ID: 1186493423

View in Genome Browser
Species Human (GRCh38)
Location X:9992914-9992936
Sequence CCCTGCTGCCGCCTCAGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186493419_1186493423 -4 Left 1186493419 X:9992895-9992917 CCAGGCTGTCCTGGCTGAGCCCT No data
Right 1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG No data
1186493416_1186493423 13 Left 1186493416 X:9992878-9992900 CCGGGGAGGCCAGGGAGCCAGGC No data
Right 1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG No data
1186493418_1186493423 4 Left 1186493418 X:9992887-9992909 CCAGGGAGCCAGGCTGTCCTGGC No data
Right 1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG No data
1186493412_1186493423 23 Left 1186493412 X:9992868-9992890 CCGGGGCAGTCCGGGGAGGCCAG No data
Right 1186493423 X:9992914-9992936 CCCTGCTGCCGCCTCAGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186493423 Original CRISPR CCCTGCTGCCGCCTCAGCGG TGG Intergenic
No off target data available for this crispr