ID: 1186487630

View in Genome Browser
Species Human (GRCh38)
Location X:9945955-9945977
Sequence CCTCACCTGGAGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 9, 3: 81, 4: 513}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186487630_1186487639 8 Left 1186487630 X:9945955-9945977 CCTTCCCCTTTCTCCAGGTGAGG 0: 1
1: 0
2: 9
3: 81
4: 513
Right 1186487639 X:9945986-9946008 GGCCACGCAGAACGCTGTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 86
1186487630_1186487643 20 Left 1186487630 X:9945955-9945977 CCTTCCCCTTTCTCCAGGTGAGG 0: 1
1: 0
2: 9
3: 81
4: 513
Right 1186487643 X:9945998-9946020 CGCTGTCCTGGCGCTGGGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 297
1186487630_1186487642 15 Left 1186487630 X:9945955-9945977 CCTTCCCCTTTCTCCAGGTGAGG 0: 1
1: 0
2: 9
3: 81
4: 513
Right 1186487642 X:9945993-9946015 CAGAACGCTGTCCTGGCGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 86
1186487630_1186487641 14 Left 1186487630 X:9945955-9945977 CCTTCCCCTTTCTCCAGGTGAGG 0: 1
1: 0
2: 9
3: 81
4: 513
Right 1186487641 X:9945992-9946014 GCAGAACGCTGTCCTGGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 76
1186487630_1186487645 26 Left 1186487630 X:9945955-9945977 CCTTCCCCTTTCTCCAGGTGAGG 0: 1
1: 0
2: 9
3: 81
4: 513
Right 1186487645 X:9946004-9946026 CCTGGCGCTGGGCTTGGAGACGG 0: 1
1: 0
2: 2
3: 51
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186487630 Original CRISPR CCTCACCTGGAGAAAGGGGA AGG (reversed) Intronic
900384362 1:2402794-2402816 CCTCCCGTGGAGGAAGGGCAAGG - Intronic
900507732 1:3038126-3038148 GGTGACTTGGAGAAAGGGGAGGG + Intergenic
900804078 1:4755925-4755947 CGTCACCTGGGGAAGGGTGAAGG + Intronic
900874175 1:5329802-5329824 CCTCACATGGTGGAAGGGGAAGG + Intergenic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
901091082 1:6641951-6641973 GATCACCTGGGGCAAGGGGAAGG + Intronic
902471405 1:16649291-16649313 GCTTGCCTGGGGAAAGGGGAAGG - Intergenic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902871099 1:19314042-19314064 CCTCACCTGCAGGGATGGGAAGG - Intronic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903190362 1:21652533-21652555 CCTCACCAGGGCAAAGGGGAAGG - Intronic
903570018 1:24297439-24297461 CCTCACCTTGAGCAAGGGGAGGG + Intergenic
903764629 1:25726226-25726248 CTGCACCTGGGGAAAGGGAAAGG + Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
904623875 1:31791247-31791269 CCAGACCTGGGGAAAGGAGAGGG + Exonic
904713268 1:32447772-32447794 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
904901713 1:33862757-33862779 GCTCACAGGGAGGAAGGGGATGG + Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905434669 1:37948306-37948328 CTTCACTTGGGGAAAGAGGAAGG - Intergenic
905447586 1:38037091-38037113 CCTCACCTGTAGGCTGGGGATGG + Intergenic
905652530 1:39666063-39666085 CCTCACCTTCACAAAAGGGAAGG + Exonic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906353045 1:45080030-45080052 CCTCTCCTCGAGCAAAGGGACGG + Intronic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
909297440 1:73968573-73968595 CTTCACTTGGAGAGAGGGAAAGG + Intergenic
909663771 1:78111409-78111431 CCTCAGATGGAGCAATGGGAGGG + Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910808309 1:91210795-91210817 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
910844370 1:91591474-91591496 CCTCACCTCGGGAAATGTGAAGG - Intergenic
911068820 1:93815601-93815623 CCTCCCCAGAAGAATGGGGAGGG + Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912598602 1:110904036-110904058 CCTCTCCTTTGGAAAGGGGAGGG + Intergenic
912980586 1:114368174-114368196 CCTCCCCTAGAGGAAGAGGAAGG - Intergenic
913050289 1:115111658-115111680 CCTCACATGGTAGAAGGGGAAGG - Intergenic
915102082 1:153507925-153507947 CCTCACCTCAAGGAAGGGAAAGG + Intergenic
915954251 1:160209629-160209651 CCTCAGCTGGAAAAGGGGGCAGG - Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
917691538 1:177474966-177474988 CCTCCCCTGGAGCAAGTGGCTGG + Intergenic
917742630 1:177975868-177975890 GCTCACCTGAAGCAAGGGGCTGG - Intronic
917850558 1:179060029-179060051 TGCCACTTGGAGAAAGGGGAAGG - Intronic
918148721 1:181780433-181780455 CCTCTCCTGGTGCAAGTGGAGGG + Intronic
918513677 1:185339083-185339105 ACTCAACTGGAGTAAGTGGAGGG - Intergenic
919108603 1:193188624-193188646 CCTTTCCTGGAGAAAGGGGTAGG - Intronic
919943357 1:202303480-202303502 CCACATCAGGAGGAAGGGGATGG - Intronic
920199241 1:204249363-204249385 CCTCAGCAGGAGAAAGGAGGGGG - Intronic
922698684 1:227745310-227745332 CTGCACCTGGGGAGAGGGGAAGG - Intronic
923048157 1:230370348-230370370 CGTGACCTTGAGAAAGGGGAGGG - Intronic
923719696 1:236456320-236456342 ACTCACCTCTAGTAAGGGGATGG + Intronic
924555973 1:245118933-245118955 CCTCAGCTAGGGAGAGGGGAGGG + Intronic
924668206 1:246095250-246095272 ACTGTCCAGGAGAAAGGGGAAGG + Intronic
924681177 1:246235712-246235734 CCTCTCCTCTAGGAAGGGGAGGG + Intronic
924740205 1:246790429-246790451 CCTCACCTGGAAAACAAGGAGGG - Intergenic
1062856672 10:783342-783364 CCTCACCTGGAGGAACAGGCAGG - Intergenic
1064445126 10:15386230-15386252 CCCCACCTGGTGGGAGGGGAAGG + Intergenic
1064846479 10:19660567-19660589 TTTCACATGGAGAAAGGTGAAGG - Intronic
1065666710 10:28071026-28071048 CCTCACCTGGTGACACTGGAAGG + Intronic
1065810425 10:29438222-29438244 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1066209484 10:33223174-33223196 CCTCACCTGGAAAGATGGGGAGG - Intronic
1066213223 10:33260483-33260505 CCTCAGCTGGCAAAAGGGGCTGG - Intronic
1067158562 10:43803151-43803173 CCTCACATGGAGCAAGGGGCCGG + Intergenic
1067511364 10:46897564-46897586 CCTCCCCTGCAGACAGAGGATGG + Intergenic
1067650883 10:48154298-48154320 CCTCCCCTGCAGACAGAGGATGG - Intergenic
1067658025 10:48211921-48211943 CCTGACCTGGAGAGAGGTGTTGG - Intronic
1067938664 10:50633925-50633947 CCACACCTGGAGAACTAGGAAGG - Intergenic
1068556455 10:58464535-58464557 CCATACCTAGAGAAAGGGTATGG - Intergenic
1068713162 10:60156195-60156217 TTTCACTTGGAGAAAGGAGAGGG + Intronic
1069694365 10:70376019-70376041 CATCCCATGAAGAAAGGGGACGG - Intronic
1070851228 10:79562874-79562896 GTGCAGCTGGAGAAAGGGGAAGG - Intergenic
1070963552 10:80515893-80515915 CCACATCTGGAGAAAGAGAAGGG - Intronic
1071071152 10:81696031-81696053 TCTCACATGGTGAAAGGGGTAGG + Intergenic
1071129190 10:82371746-82371768 CCACTCCTGGAGGAAGGTGAAGG + Intronic
1071966872 10:90860401-90860423 CCTCACCTGGCAAAGGGGGTAGG + Intergenic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073419512 10:103413099-103413121 CCTCACCTAGACAAAAGGAAGGG - Exonic
1073471681 10:103726380-103726402 CCTCACCCGTAGTATGGGGATGG - Intronic
1073765305 10:106675859-106675881 CCTCACGTGGTGGAAGGGCAAGG - Intronic
1073935944 10:108632076-108632098 CCTAAGCAAGAGAAAGGGGATGG - Intergenic
1074424539 10:113339239-113339261 CCCCATCTGGAGAAAGGTGAAGG - Intergenic
1075576864 10:123584151-123584173 CCACCCCTGGAGAACGGGGGAGG - Intergenic
1075672505 10:124272159-124272181 TTTCATCTGGATAAAGGGGAGGG + Intergenic
1075896047 10:125995400-125995422 GCTCTCCTGGAGAAATGAGATGG - Exonic
1076160216 10:128237755-128237777 GCCCTCTTGGAGAAAGGGGAGGG + Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076569057 10:131420423-131420445 CCTCAGCAGGAGGAAGAGGAGGG - Intergenic
1077902763 11:6502990-6503012 GCGCACGTGGAGAAAGAGGAGGG - Intronic
1078624671 11:12943686-12943708 CCTCTCTTAAAGAAAGGGGAAGG - Intronic
1078723518 11:13906203-13906225 CCACTCATGGTGAAAGGGGAAGG + Intergenic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079318132 11:19427220-19427242 CCTCCCCTGCAGAAAGAGGATGG + Intronic
1079473838 11:20807784-20807806 CTCCACCTGGGAAAAGGGGAAGG - Intronic
1080257346 11:30305849-30305871 CCTCACATGGTGAAAGGCAATGG + Intergenic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1081590612 11:44420439-44420461 CCTCCACTGGAGTAAGGGGAAGG - Intergenic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1083427033 11:62593537-62593559 CCTCCCTTTGTGAAAGGGGATGG - Exonic
1084102206 11:66957264-66957286 TCTCAGCTGGAGAACGGGTAAGG + Intronic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1086160763 11:83719517-83719539 CCACTCCTGGCAAAAGGGGAAGG + Intronic
1086168304 11:83806108-83806130 CCTGACCTGGACAAGGGAGAAGG - Intronic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1087128984 11:94652700-94652722 CGTGACCTGGAGGAAGGAGAAGG + Intergenic
1087549195 11:99625713-99625735 CCTCACCTGAAGAAAAGTGATGG - Intronic
1087569634 11:99909038-99909060 ATTCAGCTGGAGAAAGAGGAAGG - Intronic
1089117801 11:116110619-116110641 TTCCACCTGTAGAAAGGGGATGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089462755 11:118662425-118662447 CCTCACCTGGGGAAAGGGTTTGG - Intronic
1089466820 11:118690900-118690922 CCTCATCTGGGGAAAGGGTTTGG + Intergenic
1091589545 12:1835100-1835122 CCTCACCTGCATTGAGGGGACGG + Exonic
1091768418 12:3136824-3136846 CCTCAGCTGGAGGCAGGGGTGGG + Intronic
1091848618 12:3677583-3677605 CTCCTCCTGGAGAAGGGGGAAGG - Intronic
1092204060 12:6604972-6604994 CCTCACCTTGGGCAAGGGCATGG + Intronic
1092293484 12:7179901-7179923 CATCACATGGTGAAAGGGCAAGG + Intergenic
1092629536 12:10363279-10363301 CCTTCCCTAGGGAAAGGGGAAGG + Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094143216 12:27202057-27202079 GCTCACCTGGAGAAAGGAAGAGG + Intergenic
1095327989 12:40921065-40921087 CATCACCTGGGGGAAGAGGAAGG + Intronic
1096107589 12:49006043-49006065 CTTAACCTGGAGACAGGGGTTGG - Intronic
1096631128 12:52927372-52927394 CCTCCCCTGGGGAAAGGGTGGGG + Intronic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096803339 12:54126151-54126173 CCCCACATGGCGAAAAGGGAGGG - Intergenic
1098377966 12:69837580-69837602 CCTCATCTGGATGAAGGAGATGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098904812 12:76151047-76151069 CCTCTCCTTAGGAAAGGGGAGGG - Intergenic
1099977492 12:89561216-89561238 CCACTCCTGGAGAAAGGAGTTGG - Intergenic
1100433080 12:94547527-94547549 CCTCACCTGGAGCAAAGGCACGG - Intergenic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101866600 12:108524928-108524950 ATTAACCTGGATAAAGGGGAGGG + Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102414322 12:112747305-112747327 CCTCACATGGTGGAAGGGCAAGG - Intronic
1103526951 12:121575457-121575479 CCTGATCTGGAGCAAGGGGAAGG + Intronic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104605199 12:130183035-130183057 CCATAACTGGAGAAAGGAGAAGG + Intergenic
1104683969 12:130772322-130772344 CCACTCATGGAGAAAGGGGAAGG + Intergenic
1106039678 13:26077598-26077620 CCTCTCTTAGAGAAAGGGGCAGG - Intergenic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1108983618 13:56553894-56553916 CCTCACCTGTAGATTGGGTAAGG + Intergenic
1109987864 13:70013450-70013472 GCTAACTTGGAGAAAGGGCAAGG + Intronic
1110065502 13:71100608-71100630 CCTACCCTGAAGACAGGGGAAGG - Intergenic
1110829251 13:80011743-80011765 CCTCCCCTGGATGAAGGGTATGG + Intergenic
1111113964 13:83751747-83751769 TGTCACCTGGAGGAAGGGGGTGG - Intergenic
1111990172 13:95108575-95108597 CCTCACATGGTGGAAGGTGAAGG - Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112520284 13:100088986-100089008 CCTAACTTGCGGAAAGGGGAGGG - Intergenic
1113747732 13:112756632-112756654 CCTCACCTGGAGAGCCTGGACGG + Intronic
1113834487 13:113319669-113319691 CCTCACCTGGGAGAGGGGGACGG + Intronic
1115415008 14:33122334-33122356 CCTCTTCTGGAGAAAGGTGATGG - Intronic
1115790403 14:36871258-36871280 CCTCACATGGTGAAAGAGCAAGG - Intronic
1116777703 14:49200749-49200771 CCTCTGCTGGAGAAAGGGAGAGG + Intergenic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118346431 14:64944502-64944524 TCACACCAGGAGAAAAGGGATGG - Intronic
1118455386 14:65941569-65941591 TCTCACCTGGAGAGATGGGGAGG + Intergenic
1118459911 14:65978324-65978346 CATCACCTGGAGAAAAGGTGGGG - Intronic
1120450845 14:84665444-84665466 CATCCCCAGGAGAAAGGGGAGGG - Intergenic
1121274453 14:92658003-92658025 CATCCCCTGGAGACAGAGGAGGG + Intronic
1121570835 14:94945400-94945422 CCTCACCTGATAAACGGGGATGG + Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1122429789 14:101633110-101633132 CCTGACCTAAAGAAAGAGGAAGG + Intergenic
1122495847 14:102154371-102154393 CCTCACATGGTGGAGGGGGAAGG + Intronic
1122910088 14:104823374-104823396 CCTCATCTGGAGGGAAGGGAGGG - Intergenic
1123670744 15:22654404-22654426 CCTCACTTGGTGAAAGGGGCAGG - Intergenic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1125087899 15:35752415-35752437 CCGCACATGGAGAAAAGGAAAGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1126238092 15:46409105-46409127 CAACATATGGAGAAAGGGGATGG - Intergenic
1127734556 15:61829031-61829053 CCTGACCAGGGGAAAAGGGAGGG + Intergenic
1127857316 15:62963127-62963149 CCTCACCTGGAGCCTGAGGATGG - Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129232525 15:74204640-74204662 CCACACCTGGCCAAAGGGCATGG - Intronic
1129429230 15:75486394-75486416 CCTCACATGGCAGAAGGGGAAGG - Intronic
1129900852 15:79148455-79148477 CTTCACATGGAGGAAGGGTAAGG + Intergenic
1129933261 15:79429788-79429810 CCCCACCTGGGGAAAAGTGAAGG - Intergenic
1129958248 15:79659010-79659032 CCTCTCATGGAGGAAGGGTAAGG + Intergenic
1130562742 15:84971524-84971546 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1131072429 15:89474660-89474682 CCTCAACTGCTGAAAGGGGTGGG + Intronic
1131405811 15:92163619-92163641 CCCCACCTGGAGGAAGAGGGTGG - Exonic
1131689821 15:94814710-94814732 CCTCACATGGATGAAGGGCAAGG - Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132307842 15:100830565-100830587 TCTCAGCTGGAGATCGGGGAGGG - Intergenic
1132474315 16:125797-125819 CCTCAGCTACAGAAAGGAGAGGG + Intronic
1133345853 16:5070030-5070052 TGTCTCCTGGAGAGAGGGGACGG - Intronic
1133441144 16:5821823-5821845 CCTCACATGGTGAAAGGAGAAGG + Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1135129900 16:19844773-19844795 CCAAACATGAAGAAAGGGGATGG + Intronic
1135553324 16:23415129-23415151 CCTCTCTTGGTGCAAGGGGAAGG - Intronic
1136043847 16:27600598-27600620 GCTCACCAGGAGAATGGGGGAGG - Intronic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137866552 16:51903029-51903051 CCTCACAAGGAGATAGGGCATGG + Intergenic
1138027225 16:53531497-53531519 CCACACCTCGAGGGAGGGGAAGG + Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138345884 16:56319860-56319882 CAGCAGCTGGAGAAAGGGGTGGG - Intronic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139435655 16:66935175-66935197 CCCCAGATGGAGAAATGGGAAGG - Exonic
1139438044 16:66948222-66948244 CCACAGTTGGAGAAATGGGAAGG - Intergenic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140455103 16:75100394-75100416 CCTCACTAGGGGAAAGGGAAGGG - Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141665900 16:85464965-85464987 CCTCACCTGCAAAAACGAGAGGG - Intergenic
1141746927 16:85932062-85932084 CCTCACCTGGCAAATGGGGTGGG + Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1142050934 16:87957773-87957795 CGTCATCTGGTGAAAGGTGAAGG - Intronic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1143048853 17:4105488-4105510 CCTGACCTGAAGAATTGGGAAGG - Intronic
1143155424 17:4833448-4833470 CCTCCCCCGGAGACCGGGGAGGG - Exonic
1144169519 17:12646381-12646403 CGTCACACGGAGAAAGGGTAGGG + Intergenic
1144237359 17:13274510-13274532 CCTCTCATGGTGGAAGGGGAAGG - Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1146724943 17:35148956-35148978 GCTCTCCTGAGGAAAGGGGAAGG - Exonic
1147991091 17:44333968-44333990 GCCCACCTGGAGAAAGGCCAGGG + Intergenic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1148336802 17:46847540-46847562 GGTCACCTGGAGGATGGGGAAGG + Intronic
1148822314 17:50366777-50366799 AATCTCCTGGAGAAAGGGGAAGG - Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1150477698 17:65487440-65487462 CCTCACGTGGCGGAAGGGGCTGG + Intergenic
1150653696 17:67025780-67025802 CCTCTCCAGGAGAAAGGGCGAGG - Intronic
1151176568 17:72293506-72293528 CCTCCCTTGGAGAAAAGAGAGGG - Intergenic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151824806 17:76518275-76518297 CCTCACCTGGTGGAAGGGCAAGG - Intergenic
1152380699 17:79941102-79941124 CCTCGCCTGCAGACAGAGGACGG + Exonic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1155429842 18:25743849-25743871 CCCCACCTGGTGAGGGGGGATGG - Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157740819 18:50091091-50091113 CCCCACCTGAAGACAGGGAAGGG + Intronic
1158013324 18:52754485-52754507 CCTCACATGGTGAAAGGAGCAGG - Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158625356 18:59066578-59066600 CCTCACATGGCGGAAGGGTAGGG + Intergenic
1160464341 18:79063570-79063592 CCTCATCTGGGGAAAGGTGAAGG + Intergenic
1160838754 19:1136977-1136999 CAGCACCTGGGGAATGGGGATGG + Intronic
1160895315 19:1399642-1399664 CCCCACCTGCAGAAAGGGAGCGG + Intronic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1162009315 19:7802222-7802244 CCTGACCTCCAGGAAGGGGAAGG - Intergenic
1162141205 19:8586465-8586487 CAGCACCTGGAGAAAGGGGGCGG + Exonic
1163103140 19:15109413-15109435 GCTCACCTTGGGGAAGGGGATGG - Intronic
1164705273 19:30314815-30314837 CTCCACCCAGAGAAAGGGGAGGG - Intronic
1165318949 19:35074365-35074387 CCTAACCTGGAGAGAGGACAGGG + Intergenic
1165822663 19:38686440-38686462 CTTCACCTGGAGAACAGGGAGGG - Intronic
1165931646 19:39362980-39363002 GCTCACATGGACACAGGGGAGGG - Intronic
1166051235 19:40261583-40261605 CGTCCCATGGTGAAAGGGGAAGG - Intronic
1166195383 19:41202433-41202455 CCTCACCTAGGAAATGGGGATGG + Intronic
1167685507 19:50953201-50953223 CCTGGCCCGGAGAATGGGGAGGG + Intergenic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168568288 19:57442572-57442594 GCTCACCTTGAGCAAGGGGGAGG + Intronic
1202703803 1_KI270713v1_random:6086-6108 GCTTGCCTGGGGAAAGGGGAAGG - Intergenic
925063107 2:908718-908740 CTTCACCTGGGGAAAGGGGCAGG - Intergenic
925574697 2:5348930-5348952 CATCACCTGGACATGGGGGAGGG + Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
926396441 2:12447380-12447402 CCTCACATGGCAAAAGGGAAGGG - Intergenic
926589465 2:14724579-14724601 CCTCACCTGGAACAGAGGGAGGG + Intergenic
927168749 2:20350872-20350894 GCACCCCGGGAGAAAGGGGAGGG + Intronic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
928154989 2:28868616-28868638 CCTGATCTGGAGAAAGGAGGAGG + Intronic
929969843 2:46564627-46564649 CCTCATCTGGACATAGAGGAAGG + Intronic
930878247 2:56244301-56244323 CCTCTGCTGGCGCAAGGGGAGGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
932410867 2:71546970-71546992 CCTCACCTGGGGGAAGCTGAAGG - Intronic
932415677 2:71572644-71572666 CCTCACCTGGAGGCAGGGCTGGG + Intronic
933313356 2:80687228-80687250 CCTCAACTGGACAAAGGGTTGGG + Intergenic
933748085 2:85585098-85585120 CCTCCCCTAGAGAAAGAGAAAGG + Intronic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
936249771 2:110859518-110859540 GCACACCTGGAGGAAGGAGAAGG + Intronic
938228248 2:129636193-129636215 CCTCACATGGCCAAATGGGAAGG + Intergenic
938626356 2:133113546-133113568 CCACACCTGGTGGAAGGGGATGG - Intronic
939442081 2:142262285-142262307 CCACAACTGGAAAAAAGGGAGGG + Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
940493812 2:154399481-154399503 CCTCACATGGACAAAGGGGCAGG + Intronic
940899523 2:159113654-159113676 TCTCACCTGGAGAATAGAGAAGG + Intronic
941083730 2:161092207-161092229 CCTCACATGGAGGAAGAGCAAGG + Intergenic
941090191 2:161166438-161166460 CCTTACCTGAAGAAAGGAAATGG - Intronic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942737900 2:179137376-179137398 TCTAACCTGGAGAAAGAGTATGG + Intronic
943393739 2:187305769-187305791 CCTTACCTAGAGAAAGAGGAAGG - Intergenic
943759085 2:191588940-191588962 CCTCACATGGAGAAAGGTCAAGG - Intergenic
945059755 2:205898704-205898726 GCTCACGTGGTGAAAGAGGAAGG - Intergenic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
945273193 2:207962202-207962224 CCTGACCTCCAGGAAGGGGAAGG + Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946105668 2:217367559-217367581 CTACAGCTGGGGAAAGGGGAAGG - Intronic
946737119 2:222764915-222764937 GTGCACCTGGAAAAAGGGGAGGG + Intergenic
947385165 2:229584273-229584295 CCTCACCTGGAGGATGGGGTAGG - Intronic
947556556 2:231098637-231098659 CCTCCCCTAGAGGAAGTGGAAGG - Intronic
947944513 2:234090135-234090157 CCTTACATGGTAAAAGGGGAAGG - Intergenic
948146988 2:235715453-235715475 CCTCCTCAGGTGAAAGGGGAGGG + Intronic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
948779326 2:240308280-240308302 CCTCCCCTGGAGCAAGGGAGAGG - Intergenic
948794928 2:240397628-240397650 CCTCGTCTGTAGAAAGGGGTTGG - Intergenic
948981521 2:241497143-241497165 CCCCACCTGGAGCCTGGGGAGGG - Intronic
1169268277 20:4180877-4180899 CCCCAGCTGGAGTGAGGGGAGGG + Intronic
1169277503 20:4243674-4243696 CCTCACCGAGAGAGAGGGGAGGG - Intronic
1170732794 20:18988939-18988961 CCTCACCTGGAGGCAGAGGCGGG + Intergenic
1170912236 20:20584365-20584387 ACTCACCTGGAGAAAGGTCCAGG + Intronic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172167788 20:32909477-32909499 CCTCGCCTGGGGCAAGGGGGAGG + Intronic
1173255335 20:41390567-41390589 CCGGACCTGGAGAAGGGGAAAGG - Intergenic
1173526812 20:43739012-43739034 CCTCACCAGGGGAGAGGGGCCGG - Intergenic
1173554938 20:43959178-43959200 CCTCCCCTGGAGAACAGGAATGG - Intronic
1174161910 20:48557120-48557142 CCTTCCCTGGAGGAAGGGGAGGG - Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174650416 20:52120101-52120123 CCACACATGGTGGAAGGGGAAGG - Intronic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175785487 20:61709155-61709177 ACTCCCCTGGAGAGAGGGGCAGG - Intronic
1175817572 20:61891468-61891490 AGTCACCTGGAGAAGGGGGGAGG - Intronic
1175828417 20:61949572-61949594 CCTCACATGGTGGAAGGTGAGGG + Intergenic
1175946308 20:62560694-62560716 CCTCCCCTGGTGGGAGGGGAGGG + Intronic
1176094789 20:63335499-63335521 CCTCACTTGGCGGAAGGGGCGGG + Intergenic
1176276348 20:64272057-64272079 CCTGTCCTGGAGAAAGGAGAAGG + Intronic
1176795000 21:13365325-13365347 CCTCACCTGTAGAATAGGAATGG - Intergenic
1178836863 21:36105520-36105542 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1179110148 21:38439159-38439181 CATCGCCTGTGGAAAGGGGAAGG + Intronic
1179604790 21:42507708-42507730 CCTCACATAGTGAGAGGGGAAGG + Intronic
1180727118 22:17954459-17954481 CATCACCTGGGGCATGGGGAGGG + Intronic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183034021 22:35127125-35127147 CCTCACCTGTAAAAAGGACAGGG - Intergenic
1183059672 22:35328441-35328463 CCTGACCTGGAAAATGGGGGTGG - Intronic
1183072112 22:35403397-35403419 CTCCAGCTGGAGAAAGGGAAGGG - Exonic
1183100494 22:35580753-35580775 CCTCACCTGGAAAATGGGTTTGG + Intergenic
1183319082 22:37154198-37154220 CCACCCCAGGAGACAGGGGATGG + Intronic
1183827647 22:40401031-40401053 CCTCAGGTGGAGAAAGAGGCCGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184151814 22:42643832-42643854 CCCTACCTGGAGGATGGGGAGGG + Intronic
1184273999 22:43399992-43400014 CCTGACCAGGAGGAAGGGGAGGG + Intergenic
1184507819 22:44914693-44914715 CCTCACGTGGTGGATGGGGAAGG + Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1185019734 22:48367146-48367168 CCTCACATGGAGGAAGGAGGAGG + Intergenic
1185152800 22:49175628-49175650 CCTCATGAGGTGAAAGGGGAAGG - Intergenic
949122613 3:404989-405011 CCTCACATCGTGAAAGGGGTAGG + Intronic
949935495 3:9112617-9112639 CCTCTCCTGGGGAAGGCGGAGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950173778 3:10857225-10857247 CATCACTTTGAGCAAGGGGAGGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950529387 3:13544465-13544487 CCTGCCCTGGAGCCAGGGGAGGG - Intergenic
950869039 3:16213024-16213046 CCTCACCTGGGGCCAGGGGAGGG + Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
953545461 3:43860981-43861003 AATGACCTGGAGGAAGGGGAGGG + Intergenic
954156904 3:48690461-48690483 CCTTACCTCTACAAAGGGGAGGG + Intronic
954537390 3:51371423-51371445 GCTCATCTGGAGAAAGGTGCAGG + Intronic
954604487 3:51898096-51898118 CCTCCCCTAGGGGAAGGGGAAGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955148818 3:56346840-56346862 CCTCCAATGGAGAAAGGGCAAGG + Intronic
956737448 3:72248596-72248618 CCTCACCTCTACAAAGAGGATGG - Intergenic
957163988 3:76647045-76647067 TCTGACCTTGAAAAAGGGGAGGG + Intronic
957265951 3:77966105-77966127 CCTGTCCTGGAGTAGGGGGAAGG + Intergenic
957965898 3:87322038-87322060 CTTTCCCTGGGGAAAGGGGAAGG + Intergenic
958644944 3:96858038-96858060 AATCAGCTGGAGAAAGGGGGTGG + Intronic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
959863737 3:111243137-111243159 CCTCACCTGGAGATGGGAGCAGG + Intronic
961683656 3:128615566-128615588 GCCCACCTGGAGAATAGGGAAGG + Intergenic
961817153 3:129556986-129557008 CCTCCACTGGAGTAAGGGCAGGG - Intronic
962608362 3:137051310-137051332 CTTCACCTGTAGCAATGGGAAGG + Intergenic
963060629 3:141222048-141222070 CCTGGCCTGGAGAAGAGGGAAGG - Intergenic
963173724 3:142277380-142277402 CCTCACGTGGTGAAAGGCAAAGG - Intergenic
963989368 3:151635419-151635441 CCTCACATGGTGGAAGGGGAGGG + Intergenic
964628709 3:158784934-158784956 CCTCACCTGGAGAGGGATGAGGG + Intronic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
966400990 3:179546732-179546754 CTCCACCTGGGGAAAGGGGAGGG + Intergenic
966735253 3:183182148-183182170 CCTCGCCTGGAGGCAGGGAATGG - Intronic
967019230 3:185507973-185507995 CTTCACATGGGGACAGGGGATGG - Exonic
967123459 3:186404525-186404547 CCTCACATGGTGAAAGGGCAAGG - Intergenic
967465856 3:189805640-189805662 GCTCACCAGGAGAAATAGGAAGG + Intronic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969457260 4:7307184-7307206 CGTCGCCTGGGGAGAGGGGAGGG - Intronic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
969676297 4:8616268-8616290 CATCACCTGGGGCGAGGGGAGGG + Intronic
970034396 4:11716071-11716093 ATTCACCTGGAGAAGGGAGAGGG - Intergenic
970237711 4:13975402-13975424 CCTCACATGGCGAAAGGGGAAGG + Intergenic
971003590 4:22349960-22349982 CCTCACCTGGATAATAGAGATGG - Intronic
971822776 4:31580234-31580256 CCTCACATGAAGTAAGGGGCAGG - Intergenic
972229538 4:37055178-37055200 CCTCACCAAGAGCAAGGGAATGG - Intergenic
972579126 4:40379561-40379583 CCTCTCCTCAAGCAAGGGGAAGG - Intergenic
972775800 4:42239399-42239421 CCTGTGCTGGAGAGAGGGGAGGG - Intergenic
972784748 4:42315793-42315815 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
975805082 4:78103692-78103714 CCTCACATGGTGAAAGGGGTTGG - Intronic
976700955 4:87967701-87967723 CTTCATCTGGTGAAAGGGTAAGG + Intergenic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977141927 4:93384126-93384148 CCTCACATGGCCAAAGGGGAAGG + Intronic
977489800 4:97697890-97697912 CCTCACGAGAAGAAAAGGGATGG - Intronic
978313937 4:107415144-107415166 CCTCCCCTAGGGTAAGGGGAAGG + Intergenic
979312558 4:119220981-119221003 CATCACCTGGAGGATGGTGAAGG + Intronic
980911351 4:138997590-138997612 CCTAACAGGGAGCAAGGGGAGGG - Intergenic
980930063 4:139176726-139176748 CGGGACTTGGAGAAAGGGGAAGG - Intronic
981290669 4:143071340-143071362 CCTCACCTGGTGAGGAGGGATGG + Intergenic
981552973 4:145960417-145960439 CCTCACAAGGTGAAAGGGAAAGG + Intergenic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
985409035 4:189664333-189664355 CCTGACACGGAGAAAGGAGAAGG - Intergenic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
986234355 5:5893513-5893535 CCTCACCTGGAGAATGGGCGTGG - Intergenic
986257320 5:6111024-6111046 CCCCTTATGGAGAAAGGGGATGG - Intergenic
986321496 5:6635523-6635545 CCCCACCTGTAGAATGGGCATGG + Intronic
988506263 5:31826117-31826139 CCTCACCTTGAGAGAGAAGAGGG - Intronic
989062275 5:37421080-37421102 CCTCACCTGTCGAAAGGGGATGG - Intronic
989348203 5:40453640-40453662 CCTCACCCAGTGAAAAGGGATGG + Intergenic
990043933 5:51405229-51405251 AATCACCCAGAGAAAGGGGATGG + Intergenic
990349422 5:54900785-54900807 CCTACCCTGAAGAAAGGGGCTGG + Intergenic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
990666191 5:58074970-58074992 CCTCAACTGGAGGACGGGAACGG + Intergenic
991582813 5:68174465-68174487 CCTCACATGGTGGAAGGGCAAGG + Intergenic
992598048 5:78366096-78366118 CCTCACATGGCAGAAGGGGATGG + Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993055418 5:82974795-82974817 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
993736257 5:91479859-91479881 CCTAACTGGGAGAAAGAGGATGG - Intergenic
994079713 5:95694820-95694842 CCTCCCTGGTAGAAAGGGGAGGG - Intronic
995316666 5:110782389-110782411 CCACACATGGAGAAAGGTGAAGG + Intergenic
996036279 5:118762507-118762529 CCCCACCTGGTGAGAAGGGATGG - Intergenic
997206861 5:132055251-132055273 CCTCCCAGGGAGAGAGGGGAAGG - Intergenic
997415534 5:133725450-133725472 CCTCTCCTGAAGAAAGGGAGTGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998498446 5:142611363-142611385 CCTCACCTGTGGAATGGGAATGG - Intronic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998552789 5:143093741-143093763 CCTCCCCTAGGGGAAGGGGAAGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999816139 5:155178244-155178266 CTTCACATGGTGAAAGGGCAAGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000334071 5:160228994-160229016 GCTGACCTGGAGCATGGGGAAGG - Intronic
1000410332 5:160930677-160930699 CCTCAGGTGGAGAAAGGGCAGGG - Intergenic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001210431 5:169805910-169805932 GCTCACCCGGAGAAAGGGGTGGG - Intronic
1001287645 5:170435471-170435493 CCTCATCTGGAGAGCGGGGCTGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1003175283 6:3749551-3749573 CCTCACCTGGAGCAGGAGGGAGG - Intronic
1003946213 6:11078263-11078285 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1003972880 6:11315902-11315924 CCTGACCAGGAAAAAGGGCATGG + Intronic
1005169710 6:22968873-22968895 CCTCACCTGGTGGAAGGTGAAGG + Intergenic
1005214519 6:23509606-23509628 CCTCACATGGAGGAAGGGAAAGG - Intergenic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007795374 6:44342800-44342822 CCTCCCCTGGGGAAGGGGGTGGG + Exonic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008857763 6:56112505-56112527 CCTCTGCTGGGGAAGGGGGAGGG - Intronic
1009947413 6:70355908-70355930 CCTCACATGGTGGAAGGGCAAGG - Intergenic
1010191413 6:73201028-73201050 CCTGAGCTGCAGCAAGGGGAGGG - Intergenic
1010641289 6:78331191-78331213 CCACACCCTGAGAGAGGGGAAGG + Intergenic
1010733145 6:79412091-79412113 CGTTCCCTGAAGAAAGGGGAAGG + Intergenic
1011570127 6:88725807-88725829 CCTCCCCTAGGGGAAGGGGAAGG + Intronic
1012520069 6:100110554-100110576 CCTCTGCTGAAGAAAAGGGAAGG + Intergenic
1012972500 6:105746420-105746442 CCAGACCTGCAGAAAGGGGGTGG - Intergenic
1013211217 6:107988643-107988665 TCTCTCCTGGAAAAAGGGAAAGG - Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1015169890 6:130240762-130240784 CCTCACATGGTGGAAGGGCAAGG - Intronic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015603772 6:134935679-134935701 TCTAACCTGGAGCAAAGGGAAGG - Intronic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1016388802 6:143554580-143554602 CCTCACCTGAGGAAAGGTGAAGG + Intronic
1016804201 6:148196546-148196568 GCTCACTGGGAGAAAGAGGATGG - Intergenic
1016904639 6:149136764-149136786 CCTCACATGGCAGAAGGGGAAGG + Intergenic
1016958976 6:149653528-149653550 TCTCACCTGGTGAAAAGAGAGGG - Intergenic
1017173030 6:151475758-151475780 CCTCACGTGGAGAAGGCGGACGG + Intergenic
1017595645 6:156025901-156025923 CCTCACATGGTGGAGGGGGAGGG - Intergenic
1018191616 6:161314367-161314389 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019703792 7:2487979-2488001 CCTCACCTGGAGAAACAGTCTGG + Intergenic
1019911006 7:4100575-4100597 CCTCACGTGGTGGAAGGAGAGGG - Intronic
1021197326 7:17688024-17688046 CCTCTCCTGGAGAAAGAGACAGG + Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022111599 7:27235665-27235687 CAGCACCTGGGGCAAGGGGAGGG + Intergenic
1022500390 7:30878887-30878909 TCTGACCTGGTGAAAGTGGATGG - Intronic
1023436644 7:40147154-40147176 CCTCCCCTAGCGGAAGGGGAAGG - Intronic
1023628087 7:42136668-42136690 CAACACCTGGAGCACGGGGAGGG + Intronic
1024244106 7:47456414-47456436 CCCCACCTGGGGAATGGGGGTGG + Intronic
1024390588 7:48807204-48807226 CCTCACATGGTGAAGGGGCAAGG - Intergenic
1024785278 7:52900515-52900537 AGTCAACTGGAGAACGGGGAGGG + Intergenic
1024963013 7:54997132-54997154 ACTCAGCAGGGGAAAGGGGAAGG - Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1026277719 7:68894768-68894790 CCTCACATGGAGGAAGAGGGAGG - Intergenic
1027250844 7:76397827-76397849 CCTCACCTGGGGATGGGGGCGGG + Exonic
1028906522 7:96160566-96160588 CCTCACATGGAGGAAGGAGTGGG + Intronic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029448552 7:100627969-100627991 CATCCCCTGGAAAAAGGGGAGGG + Exonic
1029972454 7:104802543-104802565 CCTCACATGGTGGAAGGGGAGGG - Intronic
1030065180 7:105653867-105653889 GTTCACCTGGAGAATGGGGGAGG - Intronic
1030618958 7:111769013-111769035 CTTCACATGGTGAAAGGGGCTGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1032486637 7:132292638-132292660 CCTCACCCAGAGAAAGGGCCAGG - Intronic
1032742045 7:134748938-134748960 CCTCACATGGTGAAAGGGGTGGG - Intronic
1032783091 7:135179855-135179877 CCTGACTTGGAGAAAGGCCATGG - Intergenic
1033992804 7:147308605-147308627 CCTCAAATTGTGAAAGGGGAAGG - Intronic
1034453391 7:151149919-151149941 CCTTGGCTGGGGAAAGGGGAAGG - Intronic
1034752786 7:153586610-153586632 CATCACCTGGTGACAGGTGAAGG - Intergenic
1035856517 8:2981917-2981939 CCTCTCCAGGAAAAAGGGGTGGG - Intronic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1036810720 8:11866528-11866550 CAGCTCCTGGAGAAAGGGGCTGG - Intronic
1038684565 8:29704526-29704548 CCTCACATGGCAAAAGGGCAAGG + Intergenic
1041525653 8:58802483-58802505 CATTGCTTGGAGAAAGGGGATGG - Intergenic
1041675541 8:60534833-60534855 CCCCACTTAGAGAATGGGGAAGG - Intronic
1042659674 8:71140849-71140871 CCTCACATGATGAAAGGGGTGGG + Intergenic
1043651033 8:82592386-82592408 CCTCACATGTGGAAAGGGCAAGG + Intergenic
1044184894 8:89239708-89239730 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1044719013 8:95128105-95128127 CCACACCCGGCCAAAGGGGAGGG - Intergenic
1044908184 8:97027923-97027945 CATCACCTGAAGAGAGGTGAGGG + Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045566253 8:103319113-103319135 CCTAAACTGGGGAAAGGGGAAGG + Intronic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1047901158 8:129423467-129423489 CCTCTCCCTGTGAAAGGGGAGGG + Intergenic
1048008080 8:130435151-130435173 CCCCACCTGCGTAAAGGGGATGG - Intronic
1048201080 8:132374251-132374273 CATCACCATGAGAAAGGGGCTGG - Intronic
1049201778 8:141343856-141343878 CCTCACCTGGAAAAGGGGCTTGG + Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049298238 8:141855274-141855296 CCTCACCTTGAGGATGGTGACGG + Intergenic
1049374328 8:142281810-142281832 CCTCACCTGGGGCAAGGGAGGGG - Intronic
1049598062 8:143493474-143493496 CCACACCTGGAGAAGGTGGAAGG + Intronic
1049606404 8:143531297-143531319 CATCCCCAGGAGAAAAGGGAAGG + Intronic
1050005803 9:1128989-1129011 CCTCACATGGAGGAAGGAGAAGG - Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1052495081 9:29214245-29214267 GCTCAGCTGGAGAAAGGGGAGGG + Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1055139886 9:72864449-72864471 CTTCCCCATGAGAAAGGGGAGGG + Intergenic
1055791338 9:79926220-79926242 CCACTTCAGGAGAAAGGGGAAGG + Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056565321 9:87766930-87766952 CATCACCTGGAGGATGGGGGAGG + Intergenic
1056777690 9:89525744-89525766 CTCCACCTGGACAAATGGGAAGG - Intergenic
1057126647 9:92621057-92621079 CTTCACATGGTGAAAGGGGCTGG + Intronic
1057565630 9:96164004-96164026 CCTCACTTGAAGAAAGGGCATGG - Intergenic
1057593096 9:96390968-96390990 GCTAACCAGGAGAAAGAGGAGGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058548910 9:106092273-106092295 CTTCACTTGGCGAAAGGGCAAGG + Intergenic
1058915485 9:109560634-109560656 CCCCACCTGGAGGAAGGGATTGG + Intergenic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1060494916 9:124111538-124111560 GCTCCCCTGGAGGAGGGGGATGG - Intergenic
1061016702 9:127985198-127985220 TCACACCTGGAGAAAGTGGGAGG + Intergenic
1061548163 9:131316666-131316688 CCTCACCTGGGGGAAGGGGAAGG - Intergenic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1062083437 9:134636520-134636542 CCTCACTCACAGAAAGGGGAGGG + Intergenic
1062219826 9:135409215-135409237 CCACCCCAGGAGAAGGGGGAAGG + Intergenic
1062271959 9:135713923-135713945 CCTCACCTGGTGACAGTGGCAGG + Intronic
1062284016 9:135765179-135765201 CCTCACCTGGAGCCGGGGGTGGG - Exonic
1186083695 X:5962779-5962801 CCTCACATGGAAAAAGGGTGAGG - Intronic
1186473027 X:9836069-9836091 GCACACCTGGAGAGCGGGGAGGG + Intronic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187636875 X:21238698-21238720 CTTTGCCTAGAGAAAGGGGAAGG + Intergenic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189025565 X:37390142-37390164 CCTCACATGGCAAAAGGGGATGG + Intronic
1189491696 X:41475280-41475302 CCCCGCCAGGAGAAATGGGACGG - Exonic
1189620802 X:42835223-42835245 ACTCACATAGAGAAAGGGAAGGG + Intergenic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190969720 X:55336794-55336816 CCAGACCTGGAGCTAGGGGATGG - Intergenic
1191251048 X:58260361-58260383 CATCCCCTGGAGGGAGGGGACGG + Intergenic
1191890132 X:65931572-65931594 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1192554961 X:72082028-72082050 CTTCACCTAGAGACAGGGGAAGG - Intergenic
1192694511 X:73400028-73400050 CTCTGCCTGGAGAAAGGGGAGGG + Intergenic
1193164324 X:78264074-78264096 CCCCACCTGGTGAAGAGGGATGG + Intergenic
1194767367 X:97857183-97857205 CCACTCATGAAGAAAGGGGAAGG + Intergenic
1195177609 X:102326307-102326329 CCTCACCTGGAGCATAGTGAAGG - Exonic
1195181255 X:102360786-102360808 CCTCACCTGGAGCATAGTGAAGG + Exonic
1195223145 X:102765754-102765776 CCTCCCCTGAAGTAAGGAGAGGG + Intergenic
1195502151 X:105613746-105613768 CTTTGCCTGCAGAAAGGGGAGGG + Intronic
1196262755 X:113603957-113603979 CTTCACCTGTAGCAAGAGGAGGG + Intergenic
1196558155 X:117115972-117115994 CCTCTTTTGGAGACAGGGGATGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1199637513 X:149827161-149827183 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1199894171 X:152116153-152116175 CCTTGCCAGGAGAAAGGTGAGGG - Intergenic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1201900136 Y:19040679-19040701 CCTCCTCTAGAGGAAGGGGAAGG - Intergenic
1202350058 Y:23980108-23980130 CCTCACTTAGAGGATGGGGATGG + Intergenic
1202520721 Y:25690013-25690035 CCTCACTTAGAGGATGGGGATGG - Intergenic