ID: 1186493419

View in Genome Browser
Species Human (GRCh38)
Location X:9992895-9992917
Sequence AGGGCTCAGCCAGGACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186493419_1186493429 9 Left 1186493419 X:9992895-9992917 CCAGGCTGTCCTGGCTGAGCCCT No data
Right 1186493429 X:9992927-9992949 TCAGCGGTGGCCGGGAGAACAGG No data
1186493419_1186493423 -4 Left 1186493419 X:9992895-9992917 CCAGGCTGTCCTGGCTGAGCCCT No data
Right 1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG No data
1186493419_1186493421 -7 Left 1186493419 X:9992895-9992917 CCAGGCTGTCCTGGCTGAGCCCT No data
Right 1186493421 X:9992911-9992933 GAGCCCTGCTGCCGCCTCAGCGG No data
1186493419_1186493426 1 Left 1186493419 X:9992895-9992917 CCAGGCTGTCCTGGCTGAGCCCT No data
Right 1186493426 X:9992919-9992941 CTGCCGCCTCAGCGGTGGCCGGG No data
1186493419_1186493425 0 Left 1186493419 X:9992895-9992917 CCAGGCTGTCCTGGCTGAGCCCT No data
Right 1186493425 X:9992918-9992940 GCTGCCGCCTCAGCGGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186493419 Original CRISPR AGGGCTCAGCCAGGACAGCC TGG (reversed) Intergenic
No off target data available for this crispr