATATTATTTGGGG + Intronic
1037703125 8:21293242-21293264 AGAGCCCAGTGGAATTTCTGGGG + Intergenic
1038112781 8:24517904-24517926 AGAGCCCAGTGGATTCCCTGAGG - Intronic
1038963395 8:32547535-32547557 AGAGGCCAGGTTATTTTTTAAGG + Intronic
1039398960 8:37252397-37252419 AGAGCCAAGTGTATGCTTCGTGG + Intergenic
1039593009 8:38766396-38766418 AGAGTCCTGTCTATTTTTGGAGG + Intronic
1039805818 8:40997110-40997132 AGAAGCCAGTGTATTTTGAGAGG + Intergenic
1040895709 8:52366292-52366314 AGAGAGCAGTGTTTTTTGTGAGG - Intronic
1040917452 8:52577782-52577804 AGAGCTCAGTAAATATTTTGGGG + Intergenic
1041795718 8:61745646-61745668 AGGGCCATGTGTATGTTTTGGGG + Intergenic
1042458376 8:69032208-69032230 AGAGCAAGGTGGATTTTTTGAGG + Intergenic
1042668429 8:71233083-71233105 AAAGCCCAGTGTTGTTTATGTGG - Intronic
1043320307 8:78976281-78976303 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1049985077 9:942858-942880 ACACCCCAGTGTTTTTTGTGAGG - Intronic
1050477243 9:6052936-6052958 TTTGCCCAGTGTTTTTTTTGTGG - Intergenic
1051284061 9:15476836-15476858 AGGGCCCAGTGTACCTTTTTAGG - Intronic
1051841755 9:21405758-21405780 AGAGTCCAGTGTATTATAGGAGG - Intergenic
1052136411 9:24917121-24917143 AGAGCATAGTGAATTTATTGAGG - Intergenic
1053172644 9:35901034-35901056 AGAGCACAGGGAATTTTTTAGGG - Intergenic
1053187516 9:36030515-36030537 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1056057367 9:82840854-82840876 AGCTCCCAGTGAATTTTGTGGGG + Intergenic
1056996258 9:91462807-91462829 AAGGCCCAATGTTTTTTTTGGGG + Intergenic
1058638364 9:107058562-107058584 TGAGCCCACTGTATCTTTTACGG - Intergenic
1059106333 9:111514968-111514990 AGTGCCCAGTGTGTTTCATGGGG + Intergenic
1059461856 9:114436237-114436259 AGAGCACAGAGGATTTTTAGAGG + Intronic
1061204840 9:129156838-129156860 AGGGCCCAGTTTCTTTTTGGAGG + Intergenic
1061306355 9:129735420-129735442 GGAGCCCATTGAATTTTTTAAGG - Intergenic
1061378753 9:130241726-130241748 AGTGCCCACTTTATTCTTTGAGG + Intergenic
1061965484 9:134011653-134011675 GGAGCCCAGGGGATTTTCTGAGG + Intergenic
1062054528 9:134463966-134463988 AGGGCCTTGTGTATTTTCTGTGG - Intergenic
1062716490 9:138013014-138013036 GCAGCACTGTGTATTTTTTGAGG + Intronic
1186454213 X:9698560-9698582 AGTGCCCAGAGTTTTTATTGGGG + Intronic
1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG + Intronic
1187458614 X:19465511-19465533 AGAGGCGAGTGGATTATTTGAGG + Intronic
1188100718 X:26080550-26080572 CTAGACCAGTGTATTTTATGAGG - Intergenic
1189682725 X:43533855-43533877 AATGCCCAATGTATTTATTGAGG - Intergenic
1190215636 X:48477921-48477943 TGAGCCCAGTTTAGTTTGTGTGG + Intronic
1190857279 X:54308727-54308749 ACATCCTAATGTATTTTTTGTGG - Intronic
1191722866 X:64249081-64249103 AGAGCCCAGAGGATTTGGTGTGG - Intergenic
1193366328 X:80638096-80638118 AGAGTGAAGTGGATTTTTTGAGG - Intergenic
1194119312 X:89940474-89940496 ACACCCCAGTGCACTTTTTGGGG + Intergenic
1195094417 X:101491168-101491190 AGAGCCCACTGTATCTTCTCTGG - Exonic
1195094441 X:101491288-101491310 AGAGCCCATTGTATCTTCTCTGG - Exonic
1197192067 X:123658716-123658738 AGAGCACAGAGGATTTTTTAGGG + Intronic
1197478731 X:126955958-126955980 GGAGCCCAATGTATTGTTTGTGG - Intergenic
1199582105 X:149370648-149370670 AGAGCCCAGTCATCTTTTTGTGG + Intergenic
1200472183 Y:3598031-3598053 ACACCCCAGTGCAGTTTTTGGGG + Intergenic