ID: 1186493416

View in Genome Browser
Species Human (GRCh38)
Location X:9992878-9992900
Sequence GCCTGGCTCCCTGGCCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186493416_1186493425 17 Left 1186493416 X:9992878-9992900 CCGGGGAGGCCAGGGAGCCAGGC No data
Right 1186493425 X:9992918-9992940 GCTGCCGCCTCAGCGGTGGCCGG No data
1186493416_1186493429 26 Left 1186493416 X:9992878-9992900 CCGGGGAGGCCAGGGAGCCAGGC No data
Right 1186493429 X:9992927-9992949 TCAGCGGTGGCCGGGAGAACAGG No data
1186493416_1186493423 13 Left 1186493416 X:9992878-9992900 CCGGGGAGGCCAGGGAGCCAGGC No data
Right 1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG No data
1186493416_1186493421 10 Left 1186493416 X:9992878-9992900 CCGGGGAGGCCAGGGAGCCAGGC No data
Right 1186493421 X:9992911-9992933 GAGCCCTGCTGCCGCCTCAGCGG No data
1186493416_1186493426 18 Left 1186493416 X:9992878-9992900 CCGGGGAGGCCAGGGAGCCAGGC No data
Right 1186493426 X:9992919-9992941 CTGCCGCCTCAGCGGTGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186493416 Original CRISPR GCCTGGCTCCCTGGCCTCCC CGG (reversed) Intergenic
No off target data available for this crispr