ID: 1186497592

View in Genome Browser
Species Human (GRCh38)
Location X:10024085-10024107
Sequence CATTGTAACCAGGTGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497592 Original CRISPR CATTGTAACCAGGTGGATGG AGG (reversed) Intronic
903291025 1:22314361-22314383 CTTTGGAAACAGGTGGATTGAGG + Intergenic
904258212 1:29270814-29270836 CAAATTAACCAGGTGCATGGTGG + Intronic
907481349 1:54747572-54747594 CACTGTAATCAGGTTGATGTGGG - Intergenic
908170735 1:61502057-61502079 CATTCTAGCCTGGTGGCTGGGGG - Intergenic
908842111 1:68290535-68290557 CAGTATAACCAGGTGGAAAGAGG - Intergenic
911749404 1:101479429-101479451 AATTTTCACCTGGTGGATGGGGG + Intergenic
915296376 1:154924619-154924641 CATTCTAGCCAGGTGGGAGGTGG + Intergenic
918708840 1:187703256-187703278 CATAGTGCACAGGTGGATGGGGG - Intergenic
919021223 1:192108355-192108377 CATTGCTAGCAGGCGGATGGGGG + Intergenic
920082850 1:203388714-203388736 CATGGATACCAGGTGGAGGGGGG - Intergenic
920773374 1:208911597-208911619 CATTGTAACCATGTGGATAAGGG - Intergenic
921374890 1:214463625-214463647 CTTTGTAAGCAGGTGGAGAGAGG + Intronic
923577678 1:235174726-235174748 CATTTGAACCAGGGAGATGGAGG + Intronic
923714690 1:236415172-236415194 TATTGTCATCAGGAGGATGGAGG + Intronic
1062946063 10:1463085-1463107 CATAGTAACCAGGGTCATGGTGG + Intronic
1063093398 10:2887837-2887859 TACTGGCACCAGGTGGATGGAGG - Intergenic
1064057270 10:12107946-12107968 CATCGTAGCCATGTGGAAGGAGG - Exonic
1064478030 10:15712515-15712537 CATTTTAACCCGGGAGATGGAGG + Intronic
1070788588 10:79176512-79176534 CCTTGGCACCAGGAGGATGGAGG - Intronic
1077085016 11:745685-745707 CATTCTAACTTGGTGGCTGGTGG - Intergenic
1077472937 11:2772789-2772811 CACTGTGACCAGGTGGGTGTAGG - Intronic
1080028795 11:27638872-27638894 CATTCTAACTTGGTGGCTGGTGG + Intergenic
1080257994 11:30313885-30313907 CACCATAACCATGTGGATGGGGG + Intergenic
1087860110 11:103142583-103142605 CATTTAAACCAGGGAGATGGAGG + Intronic
1091447497 12:552422-552444 CATTGGCACCCGGTGCATGGCGG - Intronic
1097071320 12:56357118-56357140 CACTTGAACCAGGGGGATGGTGG - Intronic
1102192951 12:111002656-111002678 CATTCTAACTTGGTGGCTGGTGG + Intergenic
1102988469 12:117297677-117297699 CACTGCACCCAGCTGGATGGTGG + Intronic
1105593653 13:21816603-21816625 CCTTGTAACTAGGTAGATGGTGG + Intergenic
1108474590 13:50801291-50801313 CACTGGGAGCAGGTGGATGGAGG - Intronic
1109183717 13:59245396-59245418 CATTATAAGCATGTGGATGGTGG + Intergenic
1109470045 13:62792005-62792027 CATTCTAACTTGGTGGCTGGCGG + Intergenic
1111607554 13:90560904-90560926 CATTCTAACTTGGTGGCTGGTGG - Intergenic
1111625507 13:90779526-90779548 AATTTTAAGCAGGGGGATGGTGG - Intergenic
1113048699 13:106184901-106184923 CACTGCAACCAGGAGGATGGGGG - Intergenic
1113318650 13:109210460-109210482 CATTGTAAACATTTGGATAGTGG - Intergenic
1119003534 14:70904810-70904832 CATTGGGACGGGGTGGATGGGGG - Intergenic
1122313373 14:100811429-100811451 CATTGTAACCAAGAGCATTGGGG - Intergenic
1122506820 14:102236862-102236884 TTTTTTAACCAGGAGGATGGTGG - Intronic
1127836077 15:62792336-62792358 CATTCTTACCAGGTGGCTGGAGG + Intronic
1132710525 16:1264243-1264265 GATTGTAACCAGGGTGATTGTGG + Intergenic
1133764597 16:8829059-8829081 CACTGGAACCCGGTGGGTGGAGG - Intronic
1136044094 16:27601934-27601956 GATGGAAATCAGGTGGATGGAGG + Intronic
1136470844 16:30478960-30478982 CTTGGTAACCAGTTGGATAGAGG + Intronic
1137023733 16:35453997-35454019 CACTGGAGCCAGGTGGCTGGGGG + Intergenic
1139344217 16:66292205-66292227 CACTGGAACCTGGGGGATGGAGG - Intergenic
1141053210 16:80792072-80792094 CCTTGGGAACAGGTGGATGGGGG + Intronic
1141098785 16:81181697-81181719 CATTTGAACCAGGGAGATGGAGG + Intergenic
1142356833 16:89605313-89605335 CAATGTCACCAGGTGGACGTCGG + Intergenic
1143214822 17:5216951-5216973 CAGTGTACCTAGGGGGATGGAGG - Intronic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1157698267 18:49742253-49742275 CATGGAATCCAGGTGGATGCAGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1159973625 18:74683077-74683099 AATTGTAACCAGGTGTGTGAGGG + Intronic
1162797509 19:13094488-13094510 CATGGGAACAAGGTGGGTGGTGG + Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
1167212798 19:48143938-48143960 GATTGTAACCAGATGGATCCAGG + Exonic
1168527878 19:57103327-57103349 CAGTGTAACCAGGTGGATAATGG - Intergenic
926124711 2:10265075-10265097 CCTTGGAGCCAGGTGGAGGGAGG - Intergenic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926196000 2:10763876-10763898 CATTCTAACCAGGTGTGGGGTGG - Intronic
927411407 2:22830333-22830355 CATTATTTCCAGGTGGGTGGGGG + Intergenic
927818131 2:26238689-26238711 CACTATAACCAGGAGGCTGGTGG + Intronic
928826295 2:35425449-35425471 CATGGTAGCCAATTGGATGGAGG + Intergenic
935628801 2:105194936-105194958 CATTGTAAGCTGGTGGATAAAGG - Intergenic
942139266 2:172961096-172961118 GATTGTAATCAGGTGGAAGGAGG - Intronic
946067258 2:216998639-216998661 CATTATAACCAGATGAAAGGGGG - Intergenic
946227709 2:218273032-218273054 CAGTGTTCCCAGCTGGATGGTGG + Intronic
1169813213 20:9629804-9629826 TTTTGTAACCAGGTGGGTGAAGG + Intronic
1170077405 20:12434549-12434571 CATTGTAATGGGGTGAATGGTGG + Intergenic
1172585258 20:36078781-36078803 CATTTGAACCAGGGAGATGGAGG + Intergenic
1173401165 20:42727195-42727217 CATTGGAACGGGGGGGATGGAGG - Intronic
1173970605 20:47149450-47149472 CATTTTAACCAAGAGGATGGGGG - Intronic
1177874367 21:26612829-26612851 CATTTTAACCACAAGGATGGGGG - Intergenic
1177921124 21:27153869-27153891 CTTTGAAACCAAGTGGATGGAGG + Intergenic
1178963486 21:37090951-37090973 CAATATAACAAGGTGGATGAGGG - Intronic
1179094157 21:38296941-38296963 CATGGTAGCCAGGTGGGTGAAGG + Exonic
1181141807 22:20810966-20810988 CATTGTAGCCAGTGTGATGGAGG - Exonic
1185045962 22:48528894-48528916 CATTGTAACCTGGAGAAGGGAGG + Intronic
949717754 3:6952859-6952881 CATTTTAACCACGAGGATGTTGG - Intronic
949811516 3:8011870-8011892 CATTCTAACTTGGTGGCTGGAGG - Intergenic
950223242 3:11212652-11212674 CATTAAAACCAGCAGGATGGTGG - Intronic
955422241 3:58750377-58750399 CAATGTAACCATGTGGAAGATGG + Intronic
957767954 3:84649963-84649985 CATTGGAACCTGGAAGATGGAGG + Intergenic
959128263 3:102317758-102317780 CTTTGTAACAACATGGATGGAGG - Intronic
959158028 3:102690165-102690187 CATAGTAATCAGTTGGAAGGAGG + Intergenic
963466408 3:145687635-145687657 CACTGTAACCCAGTGGGTGGAGG + Intergenic
965806979 3:172551931-172551953 AATTGTGACCAAGTGGCTGGTGG + Intergenic
966089688 3:176117975-176117997 CACTTTAACCAGGGAGATGGAGG + Intergenic
966473935 3:180322888-180322910 CATTGTAAACAGGCGGAGGCTGG + Intergenic
970322669 4:14890606-14890628 CATTGTCAGCAGGTGGATGTAGG - Intergenic
975029615 4:69599402-69599424 AAATGTAACAAGTTGGATGGAGG + Intronic
975357576 4:73425841-73425863 TAATGTAACCATGTCGATGGAGG - Intergenic
976111737 4:81682676-81682698 CATTCTCCCCAGGTGGCTGGAGG - Intronic
979343428 4:119556343-119556365 CATTTTAAACAGTAGGATGGGGG - Intronic
980613894 4:135193992-135194014 AATTGTTACCAGGAGGAGGGTGG + Intergenic
980977018 4:139620979-139621001 GCTTTTAACGAGGTGGATGGGGG - Intergenic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
985293928 4:188414493-188414515 CATTGTTACGAGGTGCTTGGCGG - Intergenic
986571271 5:9168511-9168533 CATTGTTACCATGTGGGTGAGGG + Intronic
988844214 5:35112990-35113012 CATTGTAAAGAGCTGGATCGTGG - Intronic
991161522 5:63508514-63508536 CATTCTAACCAAGTGCAAGGAGG + Intergenic
993486157 5:88488531-88488553 CTTTGTAACCTATTGGATGGAGG + Intergenic
994111380 5:96008485-96008507 CATTGTAACCAGGTTGTTGGAGG - Intergenic
995631383 5:114136547-114136569 CAGTGGAACCTGGTGGAGGGAGG + Intergenic
999726279 5:154440838-154440860 CATTCTAGCCAGGAGGAAGGGGG - Intergenic
1002961185 6:1916209-1916231 CCTTGTAACTAGGTGGCTGCTGG - Intronic
1003311814 6:4975343-4975365 CAGTGGAACCACCTGGATGGCGG - Intergenic
1003607772 6:7580314-7580336 CATGGTGAGCTGGTGGATGGTGG - Exonic
1004308865 6:14526034-14526056 AATTGAAAACAGGTGGATGGGGG + Intergenic
1011049360 6:83127214-83127236 CATTCTAACCTGGTGGCTGGTGG + Intronic
1014222581 6:118812766-118812788 AATTATAACCAGGTAGAAGGTGG + Intergenic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1017443331 6:154484809-154484831 AATTGTTACCATCTGGATGGAGG + Intronic
1019415337 7:924345-924367 CAGTGTAACCCGGAGGGTGGGGG - Intronic
1020923549 7:14295676-14295698 TCTTGGAACCAGGTGGATGGAGG - Intronic
1021252005 7:18341036-18341058 CATTGTAACCAAGAAGATAGTGG - Intronic
1023106121 7:36764723-36764745 CATTGTTAGCATGTGGAGGGTGG + Intergenic
1025868879 7:65411817-65411839 CATTGAAATGAGGTGAATGGAGG + Intergenic
1026079571 7:67205623-67205645 CATTATAACCAGGTGAAGGTGGG + Intronic
1026621605 7:71954374-71954396 CATTTGAACCAGGGAGATGGAGG + Intronic
1028526587 7:91793224-91793246 CATTGTTACCAGGATGATGCTGG - Intronic
1035306320 7:157935172-157935194 CTTTTTCACCAGGTGGAGGGTGG + Intronic
1035443264 7:158921590-158921612 GATTGTGACGAGGTGGAAGGAGG + Intronic
1035672098 8:1425949-1425971 TATGGAAACCAGGTGGCTGGAGG + Intergenic
1037839719 8:22235314-22235336 CATTTTAAAAAGGTGGAGGGTGG + Intergenic
1039887293 8:41662171-41662193 CACTTGAACCTGGTGGATGGAGG + Intronic
1040499733 8:47996046-47996068 TATTTTAACCAAGAGGATGGGGG + Intergenic
1041478732 8:58295057-58295079 CATTCTAACTTGGTGGCTGGTGG - Intergenic
1041556776 8:59165943-59165965 CTTTGTGACCAGTTGGATGAAGG + Intergenic
1042699547 8:71597195-71597217 CACTGAAACCATGAGGATGGGGG + Intergenic
1042760727 8:72268965-72268987 CACTTTCACCAGGTGGATAGAGG + Intergenic
1043130888 8:76459559-76459581 CTTTGTAGCCAGGTAGATGAAGG - Intergenic
1043170661 8:76961844-76961866 CATTGTAACTAAATAGATGGTGG + Intergenic
1044067613 8:87718529-87718551 CGTTGTAAGCAGGTGGATCTAGG - Intergenic
1044987883 8:97771026-97771048 CATTCTAACTTGGTGGCTGGTGG + Intergenic
1046294679 8:112202062-112202084 CATAGTCACCAGGTGGGGGGAGG - Intergenic
1047311523 8:123696565-123696587 CATTTTAACCAGCTTGGTGGTGG - Intronic
1053356714 9:37452037-37452059 CATTCTAACTTGGTGGCTGGTGG + Intronic
1053445637 9:38150940-38150962 CCTGGTAACCATGGGGATGGAGG + Intergenic
1055045858 9:71923143-71923165 TATGGAAACCAGATGGATGGTGG - Intronic
1057154536 9:92829604-92829626 AACTGTAAGCAGGTGGCTGGGGG - Intergenic
1057986302 9:99718019-99718041 AATTGCCACCAGGTGAATGGTGG - Intergenic
1060172160 9:121470780-121470802 CATTCTAACTTGGTGGCTGGTGG - Intergenic
1061921119 9:133783161-133783183 CATTCTCAACAGGTGCATGGAGG - Intronic
1062614045 9:137388010-137388032 CCTTGGAACCATGTGGGTGGGGG + Intronic
1186497592 X:10024085-10024107 CATTGTAACCAGGTGGATGGAGG - Intronic
1186747680 X:12586270-12586292 TCTTGGAACCAGGTGGTTGGTGG - Intronic
1186924654 X:14319847-14319869 CTTTAGAACCAGGTGGATGTGGG - Intergenic
1187006829 X:15240650-15240672 CCTTGTGACCAGCTGGCTGGCGG - Intronic
1187953861 X:24496701-24496723 CACTGTGACCAAGGGGATGGTGG - Intronic
1193554696 X:82938958-82938980 CAGTGTAATCAGGTGGGTAGTGG - Intergenic
1194184818 X:90763394-90763416 CTTTGTAAACAAGTGTATGGTGG - Intergenic
1197104328 X:122695663-122695685 CATTATATCCAGTTGGTTGGTGG - Intergenic
1198177923 X:134173529-134173551 CATTGTTACCAGGGTGATTGTGG + Intergenic
1198376715 X:136048164-136048186 GATTGTAACCAGAAGGATGAAGG + Intergenic
1200531436 Y:4345484-4345506 CTTTGTAAACAAGTGTATGGTGG - Intergenic