ID: 1186497628

View in Genome Browser
Species Human (GRCh38)
Location X:10024511-10024533
Sequence TCTCCCTTTGGTTCGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186497622_1186497628 -8 Left 1186497622 X:10024496-10024518 CCCGAGCCATTCGGTTCTCCCTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153
1186497617_1186497628 19 Left 1186497617 X:10024469-10024491 CCTAAGATGCTCCGAGCCATTCA 0: 1
1: 0
2: 0
3: 9
4: 57
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153
1186497621_1186497628 -7 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153
1186497619_1186497628 3 Left 1186497619 X:10024485-10024507 CCATTCAGTGCCCCGAGCCATTC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153
1186497618_1186497628 8 Left 1186497618 X:10024480-10024502 CCGAGCCATTCAGTGCCCCGAGC 0: 1
1: 0
2: 0
3: 33
4: 139
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153
1186497623_1186497628 -9 Left 1186497623 X:10024497-10024519 CCGAGCCATTCGGTTCTCCCTTT 0: 1
1: 0
2: 0
3: 1
4: 131
Right 1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG 0: 1
1: 0
2: 2
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497628 Original CRISPR TCTCCCTTTGGTTCGGAGGA AGG Intronic
900632072 1:3642190-3642212 TCTCCCTTTGTTTCCCAGGCTGG - Intronic
901142969 1:7047301-7047323 TCTCCCTTCGGTGAGAAGGAGGG + Intronic
902854664 1:19192741-19192763 GCTGCTTTTGATTCGGAGGAGGG - Intronic
905556662 1:38890887-38890909 TCTCCCTATGTTTCACAGGATGG + Intronic
906795093 1:48690308-48690330 ACACCCTTTGATTTGGAGGATGG + Intronic
906951929 1:50341688-50341710 TCTCCCTTTCTTTCAGAAGATGG - Intergenic
911991839 1:104707904-104707926 TCTCCCTTTGTTGCCCAGGATGG + Intergenic
912334449 1:108849283-108849305 TCTCACTTTGTTGCTGAGGATGG - Intronic
913477079 1:119248160-119248182 TCTCCATTTGGAGAGGAGGAGGG + Intergenic
920142512 1:203828406-203828428 TCTCACTTTTGCTCGGAGGTAGG - Exonic
924010425 1:239659320-239659342 TCTCCCTCTTGTCTGGAGGAAGG + Intronic
1065200714 10:23310478-23310500 GCTGCCTTTGGTTCCCAGGAGGG + Intronic
1065210680 10:23399429-23399451 TCTCACTTTGTTGCGGAGGCTGG + Intergenic
1065813003 10:29459710-29459732 TCTCCTTTTGGGTGGGTGGATGG + Intronic
1074383831 10:113001527-113001549 TCTTCTTTTGGTTTGGAGGGAGG + Intronic
1075589784 10:123683320-123683342 TCTCCCTATGGTACAGAAGATGG - Intronic
1076451547 10:130560261-130560283 TCTCTCTTTGGCCCAGAGGAGGG + Intergenic
1080505620 11:32910170-32910192 TCTTCCTTTGGTTTGGGGCAGGG + Intronic
1082987407 11:59180508-59180530 TATCCCTCTGGGTTGGAGGAGGG + Intronic
1083455893 11:62778376-62778398 TCTCCCTTAGGTTCTGAGGGTGG + Intronic
1085511553 11:77090810-77090832 GCTCCCTCTGGGTCAGAGGATGG + Intronic
1088423603 11:109675799-109675821 TCTGTCTTTGGTGGGGAGGATGG + Intergenic
1088579813 11:111303761-111303783 TCTCCCTGTGGCTCAGAGTATGG + Intronic
1089260685 11:117221923-117221945 TCTCCCTGGGGCTGGGAGGAGGG + Intronic
1089518588 11:119049079-119049101 TCTCCCTTAGGTTCAGGGGGTGG + Exonic
1090972670 11:131656477-131656499 TATCCATGTGGTTGGGAGGATGG - Intronic
1093051155 12:14506419-14506441 TCTCCCTTGGCTTGTGAGGAAGG + Intronic
1096359744 12:50973497-50973519 TCTACCTTTGGTTTTGATGATGG - Intergenic
1098681837 12:73366076-73366098 TCTCCCTTTGTTGCCCAGGATGG - Intergenic
1098837331 12:75438677-75438699 TCTCCCTTTGGTGTGGGTGAGGG + Intergenic
1099608212 12:84832323-84832345 TTTCGCTTTGCTTCTGAGGAAGG - Intergenic
1102144371 12:110643865-110643887 TCTCCCTTTGTTTCCCAGGCTGG + Intronic
1103499387 12:121389144-121389166 TCTCCCTATGTTTCCCAGGATGG - Intronic
1104031558 12:125068583-125068605 CCTCCCTTTAGTTTGGAGGAGGG + Intronic
1107477459 13:40752767-40752789 TCTCACTTTGATTCTTAGGATGG + Intronic
1109131868 13:58597338-58597360 TTTGCCTTTGGTGGGGAGGAGGG + Intergenic
1112768488 13:102772340-102772362 TCTCCCTATGTTTCGCAGGCTGG + Intronic
1113027114 13:105953145-105953167 TCTCCTTTTGGTCAGGTGGAAGG - Intergenic
1113827178 13:113265349-113265371 TCTCCCTATGGTGCTCAGGATGG - Intronic
1117275260 14:54187526-54187548 TCTCCCTTTGCCTGGTAGGAAGG + Intergenic
1119174372 14:72558393-72558415 TCTTTCTTTGGCTGGGAGGAGGG - Intronic
1128635543 15:69299778-69299800 TCCCGCTTAGGTTGGGAGGAGGG + Intronic
1131257277 15:90871255-90871277 TTTCCCTTTGGTTCCGAGTTCGG + Intronic
1133566598 16:7001484-7001506 TCTCGCTTTGTTGCCGAGGATGG + Intronic
1134020886 16:10920729-10920751 TCTCCCTGTGGGGTGGAGGAAGG + Intronic
1134249467 16:12564190-12564212 TCTCCCTATGGTGCCCAGGACGG - Intronic
1136341243 16:29645027-29645049 TCTCCCTATGGTCCCCAGGATGG + Intergenic
1143285767 17:5788113-5788135 TCTTCCTTTCCTTTGGAGGAAGG - Intronic
1144318900 17:14094051-14094073 TCTCCCTTTTTTTCAGAGGCAGG - Intronic
1144870865 17:18369955-18369977 TCTACCTTTTGATGGGAGGAAGG - Intergenic
1145023162 17:19447686-19447708 TCTCCCTTAGGTTAGAGGGAGGG - Intergenic
1147163395 17:38580374-38580396 TCTTCCCTTGGTTCGGTGGGAGG - Intronic
1148029689 17:44610891-44610913 TCCACCTTTGGTTTGGGGGAAGG - Intergenic
1148508766 17:48149948-48149970 TATCCTTTTGGTAAGGAGGAGGG - Intronic
1149458747 17:56810534-56810556 TGTCCCTTTGCTTGGGAAGAGGG - Intronic
1150385925 17:64760073-64760095 GCTCCCTTTGGGTGGGGGGAAGG - Intergenic
1150805492 17:68315563-68315585 TCTCCCTTTGGTGCTAATGAAGG + Intronic
1151338641 17:73455812-73455834 TCTCCCTTGAGTGTGGAGGAGGG - Intronic
1151446255 17:74166270-74166292 TCTCCCTTTGTTACTGAGGCTGG - Intergenic
1155244614 18:23895171-23895193 TCTTCATTTGGATCAGAGGAAGG - Intronic
1155322433 18:24632327-24632349 TCTCCCTTGGGATCAGAGCAGGG + Intergenic
1158255720 18:55546138-55546160 TCTCACTTTGTTACGGAGGCTGG - Intronic
1160073387 18:75648431-75648453 GCTCCCTTAGGTAAGGAGGAAGG + Intergenic
1160328675 18:77972507-77972529 TCTCCTTCTGCTTCGGAGCAGGG + Intergenic
1161389422 19:4013490-4013512 GGTCCCTTTGCTTCCGAGGAAGG - Intronic
1161867303 19:6842621-6842643 TCTCCCTTTGTTTCCCAGGCTGG - Intronic
1162241979 19:9362667-9362689 TCTTCCTTTGGTCAGGAAGAGGG + Intronic
1163560302 19:18015292-18015314 TCTCCCTTTGTTTCTCAGGTGGG + Intergenic
1164005080 19:21141239-21141261 TCTCCCTTCAGTTCTGAGGGTGG - Intergenic
1164071034 19:21768345-21768367 TCTCTCTTTGGTTCCTAGGGTGG + Intergenic
1164100519 19:22050898-22050920 TCTCTCTTCAGTTTGGAGGATGG - Intergenic
1164114113 19:22200546-22200568 TCTCACTTTGTTGCGGAGGCTGG + Intergenic
1167456162 19:49597486-49597508 CCACCCTTGGGTTCGGAGGCCGG - Exonic
925227625 2:2199476-2199498 TCTCCCATTGACTCGGGGGAAGG - Intronic
927240327 2:20915248-20915270 ACTCCCTCTGGTTCGCAGGCTGG + Intergenic
930104819 2:47631548-47631570 TCTCCCTCTGGGTCAGATGAGGG + Intergenic
931982256 2:67706635-67706657 TCTTCCTTTGGCTCAGATGAGGG - Intergenic
932548767 2:72744342-72744364 TCTCCCTTTATTTCAAAGGAAGG - Intronic
937252245 2:120532289-120532311 TCTCCCTTTGGGGCAGTGGAGGG - Intergenic
937967870 2:127527569-127527591 CTTGCCTTTGGATCGGAGGAGGG + Intergenic
940232823 2:151476109-151476131 ACTACTTTTGGTTTGGAGGAGGG + Exonic
940313743 2:152306010-152306032 TCTCCCTCTGTTTCGCAGGCTGG - Intergenic
941085781 2:161115879-161115901 TCTCCCTTTGGTGCAAAGGCAGG - Intergenic
941959129 2:171236305-171236327 TCACCCTTTGATGCTGAGGAGGG + Intergenic
943060447 2:183037788-183037810 TCTCCCTGTGGTTCGCCGGCCGG - Intronic
944430618 2:199629677-199629699 TCTCCATTTGCTTTGAAGGAAGG - Intergenic
944593938 2:201244702-201244724 TATCCCTTTGGTGCTGAGCATGG - Intronic
944776441 2:202971015-202971037 TCTATCTTTGGTTGGAAGGATGG + Intronic
946322829 2:218963386-218963408 TCTCTCTTGGTTTGGGAGGAGGG + Intergenic
946772402 2:223101964-223101986 TCTCCCTGTGGTTCACAGTAAGG - Intronic
946843966 2:223843041-223843063 TCTCACTTTGGTTCCCAGGCTGG + Intergenic
949032270 2:241802710-241802732 TCTCCCTGGGTTTCTGAGGATGG + Intronic
1173138933 20:40465134-40465156 GCTCAGTTTGGTTCCGAGGAAGG + Intergenic
1174041771 20:47705271-47705293 CCTCCCTTTGTGTGGGAGGATGG + Intronic
1177502115 21:21970381-21970403 TCTCACTTTGTTGCCGAGGATGG + Intergenic
1177780759 21:25620477-25620499 TTGCCCTTTGGTTCAGAGTATGG + Intergenic
1178477172 21:32947105-32947127 TCTCCCTTTTGTTTGGAGACAGG - Intergenic
1180120097 21:45740144-45740166 TAGCCCCTTGGGTCGGAGGATGG - Intronic
1180142434 21:45900536-45900558 TATCCCTCTGGCTCTGAGGACGG - Intronic
1183784846 22:40023376-40023398 TGTACCTCTGGTTTGGAGGAAGG + Intronic
1183856430 22:40637872-40637894 TCTCCCATTGCTGGGGAGGAAGG - Intergenic
1184182198 22:42837264-42837286 TCTCACTTTGGTTCCCAGGTTGG - Intronic
1185051469 22:48556348-48556370 TCTCCCTGTGGTGCGCAGGATGG - Intronic
1185225604 22:49650220-49650242 TTTCCCTTTAGTCCGGTGGAAGG - Intronic
950653535 3:14422646-14422668 TCTACCTCTGGCTGGGAGGAGGG - Intronic
951819765 3:26795072-26795094 TTGCCCTGTGGTTGGGAGGAGGG + Intergenic
951948738 3:28173832-28173854 TATCACTTTGGTCAGGAGGAAGG - Intergenic
954124119 3:48518692-48518714 TCTGCCTGTGGGTCTGAGGAAGG - Exonic
957570680 3:81944581-81944603 TCTCCCTTTGTTTCCCAGGGTGG + Intergenic
959008483 3:101047113-101047135 TCTCCCTTTGGCTTGGGGAAAGG - Intergenic
962648452 3:137463857-137463879 TCTCCCTTTAGATGGGAGGGAGG - Intergenic
964417003 3:156458187-156458209 TCTGCCTTGGGTTCAAAGGAAGG - Intronic
965178238 3:165364463-165364485 TCTCTCTGTGGTTCAGATGAGGG + Intergenic
969719988 4:8888289-8888311 TCTCCCTTTGGTACTGGGGAAGG - Intergenic
972280114 4:37593822-37593844 TCCACCTTTGGTCCGGGGGAAGG + Intronic
984127197 4:175826128-175826150 TCTCCCTTTGGTACCCAGGCTGG - Intronic
984981438 4:185285971-185285993 TCTCCCTTTGTTTCCCAGGCTGG + Intronic
987813797 5:22874179-22874201 TGTCCCTTTGGCTGGCAGGAAGG + Intergenic
993528186 5:88992556-88992578 TCTACCTTTGGTTTTGATGATGG + Intergenic
995203250 5:109449734-109449756 TCTCCCTTTGTTTCCCAGGCTGG + Intergenic
997476154 5:134143700-134143722 CCTCCCTTTGGGTCAGAGGAGGG - Intronic
998277352 5:140769473-140769495 TCACCCTTTGGTTCTAGGGAAGG + Intergenic
998743842 5:145234394-145234416 TCTACCTTTGGTTAAGAGTAAGG - Intergenic
999231579 5:150065152-150065174 GCCCCCTTTGGTGGGGAGGATGG - Intronic
1003367246 6:5486557-5486579 TTTCCCTTTGCTTGTGAGGAGGG + Intronic
1003875421 6:10432035-10432057 TCTCCCTTTGTTGCCGAGGCTGG + Intergenic
1004149517 6:13102317-13102339 CCTCTCTTTGGCTCGGAGTAAGG + Intronic
1006531966 6:34663224-34663246 TCTCACTTTGTTTCGCAGGCTGG - Intronic
1007767686 6:44170700-44170722 TCTACCTTTGGAAGGGAGGATGG + Intronic
1008874846 6:56314341-56314363 TCTCTCTTTTGTTTGAAGGAAGG - Intronic
1009812104 6:68681352-68681374 TCTCCCTTTGTTTCCCAGGTTGG + Intronic
1012847394 6:104407840-104407862 TCTCCCTTTAGGTTGGAAGAAGG - Intergenic
1013243617 6:108268286-108268308 AATACCTTTGGTTCAGAGGAGGG + Intergenic
1017414409 6:154204737-154204759 TCTATCTGTGGTTTGGAGGATGG - Intronic
1020882897 7:13785319-13785341 TCTCCCTTTGTTTCCCAGGCTGG + Intergenic
1023301403 7:38776034-38776056 TCTCCCTTTGAAGCTGAGGACGG - Intronic
1024750925 7:52464799-52464821 TCTCCCTTTGGTACCCAGGCTGG + Intergenic
1026818866 7:73533218-73533240 TCTCCCTTTGTTGCTGAGGCTGG + Intergenic
1027943951 7:84722537-84722559 TCTCCCTGTGGCTCTCAGGAGGG - Intergenic
1033928246 7:146490085-146490107 ACTGCCTTTGGTTTGGAGGGGGG + Intronic
1034115252 7:148578420-148578442 TCTCCCTTTGTTTCCCAGGCTGG - Intergenic
1034691543 7:153018182-153018204 TCTCCCTCTGGTTCCCAGGCTGG + Intergenic
1036982573 8:13486985-13487007 TCTCCCTGTGCTTCTGTGGATGG + Intronic
1037414085 8:18630104-18630126 TTTCCCTTTGGTTCTGAGGCAGG + Intronic
1038664067 8:29522321-29522343 TCTTCTTTAGGTTGGGAGGAGGG + Intergenic
1042245728 8:66707150-66707172 TCTCACTTTGGTACCCAGGATGG + Intronic
1044948616 8:97414484-97414506 TCTGCCTGTGGTGTGGAGGAAGG - Intergenic
1049236779 8:141516085-141516107 GCTGCCTTTGGCTGGGAGGAGGG - Intronic
1049923556 9:387573-387595 TCTCCCTTTGGACTGGATGAGGG + Intronic
1052702042 9:31949399-31949421 TCTCCCTTTGATGCCCAGGATGG - Intergenic
1054975738 9:71142915-71142937 TTTCCCTATGGTTCCCAGGATGG - Intronic
1056144629 9:83717479-83717501 TCTCCCTGTGTTTCACAGGATGG + Intergenic
1057113973 9:92502835-92502857 TCTCACTTTGTTACGCAGGATGG + Intronic
1057326822 9:94072600-94072622 TCTCCCTATGGTCAGGAAGAAGG - Intronic
1185432115 X:17451-17473 TCTCCCTGTGGTTCGGAGGGTGG - Intergenic
1185441431 X:230165-230187 TCTCCCTGTGGTTCGGAGGGTGG - Intergenic
1186497628 X:10024511-10024533 TCTCCCTTTGGTTCGGAGGAAGG + Intronic
1186539857 X:10389456-10389478 TATCCCTGTGGTTCTGTGGATGG - Intergenic
1189984625 X:46543447-46543469 TCTTCATGTGGTTTGGAGGAAGG + Intronic
1191992263 X:67051148-67051170 TCTCCCTTTGGTTACCAGAATGG + Intergenic
1196758940 X:119182229-119182251 TCTCCCTTTGTTTCTCAGGCTGG - Intergenic
1200424648 Y:3007724-3007746 TCTCCCTCTGGAGGGGAGGATGG + Intergenic