ID: 1186490596

View in Genome Browser
Species Human (GRCh38)
Location X:9969424-9969446
Sequence GTGTGTGTGCGCGCGTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186490596_1186490603 30 Left 1186490596 X:9969424-9969446 CCAGTGCACGCGCGCACACACAC No data
Right 1186490603 X:9969477-9969499 TTTTTTTTTTCCCTGAGGCAGGG No data
1186490596_1186490602 29 Left 1186490596 X:9969424-9969446 CCAGTGCACGCGCGCACACACAC No data
Right 1186490602 X:9969476-9969498 TTTTTTTTTTTCCCTGAGGCAGG No data
1186490596_1186490601 25 Left 1186490596 X:9969424-9969446 CCAGTGCACGCGCGCACACACAC No data
Right 1186490601 X:9969472-9969494 TTTTTTTTTTTTTTTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186490596 Original CRISPR GTGTGTGTGCGCGCGTGCAC TGG (reversed) Intergenic