ID: 1186497621

View in Genome Browser
Species Human (GRCh38)
Location X:10024495-10024517
Sequence AGGGAGAACCGAATGGCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186497621_1186497633 -2 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497633 X:10024516-10024538 CTTTGGTTCGGAGGAAGGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 248
1186497621_1186497634 5 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847
1186497621_1186497635 10 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497621_1186497632 -3 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497621_1186497630 -4 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1186497621_1186497628 -7 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497621 Original CRISPR AGGGAGAACCGAATGGCTCG GGG (reversed) Intronic
902782964 1:18716409-18716431 AGGGAGGCACGAATGGCTGGAGG - Intronic
903345810 1:22683634-22683656 AGGGAGAACAGCATGGCAGGGGG - Intergenic
904441222 1:30533254-30533276 AGGGGGAACAGATTGGCTCATGG - Intergenic
907275808 1:53316054-53316076 AAGAAGAACCGACTGGCTCATGG + Intronic
907527477 1:55062442-55062464 AGGGAGAACAGCATGTCTCTTGG - Intronic
913348957 1:117836777-117836799 AGAGAGAACTGAGTGGCTGGAGG + Intergenic
913608446 1:120488032-120488054 AGAGAGAATCTAATGGCTTGGGG - Intergenic
913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG + Intergenic
914370186 1:147017813-147017835 AGAGAGAATCTAATGGCTTGGGG - Intergenic
914484507 1:148095600-148095622 AGAGAGAATCTAATGGCTTGGGG + Intergenic
914582755 1:149033805-149033827 AGAGAGAATCTAATGGCTTGGGG + Intronic
918265806 1:182840197-182840219 GGGGAGAAACGAATGGATAGGGG + Intronic
918803377 1:189002837-189002859 AGGAAGAAATGAATGGCTCCGGG - Intergenic
919739949 1:200975355-200975377 AGGGAGAACAGGAGGGCTTGGGG + Intronic
921291493 1:213662064-213662086 AGGGAGAACCCAATGTTTCTAGG + Intergenic
1063636986 10:7791603-7791625 AGGGAGAATCAAATGGACCGTGG - Intronic
1066051202 10:31637459-31637481 AGGGAAAACAGAATGGGTAGTGG - Intergenic
1068571041 10:58629542-58629564 AGGGACAACCAAAAGGCTGGGGG + Intronic
1072253545 10:93600553-93600575 AGGGAGCACCGAATGGGTGGAGG - Intronic
1074607721 10:114990557-114990579 AGGGAGAACAGGACGCCTCGTGG + Intergenic
1076833213 10:133007292-133007314 AGGGCCAACTGAATGGCTCCTGG + Intergenic
1083667863 11:64285328-64285350 AGGGAGGACCGTAGGGCCCGTGG + Intronic
1084982453 11:72837726-72837748 AGGAAGAACCTGGTGGCTCGTGG - Intronic
1091806224 12:3358118-3358140 AGGGGGAACCGAAAGGCTTCAGG - Intergenic
1102573861 12:113843859-113843881 AGGGAGGACAGCATGGCTGGAGG - Intronic
1104600079 12:130147261-130147283 AGGGAGCACTGAGTGGCTAGTGG - Intergenic
1110949479 13:81466774-81466796 AGGGAGAATCATATGGCTAGGGG + Intergenic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1116664408 14:47756804-47756826 AGGGAGTAACGAATGGCAAGGGG - Intergenic
1116835173 14:49763316-49763338 AGGTGGAACAGAATGGCTAGAGG + Intergenic
1121312354 14:92941976-92941998 AGGCAGAACCGATGGGCTCCTGG + Intronic
1127525935 15:59792115-59792137 AGGGAGGGCCTAATGGCTGGGGG - Intergenic
1129379322 15:75155306-75155328 AGAGAGATCTGAATGGCTCTGGG + Intergenic
1131396859 15:92093180-92093202 AAGGAGATTCGAGTGGCTCGGGG + Intronic
1133879823 16:9770861-9770883 AGGGAAAACCGAAGGGAGCGGGG - Intronic
1134690676 16:16189239-16189261 GGGGAGAACCTAATGCCTCTAGG + Intronic
1146278258 17:31529047-31529069 TGGGAGAACCCAATGCCTCCAGG - Intronic
1148486793 17:47995905-47995927 AGGGAAAACAGAATGGGTCCTGG + Intergenic
1149004045 17:51786269-51786291 AGGGAGGACGCATTGGCTCGTGG + Intronic
1152297953 17:79479270-79479292 AGGGAGAACCCAGGAGCTCGCGG + Intronic
1153624487 18:7011260-7011282 AGGAAGCACCGACTGGCTCTCGG + Intronic
1161258259 19:3321645-3321667 AGGGAGAAGCCACTGGCTAGGGG + Intergenic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
948336394 2:237210792-237210814 AGGGAGACACGAAGGGCTGGAGG + Intergenic
1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG + Exonic
1179597852 21:42455080-42455102 AAGGAGAACAAAATGGCTCAAGG - Intergenic
1181832875 22:25576613-25576635 AGGGAGAAGCTAATTGCTCAAGG + Intronic
1184278091 22:43421719-43421741 AGGGAGAAACGGATGGATGGAGG - Intronic
956190393 3:66602267-66602289 AGGAAGAAAGGAATGGATCGAGG - Intergenic
959478425 3:106840109-106840131 AGATAGAACAGAATGGCTTGTGG - Intergenic
961486154 3:127218184-127218206 AGGGAGATAAGAATGGCTCAGGG - Intergenic
962479335 3:135785352-135785374 AGGGAGAACTGCATAGCTCCAGG + Intergenic
967649882 3:191973483-191973505 AGGGAGGACCTAAAGGCTGGGGG - Intergenic
970389993 4:15599213-15599235 AGGGAGTACTGAATGACTTGGGG - Intronic
978018275 4:103776120-103776142 TGGGAGAACTGGATGGCTAGAGG + Intergenic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
985611497 5:892180-892202 AGGGTGAACCGAAGTGCTGGGGG - Intronic
995344201 5:111092679-111092701 AGGGAGAACCGGACTGCTCCAGG - Intronic
1003539302 6:7004079-7004101 AGGGAGAAACGCAGGGCTCCTGG - Intergenic
1009921801 6:70071726-70071748 AGGGAGAACAGAATGGCATTGGG + Intronic
1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG + Intergenic
1029705471 7:102273619-102273641 AGGGAGAACCCAATGGTTTTAGG - Intronic
1037254250 8:16934532-16934554 AGGTAGAACAAAATGGCTAGCGG - Intergenic
1046171403 8:110512273-110512295 AGGGATAAACGAATGGCTCCTGG + Intergenic
1051969807 9:22874910-22874932 AGAGAGAAACTAATGGGTCGTGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG + Intergenic
1059449402 9:114360944-114360966 AGGGAGACACGGATGGCTCCAGG - Intronic
1062675746 9:137742679-137742701 AGGGAGAAGCAAATGTCTGGGGG - Intronic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1189032218 X:37462415-37462437 AGGGAAAACAGAATGGGTAGTGG - Intronic
1190643578 X:52503970-52503992 AGGGAGAAGCGATTCTCTCGTGG + Intergenic
1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG + Intergenic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1195540718 X:106059531-106059553 AGAGAGAGCCCAAAGGCTCGTGG - Intergenic
1196056540 X:111362432-111362454 TGGGGGAACTGAATGGCTTGGGG - Intronic
1196688839 X:118536961-118536983 AAGGAGAGCCGAATGACTAGGGG + Intronic
1197795996 X:130299406-130299428 AGGGAGAACCTGAAGGCTGGAGG - Intergenic