ID: 1186496576

View in Genome Browser
Species Human (GRCh38)
Location X:10015979-10016001
Sequence CGAGCTCTGCCCGGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 382}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186496576_1186496585 3 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496585 X:10016005-10016027 CGCCTCCATCCCCGGAACCAGGG 0: 1
1: 0
2: 1
3: 11
4: 134
1186496576_1186496594 23 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496594 X:10016025-10016047 GGGGACTCCCTGGAGTGCTCCGG 0: 1
1: 0
2: 0
3: 21
4: 329
1186496576_1186496583 -5 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496583 X:10015997-10016019 GCTCGGAGCGCCTCCATCCCCGG 0: 1
1: 0
2: 1
3: 7
4: 110
1186496576_1186496591 13 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496591 X:10016015-10016037 CCCGGAACCAGGGGACTCCCTGG 0: 1
1: 0
2: 1
3: 18
4: 173
1186496576_1186496586 4 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496586 X:10016006-10016028 GCCTCCATCCCCGGAACCAGGGG 0: 1
1: 0
2: 3
3: 12
4: 156
1186496576_1186496595 29 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496595 X:10016031-10016053 TCCCTGGAGTGCTCCGGTCCAGG 0: 1
1: 0
2: 1
3: 15
4: 140
1186496576_1186496584 2 Left 1186496576 X:10015979-10016001 CCCCCGGGCCCGGGCAGAGCTCG 0: 1
1: 0
2: 1
3: 27
4: 382
Right 1186496584 X:10016004-10016026 GCGCCTCCATCCCCGGAACCAGG 0: 1
1: 0
2: 0
3: 14
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186496576 Original CRISPR CGAGCTCTGCCCGGGCCCGG GGG (reversed) Intronic
900373582 1:2343405-2343427 CCAGCCCTGCCGGGGCCAGGCGG + Intronic
900375945 1:2354838-2354860 CGAGCTCTGCCTGGGCCTCACGG - Intronic
901120913 1:6892991-6893013 AGAGCTGTGGCCGGGCGCGGTGG + Intronic
901495794 1:9620916-9620938 AGAGATCTGACCGGGCACGGTGG - Intergenic
901669731 1:10849257-10849279 GGAGCTCTGCCTGGTCCGGGTGG - Intergenic
901729337 1:11267576-11267598 CCAGCTCAGGCCGGGCACGGTGG - Intergenic
902089680 1:13893216-13893238 AGAGCGCTGCCCAGGCCCCGCGG - Intergenic
902451365 1:16498937-16498959 CGAGGCCTGCCCGGGCGCAGAGG - Intergenic
902592011 1:17481941-17481963 CCAGGTCTGGACGGGCCCGGTGG - Intergenic
902612193 1:17603768-17603790 CAAGCCCTGCCCGGCCCCGGTGG - Intronic
903735761 1:25529046-25529068 GGAGCCCTGCCCTGGCCTGGGGG + Intergenic
904006633 1:27366476-27366498 CGCGCGCAGCCCCGGCCCGGGGG + Exonic
904081911 1:27877612-27877634 TGAGCTCTGGCCGGGCATGGTGG - Intronic
904223578 1:28994456-28994478 CTTGCTCTGGCCGGGCGCGGTGG - Intronic
904631002 1:31842290-31842312 CCAGCTCCGGCCGGGCGCGGTGG - Intergenic
904703698 1:32374863-32374885 GGAGCTCAGGCCGGGCACGGTGG + Intronic
904730343 1:32586028-32586050 CGATTTCTGGCCGGGCACGGTGG + Intronic
905362678 1:37431243-37431265 GGAGCTGTGCCCTGGCCAGGTGG + Intergenic
905452883 1:38068364-38068386 CGAGCTCTGCCCCGATCAGGCGG - Intergenic
905874954 1:41426693-41426715 CGGGCTGTCCCCGGGCCTGGTGG + Intergenic
905980914 1:42226322-42226344 CTAGCTCTGGCCGGGCACGGCGG + Intronic
906056920 1:42924762-42924784 CGAGCCCCGCCCCGGCCCAGAGG - Intergenic
906449574 1:45933450-45933472 AGAACTCTGGCCGGGCACGGTGG + Intronic
907369481 1:53991688-53991710 CGAGTTTTGCTCGGGCCCGCTGG + Intergenic
910936142 1:92485574-92485596 CGCGCTCGGCCCAGGCCCCGGGG - Intronic
911527480 1:99004497-99004519 CAAACCCTACCCGGGCCCGGAGG - Exonic
912381321 1:109249661-109249683 CGACCCCGGCCCGGCCCCGGCGG - Intergenic
913146132 1:115992087-115992109 GGAGCTCTGCCAGGTCCCAGTGG - Exonic
914813562 1:151047245-151047267 AGAGCTCTGGCCGAGCGCGGTGG - Exonic
915569125 1:156734419-156734441 GGAGCTCGGGCCGGGCCCGTCGG - Exonic
916103383 1:161412106-161412128 CAAGCTCTGACCAGGCGCGGTGG + Intergenic
916961424 1:169893636-169893658 CGAGCTCGGCGCGGCGCCGGCGG - Intronic
916973224 1:170047331-170047353 TGAGATCTGGCCGGGCACGGTGG + Intronic
918064465 1:181089804-181089826 GCAGATCTGCCCGGGCTCGGCGG - Exonic
919377175 1:196808994-196809016 CGAGCTCTGCGCTGGCCTGCTGG - Intergenic
919485952 1:198147190-198147212 TGAATTCTGGCCGGGCCCGGTGG - Intergenic
919836951 1:201581539-201581561 AGAGCTCCGGCCGGGCGCGGTGG + Intergenic
919852818 1:201684987-201685009 CCAGTTCTGGCCGGGCGCGGTGG + Intronic
921072992 1:211677455-211677477 AGAGCCCTGGCCGGGCACGGTGG + Intergenic
921963221 1:221058301-221058323 AAAGCTCTGGCCGGGCACGGTGG - Intergenic
922287860 1:224184801-224184823 CGTGCTCTGGCCGGGCACGGTGG - Intronic
922490246 1:226010657-226010679 TGAGCTCTGGCCGGGCATGGTGG - Intergenic
922513196 1:226186603-226186625 CACGCTCAGCCCGGACCCGGAGG - Exonic
922951253 1:229559642-229559664 CGATCTCAGGCCGGGCACGGTGG - Intergenic
923007923 1:230067092-230067114 CGAGCTCCGCCCCGGGCCGGCGG - Intronic
923293840 1:232573682-232573704 CCTGCTCTGCCCGGGGCTGGGGG - Intergenic
923782949 1:237042267-237042289 GGAGGGCGGCCCGGGCCCGGAGG - Exonic
924042483 1:239997714-239997736 CGGGCTCGGCGCGGGCCGGGAGG - Intergenic
1062990051 10:1806746-1806768 AGAGTTCTGGCCGGGCGCGGTGG + Intergenic
1063217579 10:3938199-3938221 TGAACTCTGCCCGGGACCGCAGG - Intergenic
1063429657 10:5977530-5977552 CGAGCGCTGCCCAGGCCGGGGGG + Exonic
1063712395 10:8492357-8492379 CGAGCACCGGCCGGGCGCGGTGG - Intergenic
1064067795 10:12197662-12197684 CTAGTTCTGGCCGGGCGCGGTGG - Intronic
1064258702 10:13767524-13767546 CCACCTCTGGCCGGGCACGGAGG - Intronic
1065090575 10:22229175-22229197 CCAGCTCTGCGCGTCCCCGGAGG - Intergenic
1066293615 10:34035502-34035524 CCATCACTGCCCGGGGCCGGTGG - Intergenic
1068416046 10:56724131-56724153 GAAGCTCTGGCCGGGCGCGGTGG - Intergenic
1069609896 10:69766114-69766136 CGAGCTCTGCCCGGTGGTGGTGG + Intergenic
1071581242 10:86772415-86772437 CTATCTCTGGCCGGGCGCGGTGG - Intronic
1072202952 10:93177469-93177491 AGAGCTTTGACCGGGCGCGGTGG - Intergenic
1072523992 10:96255222-96255244 CGAGCTCTTCCAGGGCCAAGAGG + Intronic
1074182901 10:111078806-111078828 CGAGCGCAGCGCGGGCCCGGGGG + Exonic
1074892834 10:117749607-117749629 GGAGCACTGGCCGGGCACGGTGG - Intergenic
1077116006 11:884934-884956 CCAGCTCTCCCTGGGCCAGGCGG - Intronic
1077201376 11:1309225-1309247 AAAGCTCTGCCCCGGCACGGCGG + Intronic
1077217414 11:1400747-1400769 CCGGCTCTGCCTGGGCCCTGCGG + Intronic
1077390440 11:2298550-2298572 CCAGTCCTGCCCAGGCCCGGGGG + Intronic
1077417909 11:2433434-2433456 CGAGCGCTGCCCGGGCCCAGTGG + Intergenic
1078546887 11:12253276-12253298 GCAGCTCTGCCTGGGCCCTGGGG - Intronic
1078620062 11:12899048-12899070 CCAGCTCTGACCTGGCCCAGGGG + Intronic
1079040273 11:17053044-17053066 CAAGGTCTGGCCGGGCGCGGTGG + Intergenic
1079243750 11:18738684-18738706 TCACCTCTGCCCGGGCGCGGTGG + Intronic
1079281349 11:19089796-19089818 CAGGCTCTGGCCGGGCGCGGTGG + Intergenic
1080363089 11:31539175-31539197 CTAGTTCTGGCCGGGCGCGGTGG + Intronic
1082805507 11:57446938-57446960 CCAGCCCTGGCCGGGCGCGGTGG - Intergenic
1084696531 11:70758871-70758893 TGAGTTCTGGCCGGGCGCGGTGG + Intronic
1084978026 11:72814066-72814088 CGAACTCGGCCCGGGCGCGGCGG + Intergenic
1087463049 11:98469675-98469697 CAAGCTCTGGCTGGGCGCGGTGG + Intergenic
1089475778 11:118760533-118760555 CGGGTTCTGGCCGGGCGCGGTGG + Intronic
1091827286 12:3522376-3522398 CAAGCTCAGGCCGGGCGCGGTGG + Intronic
1094679862 12:32658507-32658529 AGAGATCTGGCCGGGCGCGGTGG + Intergenic
1095968772 12:47887022-47887044 GGAGCCCTGGCCGGGCGCGGTGG + Intronic
1096848421 12:54420149-54420171 GGAGCTCTGGCCAGGCACGGTGG + Intergenic
1097613147 12:61851487-61851509 AGAGTTCTGGCCGGGCGCGGTGG + Intronic
1097859400 12:64503948-64503970 AGAGCTTTGGCCGGGCGCGGTGG + Intergenic
1101143792 12:101822124-101822146 TAAGCTCTGGCCGGGCGCGGTGG + Intronic
1102269666 12:111522321-111522343 AGAGTTCTGGCCGGGCACGGTGG + Intronic
1102469918 12:113153996-113154018 CTAACTCTGGCCGGGCGCGGTGG + Intronic
1102934512 12:116885147-116885169 CTAACCCTGCCCGGGCCTGGTGG + Intergenic
1103432959 12:120903894-120903916 CAGGCTGTGGCCGGGCCCGGCGG + Exonic
1103600771 12:122053281-122053303 GGAGCCCTGGCCGGGCGCGGCGG - Intronic
1104753768 12:131256207-131256229 CCAGTTCTGGCCGGGCGCGGTGG - Intergenic
1106666161 13:31852836-31852858 GGAACTCTGGCCGGGCACGGTGG + Intergenic
1106743712 13:32676642-32676664 CAAGATCTGGCCGGGCGCGGTGG + Intronic
1107467985 13:40666461-40666483 CAGGCTCTGCCCCGGCCCGGCGG - Exonic
1108075575 13:46675989-46676011 CGAGTTCTGGCCGGGTGCGGTGG + Intronic
1113459682 13:110473057-110473079 GGAGCTCAGCCCGGGCCACGGGG + Exonic
1113656679 13:112072307-112072329 CACGCTCGGCCTGGGCCCGGGGG + Intergenic
1115223694 14:31082607-31082629 AGAGCTTTGGCCGGGCGCGGTGG + Intronic
1115872627 14:37822064-37822086 CTAGCTCTGGCCGGGCACGGTGG - Intronic
1116981425 14:51175151-51175173 TGATCTCTGGCCGGGCACGGTGG + Intergenic
1117853126 14:59996025-59996047 TGTCTTCTGCCCGGGCCCGGTGG - Intronic
1122063731 14:99157505-99157527 GGGGCACTGCCGGGGCCCGGTGG + Intergenic
1122823613 14:104359234-104359256 CCAGCTCTGCCAGGGGCCGAGGG - Intergenic
1122852042 14:104539472-104539494 CGAGTTCTGGCTGGGCGCGGTGG - Intronic
1123436307 15:20257119-20257141 CTTGCTCTGGCCGGGCGCGGTGG - Intergenic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1126827800 15:52568970-52568992 CCAGCTCTCCCAGGGCCCGCCGG + Intronic
1127615138 15:60677168-60677190 TGAGCTCGTCCCTGGCCCGGAGG - Intronic
1127982600 15:64045965-64045987 CGTGCTCTGCCCGTTCCAGGGGG + Intronic
1127995605 15:64151813-64151835 CGGGCTCTGCCTGGGCCCCTCGG - Exonic
1128171762 15:65519628-65519650 AGAACTCTGGCCGGGCGCGGTGG - Intergenic
1129364073 15:75043726-75043748 CCAGCTCTGCCTGGGCCGGGAGG - Intronic
1129524897 15:76207541-76207563 GGAGTTCTGGCCGGGCCCAGTGG - Intronic
1129650645 15:77485644-77485666 CTACCTCTGGCCGGGCACGGTGG + Intergenic
1131167888 15:90155788-90155810 CCAGCTCTGGCCAGGCGCGGTGG - Intergenic
1131827219 15:96331355-96331377 GGAGCGCTGCCCGGGTCCGGGGG - Exonic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132555505 16:570224-570246 CCAGGTCGGCGCGGGCCCGGGGG - Intronic
1132728997 16:1351548-1351570 CGAGGGCGGCCCGGGCCCGGCGG - Exonic
1132845940 16:2000960-2000982 GCAGCTCTGCCCGGGCTAGGAGG - Intronic
1132925849 16:2428904-2428926 CGTGCCCTGCCCGGGTCCCGGGG - Intergenic
1133098316 16:3463258-3463280 CAAGCTGAGGCCGGGCCCGGTGG + Intronic
1133251008 16:4480939-4480961 CGAGGCCTGGCCGGGCGCGGTGG - Intronic
1133801956 16:9091804-9091826 CGACCTTCGGCCGGGCCCGGGGG + Exonic
1134018794 16:10907451-10907473 CCAGCTCTGCCAGGGCCCCGGGG - Exonic
1134126389 16:11619021-11619043 CCAGCACTGCCCGGGCACGGTGG + Intronic
1134542998 16:15084001-15084023 CCAGTTCTGGCCGGGCGCGGTGG - Intronic
1135360589 16:21810134-21810156 CCAGTTCTGGCCGGGCGCGGTGG - Intergenic
1136225550 16:28858024-28858046 AGAACTCTGGCCGGGCGCGGTGG - Intronic
1136262235 16:29086893-29086915 CCAGTTCTGGCCGGGCGCGGTGG + Intergenic
1137300359 16:47143400-47143422 CGAGCCCTGCCCGGCTCCGCCGG - Intronic
1137873236 16:51970812-51970834 CCAGCTCAGGCCGGGCGCGGTGG - Intergenic
1138190865 16:55012966-55012988 CTAGCACGGCCCGGGCCCAGTGG - Intergenic
1139651208 16:68363163-68363185 CGACCTGTGGCCTGGCCCGGGGG + Intronic
1139853793 16:69965475-69965497 CGCGCGCTGCCCGAGGCCGGGGG + Intergenic
1139893398 16:70269034-70269056 CCACCTCTGGCCGGGCACGGTGG + Intronic
1140228661 16:73099421-73099443 TGAGCTCTGGCCGGGCACAGTGG + Intergenic
1142338753 16:89507603-89507625 GGGACCCTGCCCGGGCCCGGAGG + Intronic
1142657046 17:1400991-1401013 CGGGCCCTGGCCGGGCGCGGCGG + Intergenic
1142688556 17:1591579-1591601 TGAGCCCTTCCCGGGGCCGGAGG - Exonic
1142710989 17:1724075-1724097 CCAGTTCTGGCCGGGCGCGGTGG + Intronic
1142711077 17:1724516-1724538 CCAGCTCCAGCCGGGCCCGGCGG - Intronic
1143465867 17:7135866-7135888 AGAGTTCTGGCCGGGCGCGGTGG + Intergenic
1143897405 17:10146695-10146717 AGATCTCTGGCCGGGCGCGGTGG + Intronic
1144269185 17:13601101-13601123 AGGGCACTGGCCGGGCCCGGAGG + Exonic
1144346796 17:14356691-14356713 TGAGGGCTGGCCGGGCCCGGTGG + Intergenic
1144579395 17:16449902-16449924 TGAGCTCAGCCTGGGCGCGGTGG - Intronic
1144584548 17:16480340-16480362 AGACCGCTGCCCGGGCACGGTGG + Intronic
1144678071 17:17174547-17174569 CTTGCTCTGTCCGGGCGCGGTGG + Intronic
1145787823 17:27605498-27605520 CGAGCTCTCGCCGGCCCTGGCGG + Exonic
1146372476 17:32274021-32274043 CGAGGTCTGGCCAGGCACGGTGG - Intronic
1147015128 17:37485638-37485660 TGAGCTCAGGCCGGGCGCGGTGG - Intergenic
1147147764 17:38495518-38495540 CAAGCTCTGGCCGGGCACAGTGG - Intronic
1147440368 17:40443773-40443795 CAGGCTCGGCCCGGGCCCGGCGG - Exonic
1147736485 17:42641989-42642011 CTAGCTCTGGCCGGGCATGGTGG + Intergenic
1147798178 17:43060836-43060858 CAAGCTCTGGCCGGGCACAGTGG + Intronic
1147921795 17:43921794-43921816 GTAGCTCTGGCCGGGCACGGTGG + Intergenic
1147971166 17:44219713-44219735 CGAGCTGAGGCCGGGGCCGGCGG - Intronic
1148733370 17:49851228-49851250 CCAGCTCCGCCCGGTCCCCGCGG + Intergenic
1149827161 17:59839276-59839298 AGTGCTCTGGCCGGGCGCGGTGG - Intronic
1150416829 17:64994998-64995020 CAAGCTCTGACGGGGCCAGGAGG + Intergenic
1151426976 17:74037362-74037384 CGAGCCCTGCCCAGGCCCCTGGG - Intergenic
1151461277 17:74255722-74255744 ACAGCTCTGGCCGGGCACGGTGG - Intronic
1151818508 17:76483972-76483994 CCAGCTGTGGCCGGGCGCGGTGG + Intronic
1151911884 17:77088845-77088867 AGAGCTCTGCCGGGGGCTGGAGG + Exonic
1152097826 17:78282165-78282187 CGAGATCAGGCCGGGCACGGTGG + Intergenic
1152286001 17:79413733-79413755 CGAGCTCTTCCTGGACCCTGTGG - Intronic
1152556049 17:81053842-81053864 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556064 17:81053890-81053912 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556107 17:81054033-81054055 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556149 17:81054176-81054198 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152556192 17:81054319-81054341 AGAACTGTGCCCGGGCCCCGTGG + Intronic
1152570720 17:81120162-81120184 CGGGGTCTGCCCGGGGCTGGGGG - Intronic
1152727731 17:81955921-81955943 TGAGCTCTGCCTGGGGTCGGGGG - Intronic
1152748528 17:82052012-82052034 CGACCTCAGCCCGGCCCCAGTGG - Exonic
1153182062 18:2446169-2446191 CAAGCTCTGACCGGGCGTGGTGG - Intergenic
1153193063 18:2564114-2564136 CTAGTTCTGGCCGGGCACGGTGG + Intronic
1154173487 18:12067384-12067406 CCCGCTCGGCCCTGGCCCGGAGG - Intergenic
1160164096 18:76495255-76495277 CCAGCTGCGCCCGGGCGCGGGGG + Intergenic
1160712941 19:561351-561373 TGAGGTCAGCCCGGGCGCGGTGG + Intergenic
1160772255 19:837847-837869 AGAGCTGTGGCCGGGCGCGGTGG - Intergenic
1160863949 19:1249180-1249202 CGGGTTCTGCCCGCGGCCGGCGG + Intronic
1160987493 19:1845903-1845925 CCAGCCCTGCCCTGGCCAGGTGG + Intronic
1161007927 19:1945532-1945554 CCAGCTCTGGCCGGGCGCGGGGG + Intronic
1161022171 19:2015634-2015656 CGGGGTCGGCCCGGGCACGGGGG - Exonic
1161163222 19:2772050-2772072 CGGGCTGGGCCCGGCCCCGGAGG - Intronic
1161356484 19:3822025-3822047 CGGGCTGTGCTAGGGCCCGGCGG - Intronic
1161424050 19:4192496-4192518 CGAGGCCTGGCCGGGCGCGGTGG - Intronic
1161696056 19:5768876-5768898 AGAGTTATGGCCGGGCCCGGTGG + Intronic
1161957725 19:7505905-7505927 CGAGAGGTCCCCGGGCCCGGGGG - Intronic
1162317225 19:9946903-9946925 CCAGCTCTGGCCAGGCGCGGTGG + Intergenic
1162919688 19:13893249-13893271 GGAGATCTGCCCGGGTGCGGTGG + Intronic
1163282394 19:16325587-16325609 CGAGGGCGCCCCGGGCCCGGCGG + Exonic
1163445866 19:17346211-17346233 CCACCTCTGGCCGGGCGCGGTGG - Intergenic
1163634847 19:18433137-18433159 CCCGCTCGGCCCTGGCCCGGAGG + Exonic
1163668212 19:18612904-18612926 CCAGCTCAGGCCGGGCACGGAGG - Exonic
1165527447 19:36368179-36368201 CAAGCTCTGGCCGGGCACGGTGG + Intronic
1166235244 19:41450963-41450985 TGAGCTTTGGCCGGGCGCGGTGG + Intergenic
1166393139 19:42421245-42421267 GGAGCTCAGCCAGGGCCAGGAGG - Intronic
1167388181 19:49177004-49177026 TGAGTTGTGCCCGGTCCCGGTGG + Intronic
1167647616 19:50714133-50714155 CCAGCTCTGTCCTGGCCCTGAGG + Intronic
1168111063 19:54191474-54191496 CGAGTTCTGGCGGGGCCCGCGGG - Exonic
925367553 2:3321111-3321133 AGAGCTCTCCCTGGGCCGGGAGG - Intronic
926118472 2:10228046-10228068 GCAGCTCTGGCCGGGCACGGTGG - Intergenic
926168382 2:10535732-10535754 CGAGCACTGCCTGGACCTGGTGG - Intergenic
926761338 2:16281469-16281491 CGGGCTATGGCCGGGCGCGGTGG - Intergenic
926907132 2:17816439-17816461 AGAGCTCTTCCCTGGCCAGGCGG + Intergenic
927595363 2:24392181-24392203 GGAGTTCTGGCCGGGGCCGGTGG + Intergenic
927652210 2:24919797-24919819 CGCGCTCCGGCCGGGCCCCGAGG - Exonic
927714028 2:25341391-25341413 CGGGCTCTGCCCCAGCCCCGCGG - Intronic
927800584 2:26095318-26095340 CAAGCTCAGGCCGGGCGCGGTGG + Intronic
928369604 2:30731563-30731585 CGAGCTCTGCACGGGGCGAGTGG + Intronic
928554381 2:32408253-32408275 CCAGGTCTGGCCGGGCACGGTGG - Intronic
930096461 2:47570346-47570368 CGAGCGCCGCCCCGGCCCCGGGG - Exonic
931882512 2:66581964-66581986 CGCGCTGTGCCCGGGTCAGGGGG + Intergenic
932700959 2:73991294-73991316 CAAACTCTGGCCGGGCACGGTGG + Intronic
933548739 2:83746947-83746969 TGAGTTCTGGCCGGGCCCGGTGG - Intergenic
933728140 2:85437879-85437901 CGGGCTCTGGCAGGGCCGGGAGG + Intergenic
933847460 2:86337411-86337433 CGCGCGCAGCCCGGGGCCGGGGG + Intronic
934749173 2:96781264-96781286 CGAGATCAGGCCGGGCACGGTGG - Intronic
936938210 2:117858683-117858705 CCCGCTCTGCCCCGGCCAGGGGG - Intergenic
937333699 2:121047565-121047587 GGAGCTCTGCCCAGGACCGGGGG + Intergenic
938909362 2:135872156-135872178 TCAGCTCTGGCCGGGCACGGTGG + Intronic
938967297 2:136399798-136399820 CCAGTTCTGGCCGGGCACGGTGG - Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
940490347 2:154351394-154351416 AGAGCTCTGGCCGGGCAAGGTGG + Intronic
940640870 2:156342762-156342784 CGAGTGCTGCCGGGGCCCCGGGG + Intergenic
942278241 2:174337650-174337672 CGCGCCCAGCCCGGGCCCTGGGG - Exonic
945988222 2:216371642-216371664 GCAGCGCTGCCCGGGCGCGGGGG - Exonic
946231286 2:218292513-218292535 CTAGCCCTGCCCGGCCCCGGAGG - Intronic
947417865 2:229917091-229917113 CAAGCACTGGCCGGGCGCGGTGG + Intronic
947734643 2:232448282-232448304 CCAGCTCTGCCCAGGCCCCAAGG - Intergenic
948588699 2:239036388-239036410 CCAGCTCCGCCTGGGCCCAGCGG + Intergenic
1168802933 20:654886-654908 CCAGTTCTGGCTGGGCCCGGTGG + Intronic
1168948330 20:1779698-1779720 GGGGCTCTGCCAGGGCCCTGTGG + Intergenic
1169114036 20:3051292-3051314 AGAGCTGTGGCCGGGCGCGGTGG + Intergenic
1169630924 20:7630499-7630521 AGAGATCTGGCCGGGCACGGTGG + Intergenic
1172246250 20:33446983-33447005 CAAGCTCTGGCCAGGCGCGGTGG + Intergenic
1174475961 20:50795508-50795530 CGAGCGGTGCCCGGGCCGAGCGG + Intronic
1175191187 20:57213087-57213109 CGAGCTCTGTCTGGGGCAGGAGG - Intronic
1175772025 20:61629991-61630013 CCACCTCTGCCCGGGCTCCGAGG + Intronic
1175844920 20:62053111-62053133 GCAGCTCTGCCTGGGCCCGAAGG - Intronic
1175866683 20:62182574-62182596 CGAACTCTGCCCGGGAGCCGAGG - Intergenic
1175882699 20:62270071-62270093 CGCGCTCTGCCTGGGCCGCGAGG - Intronic
1176111672 20:63413746-63413768 CCTGCTCTGCCCGGGACAGGTGG + Intronic
1177808588 21:25900712-25900734 TGAGCTCTGGCCGGGCACAGTGG + Intronic
1180057081 21:45364616-45364638 TGAGCTCAGCCCGGGACCTGGGG + Intergenic
1180218712 21:46344359-46344381 GGAGCTCGGGCCGGGCGCGGTGG - Intronic
1180843650 22:18970467-18970489 CGAGCCCCGCCCGAGCCGGGCGG + Intergenic
1180961897 22:19766042-19766064 CGCGCTCTACCCCGGGCCGGCGG + Intronic
1181424189 22:22822448-22822470 CGAGGTGTGCCCAGGCCTGGAGG + Intronic
1181539721 22:23566719-23566741 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1182116680 22:27760683-27760705 CGGGCTCTGCGTGGCCCCGGTGG - Intronic
1182237632 22:28888828-28888850 CCAGGTCTGGCCGGGCGCGGTGG + Intronic
1182480989 22:30608675-30608697 GGAGTTCTGGCCGGGCACGGTGG - Intronic
1182763503 22:32741984-32742006 CAAGCCCTGGCCGGGCGCGGTGG + Intronic
1183280495 22:36929573-36929595 CCAGCTCTGCCCCAGCCCGAAGG + Intronic
1183558653 22:38552146-38552168 GGAGTTCTGGCCGGGCCCGGTGG - Intronic
1183658555 22:39205248-39205270 TGAGCTCTGGCCGGGCGCAGTGG - Intergenic
1183859366 22:40658320-40658342 CCAGCTTTGGCCGGGCGCGGTGG - Intergenic
1184322655 22:43754354-43754376 CCAGGTCTGCCCGGGTCCCGGGG + Intronic
1184534600 22:45077896-45077918 CCAGCTCTGCCCTGGACCAGCGG + Intergenic
1184869280 22:47225064-47225086 CGAGTTTTGCTCGGGCCCGCTGG + Intergenic
1185013995 22:48333065-48333087 CAAGCTCTGGCCAGGCCTGGAGG - Intergenic
950040200 3:9915244-9915266 CGCGCTGGGCCCGGGCCTGGTGG - Exonic
950461176 3:13123000-13123022 CCAGCTCTGCCCTGGGCCTGTGG - Intergenic
952364867 3:32665321-32665343 AGGGCTCTGGCCGGGCCCGGTGG + Intergenic
952717377 3:36493861-36493883 CCACCTCTGGCCGGGCGCGGTGG + Intronic
952788210 3:37176464-37176486 CGAGCTGAGCCCTGGGCCGGCGG + Intronic
953954723 3:47222620-47222642 CAATCTCTGGCCGGGCACGGTGG - Intergenic
954423174 3:50429463-50429485 TGAACTCTGGCCGGGCGCGGTGG + Intronic
956139462 3:66131006-66131028 CCAGCTATGGCCGGGCGCGGTGG - Intergenic
957193562 3:77039934-77039956 AGAGCCCAGCCCGGGCGCGGCGG - Intronic
959648368 3:108727570-108727592 AGAGCTATGGCCGGGCACGGTGG + Intergenic
959658367 3:108836203-108836225 CTAACTCTGGCCGGGCACGGTGG - Intronic
959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG + Intronic
961312719 3:126013989-126014011 CAAGCTCTGCCCGGGCCAGATGG + Intronic
961684230 3:128618236-128618258 CGAGCTCTGGCCTGAGCCGGGGG - Intergenic
961780240 3:129316665-129316687 CGAGCCTTGTCCCGGCCCGGGGG + Intergenic
962511623 3:136106632-136106654 AAAGCTCTGGCCGGGCACGGTGG + Intronic
963719795 3:148849309-148849331 AGAGGTCTGGCCGGGCGCGGTGG - Intronic
964107665 3:153056397-153056419 AGAGCTTTGGCCGGGCACGGTGG + Intergenic
964771173 3:160225619-160225641 CGAGGTCTGCGCGGGCCATGTGG + Exonic
967357366 3:188587054-188587076 GGCGCTCTGGCCGGGCGCGGTGG + Intronic
968148823 3:196321269-196321291 CAGGCTCTGGCCGGGCACGGTGG - Intronic
968835910 4:2963977-2963999 CGAGCTATGCACGGGGGCGGCGG + Exonic
969292919 4:6252227-6252249 GGAGCTCTGCCTGGGGCAGGAGG - Intergenic
969691581 4:8706909-8706931 CCAGCCCCGCCGGGGCCCGGGGG + Intergenic
970616238 4:17770751-17770773 CTAGTTCTGGCCGGGCGCGGTGG - Intronic
971966740 4:33568667-33568689 AGTGCTCTGGCCGGGCGCGGTGG + Intergenic
972543125 4:40056643-40056665 CGAGCTCCGCCTCGGCGCGGCGG - Intergenic
972607864 4:40630413-40630435 GGAGCTCTCCCCGGGCACGCGGG - Intronic
973919735 4:55673115-55673137 CTAGATCTGCCCAGGCCCTGAGG - Intergenic
976410014 4:84702807-84702829 TGAGTTCTGGCCGGGCGCGGCGG + Intronic
977795434 4:101159186-101159208 CGAGCTCTTCTTGGGCCCTGCGG - Intronic
978825277 4:113015143-113015165 AAAGCTCTGGCCGGGCGCGGTGG - Intronic
978837031 4:113163475-113163497 CAAGCTTTGGCCGGGCACGGTGG + Intronic
980054956 4:128070371-128070393 TGAGGACTGCCCGGGCACGGTGG + Intronic
980911588 4:138999186-138999208 CCAGATCTGGCCGGGCACGGTGG - Intergenic
981271054 4:142847101-142847123 CGACCTCTGCCCGGGGCAAGGGG - Intronic
982234872 4:153242987-153243009 AGAGAGCTGCCCGGGCCCTGGGG - Intronic
983504588 4:168539300-168539322 CGAGTCCTGCCCGGGCGCGGTGG + Intronic
985195103 4:187420798-187420820 CGAGCTGAGGCCGGGCGCGGTGG + Intergenic
985737703 5:1594304-1594326 CCCGCTCTGCTCGGGCCCGCTGG + Intergenic
986412414 5:7493941-7493963 CGCTCTCTCCCCGGTCCCGGTGG + Intronic
987374230 5:17218590-17218612 CGGCCCCGGCCCGGGCCCGGGGG + Intronic
987742178 5:21924238-21924260 CTAGCTGTGGCCGGGCACGGTGG + Intronic
988280594 5:29141007-29141029 CGAGGTCTGGCCGGGCGTGGTGG - Intergenic
988796232 5:34656125-34656147 CGGGCTCTGGCCGGGACCTGCGG - Intergenic
989147055 5:38259016-38259038 CTAGCGCCGCCCGGGCTCGGGGG - Intronic
990282588 5:54267376-54267398 AGAGCTCTGGCCAGGCGCGGTGG - Intronic
991584237 5:68186245-68186267 CACGCTCTGGCCGGGCGCGGTGG + Intergenic
991673275 5:69068570-69068592 AGAGTTCTGGCCGGGCACGGTGG + Intergenic
991675634 5:69087603-69087625 CGAGCTCAGGCCAGGCACGGTGG + Intergenic
991861008 5:71013349-71013371 GGTGCTCTGGCCGGGCGCGGTGG + Intronic
992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG + Intergenic
992464339 5:76988882-76988904 AGAGTTCTGGCCGGGCGCGGTGG + Intergenic
992802967 5:80310115-80310137 CGAGCCCTGCCCCGGGCGGGAGG + Intergenic
993045406 5:82860906-82860928 AGAGCTCTGGCCGGGCGCGGTGG + Intergenic
993457470 5:88142532-88142554 GGTGCTCTGCCCGTGCCCGTGGG - Intergenic
995853961 5:116574027-116574049 CGAGCCTTGCCCGGTCCTGGGGG - Intronic
997526493 5:134556201-134556223 CCAGCTCTGCCAGGGCGGGGAGG - Intronic
999295706 5:150458366-150458388 CCAGCTCAGGCCGGGCGCGGTGG + Intergenic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG + Intergenic
1003523082 6:6875219-6875241 AGAGCTGTGGCCGGGCGCGGTGG + Intergenic
1003784508 6:9469743-9469765 GGAGCTCTGGCCGGGTGCGGTGG + Intergenic
1004661478 6:17714063-17714085 CAAGCTATGGCCGGGCACGGTGG - Intergenic
1005305962 6:24514449-24514471 CATGCTCTGGCCAGGCCCGGTGG + Intronic
1005736461 6:28752393-28752415 TGAGCACTGGCCGGGCCTGGTGG + Intergenic
1005883233 6:30075552-30075574 CGAGCTGGGCCCGGGGCTGGTGG - Exonic
1006310041 6:33250894-33250916 TGAGCTCAGCCCGGGCAGGGAGG + Exonic
1006408185 6:33857095-33857117 CCAGCCCTGGCCGGGCCCAGGGG - Intergenic
1006793063 6:36716180-36716202 GGAGCCCTGGCCGGGCACGGTGG + Intronic
1006849717 6:37089543-37089565 TGATCTCTGTCCGGGCGCGGTGG - Intergenic
1007800519 6:44388161-44388183 TGAGTTCTTCCCGGGGCCGGGGG - Intronic
1008106574 6:47445500-47445522 CCAGCTCTGCCAGGCACCGGTGG + Intergenic
1008990815 6:57599231-57599253 AGAGCTCAGGCCGGGCGCGGTGG - Intronic
1011427165 6:87241705-87241727 CAAGCTCTGGCCGGACACGGTGG - Intronic
1012530452 6:100229211-100229233 AAAGGTCTCCCCGGGCCCGGAGG - Intergenic
1014340756 6:120203896-120203918 CTAGCTTTGGCCGGGCGCGGTGG - Intergenic
1014551636 6:122795428-122795450 TGAGCTCAGGCCGGGCGCGGTGG - Intronic
1015984327 6:138870719-138870741 CGAGTTCTGGCTGGGCGCGGTGG + Intronic
1016486514 6:144545730-144545752 CAAGCTCTGGCAGGGCACGGTGG + Intronic
1017246572 6:152233610-152233632 TGAACTCTGGCCGGGCGCGGTGG - Intronic
1018669388 6:166167005-166167027 CGAGCCCTGCCAGGTCCAGGTGG + Intronic
1018838899 6:167505247-167505269 CGAGTTCTGCCTGGTCCCTGAGG - Intergenic
1019104713 6:169658972-169658994 TGAGCTCTGGCCGGGCGCGGTGG - Intronic
1019196044 6:170283694-170283716 CGAGCTGCCCCCGGGCCCAGCGG - Exonic
1019328307 7:450592-450614 GCTGCTCTGCCCGGGCCCTGTGG + Intergenic
1019470316 7:1216379-1216401 TGAGCTCAGGCCGGGCGCGGTGG - Intergenic
1019631759 7:2053294-2053316 TGTGCTCTGCCCCCGCCCGGAGG - Intronic
1020097697 7:5377749-5377771 CCAGCCCTGCCCAGGCCAGGTGG - Intronic
1020261016 7:6530918-6530940 CGGGCTCCGCCCAGGCTCGGAGG + Intronic
1022216803 7:28270861-28270883 CGAGTTCTGCTCAGGCCCGCTGG - Intergenic
1022375527 7:29807488-29807510 GGAGCGCCGCCCGGGCCCCGTGG + Intronic
1022871714 7:34487027-34487049 CCAGTTCTGGCCGGGCGCGGTGG + Intergenic
1024524374 7:50336233-50336255 GGAGCCCTGCCTGGCCCCGGCGG + Intronic
1025124689 7:56335203-56335225 CCAGCTCTGGCCGGGCACAGTGG + Intergenic
1025867081 7:65392822-65392844 TGGGCTCTGGCCGGGCACGGTGG - Intronic
1027002850 7:74666128-74666150 CAAGCTCTGGCCAGGCGCGGTGG - Intronic
1029140656 7:98407428-98407450 AAAGCTCTGGCCGGGCGCGGTGG - Intergenic
1029281500 7:99438723-99438745 GGAGCCCTGCCCGGTCCCCGCGG + Exonic
1031977444 7:128103071-128103093 CAAGCCCTGCCTGGGCCTGGTGG - Intergenic
1033351023 7:140562173-140562195 GGAGCTCGGGCCGGGCGCGGTGG - Intronic
1033873347 7:145784663-145784685 AGGGCTCTGGCCGGGCGCGGTGG + Intergenic
1034392773 7:150799940-150799962 CCAGCTCTTCCCGTGCCCCGGGG + Intronic
1034931483 7:155167180-155167202 CGAACCCTGCCCTGCCCCGGAGG + Intergenic
1034935898 7:155200642-155200664 CTAGCTCTGACTGGGCTCGGTGG + Intergenic
1034979337 7:155466424-155466446 TAAGCTCAGCCTGGGCCCGGCGG - Intergenic
1037825213 8:22156551-22156573 CGATCTCTCCCTGGGGCCGGCGG + Exonic
1037826874 8:22165053-22165075 CGAGCACTGTCCCGGCCCCGAGG + Exonic
1038869734 8:31481155-31481177 CAAGCTGTGGCCGGGCACGGTGG + Intergenic
1040029333 8:42810093-42810115 GGAGTTCTGACCGGGCACGGTGG - Intergenic
1040031927 8:42832655-42832677 AGAGCTCTGGCCGGGCGTGGTGG - Intergenic
1041215458 8:55595957-55595979 TTAGCTCTGCCCTGGCCAGGAGG - Intergenic
1045511485 8:102815357-102815379 CCAGCTCTGGCCGGGCACAGTGG - Intergenic
1045566889 8:103327305-103327327 AGAGCTCTGGCCGGGTGCGGTGG + Intronic
1047824551 8:128559426-128559448 CGGGTTCTGGCCGGGCGCGGTGG - Intergenic
1048992743 8:139770880-139770902 CTGGCCCTGCCCGGGCCTGGCGG + Intronic
1049718163 8:144103500-144103522 CGTGCCCTGCCCGGGCCAAGAGG + Intronic
1050107202 9:2177837-2177859 CTACCTCTGGCCGGGCACGGTGG - Intronic
1051400432 9:16675777-16675799 CCAGCTTTGGCCGGGCTCGGTGG + Intronic
1051629560 9:19128903-19128925 CGAGCTGTGTCGGGGGCCGGGGG - Intronic
1052911914 9:33890522-33890544 CGAGCTAAGGCCGGGCTCGGTGG + Intronic
1053129168 9:35605557-35605579 CGCGGCCTGCCCGGGCCCTGGGG + Exonic
1056339316 9:85609566-85609588 CAAGATCTGGCCGGGCGCGGTGG - Intronic
1057847922 9:98539629-98539651 GCAGGTCTGGCCGGGCCCGGTGG + Intronic
1060147975 9:121268320-121268342 GGAGCTCGGCCCGGCCGCGGGGG + Intronic
1060398772 9:123335186-123335208 CTGGCTCTGGCCAGGCCCGGTGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG + Intergenic
1061398101 9:130354400-130354422 AGAGCTCTGTCCCGGCCCTGGGG + Intronic
1062290374 9:135791725-135791747 CCAGCTCTGCAGGGGCCCAGAGG - Intronic
1062320399 9:135988017-135988039 CGCGCTCCGCCCGGCCCCAGAGG - Intergenic
1062398837 9:136363609-136363631 CGACCTCTGGACGGGCCCCGCGG + Exonic
1185775790 X:2801992-2802014 TGAGCTGTGGCCGGGCGCGGTGG - Intronic
1185877570 X:3713148-3713170 CGCGCTCTGCCCCAGCCCTGAGG - Exonic
1185894129 X:3843401-3843423 CGAGCTCTGCCCCAGCTCCGAGG - Exonic
1186496576 X:10015979-10016001 CGAGCTCTGCCCGGGCCCGGGGG - Intronic
1187697046 X:21933294-21933316 GCAGCTCTGCCTGGGCCAGGGGG + Intergenic
1187895853 X:23978840-23978862 CCAACTCTGGCCGGGCACGGTGG + Intergenic
1188881643 X:35498507-35498529 CTTGCTCTGGCCGGGCGCGGTGG - Intergenic
1189821633 X:44874037-44874059 CGCGCTCGCCCCGGGCCCCGCGG + Intronic
1190160750 X:48029852-48029874 CAAGCTCTGGCTGGGCGCGGTGG + Intronic
1192357598 X:70418795-70418817 AGACCTCTGGCCGGGCACGGTGG + Intronic
1197268707 X:124403231-124403253 TGAGCACTGGCCGGGCACGGTGG + Intronic
1198259688 X:134954698-134954720 CAAGCCCTGGCCGGGCGCGGTGG - Intergenic
1200787734 Y:7274396-7274418 CGCGCTCTGCCCCAGCCCCGAGG + Intergenic