ID: 1186483987

View in Genome Browser
Species Human (GRCh38)
Location X:9918876-9918898
Sequence AATCCTAACCCCAATGGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186483987_1186483996 9 Left 1186483987 X:9918876-9918898 CCTATCCCATTGGGGTTAGGATT 0: 1
1: 0
2: 1
3: 19
4: 138
Right 1186483996 X:9918908-9918930 GGATTTGGGAGGCAGGGCACAGG 0: 1
1: 0
2: 3
3: 33
4: 439
1186483987_1186483993 -2 Left 1186483987 X:9918876-9918898 CCTATCCCATTGGGGTTAGGATT 0: 1
1: 0
2: 1
3: 19
4: 138
Right 1186483993 X:9918897-9918919 TTTCAACTTATGGATTTGGGAGG 0: 1
1: 5
2: 156
3: 919
4: 2695
1186483987_1186483994 2 Left 1186483987 X:9918876-9918898 CCTATCCCATTGGGGTTAGGATT 0: 1
1: 0
2: 1
3: 19
4: 138
Right 1186483994 X:9918901-9918923 AACTTATGGATTTGGGAGGCAGG 0: 1
1: 0
2: 2
3: 24
4: 276
1186483987_1186483992 -5 Left 1186483987 X:9918876-9918898 CCTATCCCATTGGGGTTAGGATT 0: 1
1: 0
2: 1
3: 19
4: 138
Right 1186483992 X:9918894-9918916 GGATTTCAACTTATGGATTTGGG 0: 1
1: 27
2: 368
3: 1305
4: 3193
1186483987_1186483995 3 Left 1186483987 X:9918876-9918898 CCTATCCCATTGGGGTTAGGATT 0: 1
1: 0
2: 1
3: 19
4: 138
Right 1186483995 X:9918902-9918924 ACTTATGGATTTGGGAGGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 240
1186483987_1186483991 -6 Left 1186483987 X:9918876-9918898 CCTATCCCATTGGGGTTAGGATT 0: 1
1: 0
2: 1
3: 19
4: 138
Right 1186483991 X:9918893-9918915 AGGATTTCAACTTATGGATTTGG 0: 1
1: 17
2: 181
3: 635
4: 1586

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186483987 Original CRISPR AATCCTAACCCCAATGGGAT AGG (reversed) Intronic
900790273 1:4675384-4675406 TATCCTGACCTCAATGGGAGAGG - Intronic
901038100 1:6348468-6348490 AATCCTAACCCCCAAGGGAATGG + Intronic
901197603 1:7448812-7448834 AATCCTGACCCCGAGGAGATGGG - Intronic
901908879 1:12438203-12438225 AATTCTAACCCCAAAGGTGTTGG + Intronic
902394952 1:16127546-16127568 AATCCTGATCCCATTGGGAAAGG + Intronic
903588438 1:24436109-24436131 AGTCCTAACCCCTAAGGGAATGG - Intronic
907201354 1:52729276-52729298 AATCCTAACCCCCAAGGTAATGG - Intronic
907692892 1:56688207-56688229 ACCCCTAACCACAATGGGGTAGG - Intronic
909187249 1:72503347-72503369 AATCCTAACCTCAAGGAGATGGG - Intergenic
909832395 1:80209169-80209191 AATCCTAACCCCAAAGGTGATGG + Intergenic
910041365 1:82855731-82855753 AATCCTTACCCTCATGGGAATGG + Intergenic
910117239 1:83745377-83745399 AAGCCTAACATCAATGAGATGGG + Intergenic
916441396 1:164828655-164828677 AATCACAACCTCAAAGGGATAGG + Intronic
916462405 1:165040198-165040220 AATCCCAACCTCCAAGGGATGGG + Intergenic
920933753 1:210412191-210412213 AATCCTAACCCCCAAGGTAATGG - Intronic
921779644 1:219147197-219147219 AATCCTAACCCCCATTGTAATGG - Intergenic
923824847 1:237488903-237488925 AATCCTAACCCCCAAGGCAATGG - Intronic
923887115 1:238170063-238170085 AATCCTAACCCCTATGGTGTTGG - Intergenic
1063636299 10:7786488-7786510 AACCCTAACCCCCAAGGGAATGG + Intronic
1069656341 10:70092038-70092060 AAACCTAACCCCAGAGGCATAGG + Intronic
1069969672 10:72155826-72155848 TCTCCAAACCCCAAGGGGATAGG + Intronic
1072285468 10:93910367-93910389 AATCCTACCCCCAATGGCCTAGG + Intronic
1073529891 10:104221355-104221377 AATCCTAACCCCAATGGTGATGG + Intronic
1074897209 10:117787538-117787560 AATCCTAACCCCCAAGGGGATGG - Intergenic
1078277773 11:9867006-9867028 AATCAAAACCACAATGAGATGGG + Intronic
1081545989 11:44072110-44072132 AATCTCAACCCCAAGGGGAAGGG + Intronic
1085721467 11:78915752-78915774 AATTCTAACCCCAATTCCATGGG + Intronic
1086388547 11:86336367-86336389 AATCCTAACCCCCAAGGTATTGG + Intronic
1086410580 11:86540548-86540570 AATCCAAATCCCTATGGGCTTGG + Intronic
1088979600 11:114850199-114850221 AAGCCCAACCCCATTGGGTTGGG + Intergenic
1090668708 11:128931220-128931242 AACCCTAACCCCAATGTGATGGG + Intergenic
1097107563 12:56634586-56634608 CTTCCTAACCCCAATGGGAGGGG - Intronic
1100677377 12:96882005-96882027 AATCCTAACCCCCAAGGCAATGG - Intergenic
1104979259 12:132566321-132566343 AATCCTCACCCCCAGGTGATGGG - Intronic
1109182405 13:59229600-59229622 AATCCTAACACTAAAGGGCTTGG - Intergenic
1110455801 13:75689301-75689323 AATTCAACCCACAATGGGATTGG - Intronic
1110486303 13:76048387-76048409 AATCCTAACCCCCAAGAGAATGG - Intergenic
1111151342 13:84257110-84257132 ATTCCTAACCCCAAAGTCATAGG - Intergenic
1111806829 13:93048980-93049002 AATGCAAACGACAATGGGATAGG + Intergenic
1111807204 13:93052583-93052605 AATGCAAACGACAATGGGATAGG + Intergenic
1117180419 14:53185621-53185643 AATCCTAACCCCTACGGTAATGG - Intergenic
1121382848 14:93489668-93489690 AACTCTTACCCCAATGGGTTTGG - Intronic
1121708947 14:96022581-96022603 CATCCTTACACCAATAGGATGGG - Intergenic
1123767814 15:23499319-23499341 AATCCTAACCCCAAATGGGATGG + Intergenic
1128496957 15:68204214-68204236 AACCCTAACCCCACTTGGCTGGG + Intronic
1130204744 15:81865620-81865642 AATTCTAGCCCCAATGGGCCGGG + Intergenic
1131533183 15:93212137-93212159 AATCCTAACCCCCAAGGTAATGG + Intergenic
1132086712 15:98914230-98914252 AATCCTAACCCCTAAGGGGATGG - Intronic
1133541765 16:6762748-6762770 GAGCCTTACCCCAAGGGGATAGG + Intronic
1135108299 16:19670228-19670250 GACCCTAATCCCAATGTGATGGG - Intronic
1135909850 16:26549874-26549896 AATTCTCACAACAATGGGATGGG + Intergenic
1136051627 16:27654754-27654776 CATCCTAACCCCTAAGGGCTGGG + Intronic
1137473301 16:48782364-48782386 AATCCTAACCCCCAAGGTAATGG - Intergenic
1137875906 16:51996622-51996644 AATCCTTAACCCAAAGGAATGGG + Intergenic
1139530996 16:67542710-67542732 AGTCCTACCCCCAGTGGTATGGG + Exonic
1146080890 17:29779587-29779609 AATCCTGACCCCAAAGTGCTGGG - Intronic
1147944695 17:44074289-44074311 AACCCTAACCACATTGGGAAAGG - Intronic
1149951591 17:60993842-60993864 AATCCTAACCTAAACTGGATTGG - Intronic
1151153505 17:72108192-72108214 AAGACTAACCCCAATTGAATTGG + Intergenic
1153470302 18:5437161-5437183 AATCCTACCCTCAAGGTGATGGG + Intronic
1155553100 18:26987684-26987706 AAACCTAACCCCAAAGGTAATGG + Intronic
1155564079 18:27113511-27113533 AATCCTAACCCCAAGGCCTTGGG + Intronic
1157989929 18:52482678-52482700 AATTCTACCCCAAATGTGATGGG - Intronic
1158714030 18:59862251-59862273 AAACCTAACCCCAAGGGCTTAGG + Intergenic
1159680895 18:71350896-71350918 AATCCTAACCCCCAAGGTAATGG + Intergenic
1164922229 19:32096991-32097013 CAGCCCAACCCCAAAGGGATGGG + Intergenic
925407094 2:3612969-3612991 AACCCTAACACCAATGAGAAGGG - Intronic
926351818 2:12002613-12002635 AATCCTAACCCCCAAGGTAATGG + Intergenic
928285230 2:29984591-29984613 ATTACTAAACCCAGTGGGATAGG - Intergenic
931446491 2:62331363-62331385 AATCCTAACCCCCAAGGTAATGG - Intergenic
931627620 2:64271147-64271169 AATCCTAACCCCCAAGGCAATGG + Intergenic
933242818 2:79942097-79942119 AATCATCACCCCAACAGGATGGG + Intronic
935090836 2:99893410-99893432 AGCCCTAACCCCAGTGTGATGGG + Intronic
937565205 2:123277245-123277267 AGACCTTACCCCAAAGGGATTGG + Intergenic
939269253 2:139916595-139916617 AATCCTAACCCCTATGGGTGAGG + Intergenic
939832142 2:147085631-147085653 AACCCAAACCCAAATGGGGTTGG - Intergenic
943039429 2:182786829-182786851 AATCCTAACCCCCAAGGTAATGG + Exonic
945200085 2:207272475-207272497 AATCCAAACCACAGTGGTATGGG - Intergenic
945427405 2:209723581-209723603 AATCCTAACCTAAAAGGAATTGG - Intronic
945709030 2:213273232-213273254 CATCCTAACCCCAAAGGAACAGG + Intergenic
946402384 2:219475417-219475439 AATCCTGTCCCCCATGGGCTGGG - Intronic
949066083 2:241991053-241991075 AGCCCTAACCCCAACGTGATGGG - Intergenic
1168754791 20:308879-308901 AATCCTCGCCCCAAGGGGAGGGG - Intergenic
1168784069 20:522248-522270 ATTCCTAAGTCCAATGGGCTTGG + Intronic
1174400517 20:50273489-50273511 AATCACATCTCCAATGGGATGGG + Intergenic
1174902727 20:54517701-54517723 AATCCTAACCCCCAAGGATTTGG + Intronic
1175106373 20:56617919-56617941 AATCCTCAACCCTATGAGATAGG + Intergenic
1175465505 20:59188369-59188391 AATCAAAACCACAATGAGATAGG - Intergenic
1177338416 21:19763666-19763688 AATCCTAACCCTAAGGAGATGGG + Intergenic
1177636264 21:23790599-23790621 AATCCTAACCCCAAAGGTGATGG + Intergenic
1178769555 21:35490243-35490265 AGCCCTAACCCCCATGTGATGGG + Intronic
1178905773 21:36634680-36634702 AATCCTAACCCCAAAGGTGATGG - Intergenic
1179073580 21:38096237-38096259 AATCTTAACACCAATGTGATGGG + Intronic
1182108968 22:27709370-27709392 AAACCTAACCCCCAAGGTATTGG - Intergenic
1183435838 22:37794527-37794549 ACTTCTAACCCACATGGGATGGG + Intergenic
950169278 3:10826345-10826367 AAACCTCAACCCAATGGGACTGG - Intronic
950556147 3:13697251-13697273 AAACCTAGACCCAATGGGAACGG + Intergenic
952406775 3:33012327-33012349 AATTCTAGCCCCCATGTGATGGG + Intronic
952929761 3:38349985-38350007 AATCCTAACCCCGAGGGCCTTGG - Intronic
954096876 3:48335522-48335544 GCTCCTAACCCCAAAGGGTTGGG + Intergenic
955045194 3:55353014-55353036 ATTCCTTGCCTCAATGGGATTGG - Intergenic
955391758 3:58527086-58527108 AATCCTAACCCTCAAGGGTTAGG + Intronic
955491238 3:59485258-59485280 AATCCTAACCCCAAGGTATTAGG + Intergenic
958661110 3:97068687-97068709 AACCCTAACCCCAGTGTGATAGG + Intronic
962009182 3:131377599-131377621 AATCCTAACTCCAATTGTGTTGG + Intergenic
963627629 3:147692994-147693016 AACCCAATCCCCAATGTGATGGG - Intergenic
965881879 3:173396845-173396867 CACCCCCACCCCAATGGGATTGG - Intronic
967455039 3:189675254-189675276 AATCCTAACCCCTAAGGCAATGG - Intronic
968290460 3:197535138-197535160 AATCCTAACCCCCAAGGTATTGG - Intronic
969361576 4:6667463-6667485 AATCCTACCCGCAATGTGATGGG + Intergenic
972027986 4:34411449-34411471 AACCCTAACCCAGATGAGATTGG - Intergenic
973289836 4:48460032-48460054 AATCCTATCCCCAAGATGATGGG - Intergenic
975181209 4:71347585-71347607 AATCCTATCCCCCAAGGGAATGG - Intronic
976179253 4:82383553-82383575 AATCCTAACCCCTAAGGTAACGG - Intergenic
976407745 4:84678938-84678960 ATTCCGCACCTCAATGGGATTGG + Exonic
977050191 4:92119736-92119758 AATCCAAAACCCAATGGGGTAGG - Intergenic
979714619 4:123822708-123822730 AATCCTAACCCCAAAGGCAGTGG - Intergenic
980497173 4:133601079-133601101 AATTCAACCCCCAATGGGTTTGG - Intergenic
992047488 5:72908805-72908827 AATCCCAACCCTACTGGGAGGGG + Exonic
996131918 5:119791919-119791941 ATTGTTAACCACAATGGGATTGG + Intergenic
1000958659 5:167572658-167572680 AATCCTAGCCCCCATGTGGTAGG + Intronic
1002980444 6:2130826-2130848 AATACTTTCCCCAATGTGATAGG + Intronic
1003889852 6:10554455-10554477 AATCCAAACCCCCATGTTATTGG + Intronic
1007630989 6:43273523-43273545 AAGCCTGACCTCAGTGGGATTGG + Intronic
1008434253 6:51456608-51456630 AATCATAATACCAATGGGTTAGG + Intergenic
1018028579 6:159824198-159824220 AATCCTAACCCCTAAGGGGATGG - Intergenic
1020687487 7:11313652-11313674 ATTCCCATCCCCAGTGGGATGGG + Intergenic
1027550210 7:79583563-79583585 AATCAAAACCACAATGAGATGGG - Intergenic
1028096231 7:86764448-86764470 ACTCTTAACCTCAATGGGCTAGG + Intronic
1028882396 7:95894421-95894443 AATCCTAACCCCCAAGGTAAGGG - Intronic
1029425956 7:100494062-100494084 CATCCTAAGCCCAATGGGCCTGG - Exonic
1029896796 7:103991129-103991151 AATCCTAACACCAACTGGAGAGG + Intergenic
1030618935 7:111768893-111768915 AATCCTAACCCCCAGGGTAATGG + Intronic
1030865976 7:114702320-114702342 AATTCTAACCCCCAAGGGAATGG + Intergenic
1035086902 7:156267743-156267765 TTTCCTATCCCTAATGGGATAGG - Intergenic
1035152574 7:156886930-156886952 ATTCCCAACCAGAATGGGATGGG - Intronic
1037163220 8:15797002-15797024 AGTCCTGACCCCAATGGGAACGG - Intergenic
1038320429 8:26520998-26521020 AATCCTAACCCCTAGTGGAATGG - Intronic
1039498209 8:37997227-37997249 AGCCCTAACCCCAATGTAATGGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1040493552 8:47946824-47946846 ACTCCTAAGCTGAATGGGATGGG - Intronic
1043604664 8:81985786-81985808 AATCAAAACCACAATGAGATAGG - Intergenic
1045022993 8:98060784-98060806 AGTCCTAACCCCAATGTGACTGG + Intergenic
1045441354 8:102215505-102215527 AATCAAAATCCCAATGGAATTGG + Intronic
1046575647 8:116025560-116025582 AATCCTTACCCCAATGATGTGGG + Intergenic
1047500800 8:125439653-125439675 AAGCGTAACCACCATGGGATGGG + Intergenic
1047847224 8:128819598-128819620 AATCAGAACCCCAATGGGAAAGG - Intergenic
1051000843 9:12279942-12279964 AAACCTAACACCAATGGCAGAGG - Intergenic
1053378660 9:37630130-37630152 AATCTAAACTCCAATGTGATGGG - Intronic
1186449556 X:9660881-9660903 AATCCTAACCCCCAAGGGGATGG + Intronic
1186483987 X:9918876-9918898 AATCCTAACCCCAATGGGATAGG - Intronic
1187637777 X:21251216-21251238 AATCCAAACATCAATTGGATTGG + Intergenic
1187795104 X:22994870-22994892 AATCCTAACCCCAAAGGTGATGG - Intergenic
1191075878 X:56452698-56452720 AATCAAAACCACAATGAGATAGG + Intergenic
1193016689 X:76741521-76741543 AATACAAACTCCACTGGGATGGG + Intergenic
1196701093 X:118669626-118669648 AATCCTAACCCCCAAGGGGATGG - Intronic
1198219089 X:134583582-134583604 AATAGCAACCTCAATGGGATTGG + Intronic
1199652508 X:149960435-149960457 AATCCTAACCCAAATGGACTGGG - Intergenic
1202151189 Y:21845119-21845141 TATCCCAATCCCCATGGGATTGG - Intergenic