ID: 1186496555

View in Genome Browser
Species Human (GRCh38)
Location X:10015918-10015940
Sequence CAGCGCATCCGCGGTGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186496555_1186496563 2 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496563 X:10015943-10015965 GACACGCCCCGCCCAGCGCGGGG 0: 1
1: 0
2: 0
3: 8
4: 108
1186496555_1186496569 22 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496569 X:10015963-10015985 GGGCCGCCGCCGAGAGCCCCCGG 0: 1
1: 0
2: 0
3: 35
4: 231
1186496555_1186496573 28 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496573 X:10015969-10015991 CCGCCGAGAGCCCCCGGGCCCGG 0: 1
1: 0
2: 0
3: 40
4: 1288
1186496555_1186496574 29 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496574 X:10015970-10015992 CGCCGAGAGCCCCCGGGCCCGGG 0: 1
1: 0
2: 2
3: 21
4: 288
1186496555_1186496562 1 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496562 X:10015942-10015964 GGACACGCCCCGCCCAGCGCGGG 0: 1
1: 0
2: 1
3: 8
4: 147
1186496555_1186496561 0 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496561 X:10015941-10015963 GGGACACGCCCCGCCCAGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 122
1186496555_1186496570 23 Left 1186496555 X:10015918-10015940 CCGGCGCCACCGCGGATGCGCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1186496570 X:10015964-10015986 GGCCGCCGCCGAGAGCCCCCGGG 0: 1
1: 0
2: 1
3: 24
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186496555 Original CRISPR CAGCGCATCCGCGGTGGCGC CGG (reversed) Intronic
902471203 1:16648360-16648382 CAGCGGACCCGCGCTGGCACTGG - Intergenic
903652863 1:24931909-24931931 CAGCGCGTCCGAGGGCGCGCGGG - Intronic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
1064418201 10:15168603-15168625 CAGCGCCGCCGCGATGGCGGAGG - Exonic
1065024312 10:21526348-21526370 CAGCCCTTCCGCGGCGTCGCGGG + Intergenic
1066067762 10:31774692-31774714 CTGAGCATCAGCGGTGGGGCAGG + Intergenic
1075077553 10:119361084-119361106 CAGTGCATCAGCGGAGGAGCTGG - Intronic
1076843254 10:133056899-133056921 CAGCCCTTCCGGGGTGGGGCAGG + Intergenic
1094838694 12:34334097-34334119 CAGCGCATGCGCGGGGGCCAGGG + Intergenic
1101803405 12:108042404-108042426 CAGGGCATCCCTGGTGGGGCGGG + Intergenic
1104760835 12:131296836-131296858 CAGTCCATGCGCGGTGGAGCTGG - Intergenic
1113820278 13:113208730-113208752 CTGCGCACCCGCGGCGGGGCCGG - Intronic
1114194000 14:20461267-20461289 GAGCCCATCGACGGTGGCGCGGG - Exonic
1118220972 14:63853770-63853792 TAGCGCCTCCGCGGGGGCGGGGG + Intronic
1120979687 14:90278956-90278978 CCGAGCATCCCCGGTGCCGCGGG + Intronic
1122473209 14:101986347-101986369 CAGCGCAACCTCGGTGTCTCGGG + Exonic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1131012680 15:89031791-89031813 CAGCGGATCCGGGGAGGCTCAGG + Intergenic
1132808288 16:1785879-1785901 CATGGCCTCAGCGGTGGCGCCGG + Intronic
1133276423 16:4640874-4640896 AAGCTCATCAGCGGTGGAGCTGG - Intronic
1134482311 16:14630285-14630307 CAGCGCCTGCGCGGCGGCGGGGG + Intronic
1134608337 16:15588645-15588667 CTGGGCATATGCGGTGGCGCGGG + Intronic
1137057665 16:35753267-35753289 CTGTGCCTCCGCGGTGGCCCTGG + Intergenic
1139615362 16:68085379-68085401 GAGCGCACCCGCGGCGGCGGTGG + Intronic
1139716255 16:68815606-68815628 CAGCACATCCACGGTGACGGTGG - Exonic
1148095700 17:45051554-45051576 CAGCGCCTCCGCCGTGGCCCAGG + Intronic
1153402053 18:4692020-4692042 CAGCGGGTCTGCGGTGGCGGCGG - Intergenic
1160583288 18:79899773-79899795 CAGCGCATCCGCGGAGTCGTCGG - Exonic
1160668440 19:344519-344541 GTGCGCATGCGCGGCGGCGCGGG - Intronic
1160897316 19:1408674-1408696 CAGCGCTTCCGAGGCGGCGACGG + Intronic
1161446744 19:4322974-4322996 CAGCGTGTCCCCTGTGGCGCAGG - Exonic
1161511928 19:4676735-4676757 CAGGGCATCCGGGAAGGCGCAGG + Intronic
1162030920 19:7916928-7916950 CCGCGCACCCGCGATGGCGGCGG - Exonic
1162850445 19:13427168-13427190 CAGGGCATGCGTGGTGGCTCAGG + Intronic
1163681193 19:18683620-18683642 CGGCGCTTGCGCGGTGGCACGGG + Intergenic
927216624 2:20671063-20671085 CAGGGCAGCGGCGGGGGCGCGGG + Exonic
936954992 2:118014156-118014178 CAGAGCATGCGCGCTGGGGCCGG + Intergenic
948024344 2:234765023-234765045 CAGGGCATCCGCAGTTGTGCTGG + Intergenic
948248695 2:236507640-236507662 CAGGCCTCCCGCGGTGGCGCAGG - Intergenic
1175824786 20:61930989-61931011 GAGGGCATCCGCAGTGGGGCCGG + Intronic
1178953979 21:37006888-37006910 CAGCGCGTCCACCGGGGCGCGGG - Intronic
1181435551 22:22908349-22908371 CAGCACATCAGCGGTGTGGCAGG + Intergenic
1185291620 22:50030403-50030425 CAGCGCACCGCCGGCGGCGCAGG + Intronic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
950706492 3:14785700-14785722 CAGCCCATCTGTGGTGGAGCAGG + Intergenic
950867490 3:16200727-16200749 GAGCACATCCCCGGTGGCTCTGG - Exonic
955081981 3:55666160-55666182 GAGCTCATCAGCGGTGGAGCGGG + Intronic
958624731 3:96609619-96609641 CACCGCATCTGCGGTGGGGAAGG - Intergenic
960605468 3:119499695-119499717 CAGTCCAGCCGCGGTGGCTCAGG - Intronic
965515706 3:169619220-169619242 CAGCGCATCCCCAGTCGGGCTGG + Intronic
968498556 4:932428-932450 CAGCGCGTGCGCGGCGTCGCCGG + Exonic
983649845 4:170026683-170026705 CAGGGCCTCCGCGGCAGCGCGGG + Intronic
983918727 4:173321141-173321163 CAGGGCATCTGCAGTGGCGATGG + Intronic
987108731 5:14664976-14664998 CAGTGAGTCCGCGGGGGCGCGGG + Exonic
991436087 5:66597585-66597607 CCGCGCTCCCTCGGTGGCGCTGG + Intronic
996738415 5:126777524-126777546 CTGCCCATCCGCGGCGGCACGGG - Exonic
999328278 5:150656764-150656786 GAGCGCATGCGCGGGGGCGGGGG - Intronic
1000408837 5:160917211-160917233 CAGCACATCAGAGGTGGAGCTGG + Intergenic
1006579270 6:35067257-35067279 CAGGGCATCTGCTGTGGGGCTGG - Intronic
1018613006 6:165662029-165662051 CAGCGCGGCCGCGGCGGCGAGGG + Exonic
1033253240 7:139777929-139777951 GAGCGGATCCGCGGAGGGGCGGG + Intronic
1034347871 7:150398108-150398130 CAGCGGACCCGTGGTGGTGCGGG + Exonic
1034968719 7:155406719-155406741 CAGCTCACCCGCGGTAGAGCTGG + Intergenic
1035432153 7:158829984-158830006 GAGCGCAGCCGGGGTGGCGGTGG + Intronic
1049694086 8:143975230-143975252 CGGCGCAGCGGGGGTGGCGCTGG - Intronic
1060263231 9:122093448-122093470 CAGCGCATCCGCGGGGTGGGCGG - Exonic
1061128244 9:128689842-128689864 CAGCGCGGCCGCCGCGGCGCGGG - Intronic
1061859353 9:133460213-133460235 GAGCGCATGCGCGGCGGGGCCGG - Intronic
1186496555 X:10015918-10015940 CAGCGCATCCGCGGTGGCGCCGG - Intronic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic