ID: 1186497630

View in Genome Browser
Species Human (GRCh38)
Location X:10024514-10024536
Sequence CCCTTTGGTTCGGAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186497623_1186497630 -6 Left 1186497623 X:10024497-10024519 CCGAGCCATTCGGTTCTCCCTTT 0: 1
1: 0
2: 0
3: 1
4: 131
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1186497622_1186497630 -5 Left 1186497622 X:10024496-10024518 CCCGAGCCATTCGGTTCTCCCTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1186497617_1186497630 22 Left 1186497617 X:10024469-10024491 CCTAAGATGCTCCGAGCCATTCA 0: 1
1: 0
2: 0
3: 9
4: 57
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1186497619_1186497630 6 Left 1186497619 X:10024485-10024507 CCATTCAGTGCCCCGAGCCATTC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1186497618_1186497630 11 Left 1186497618 X:10024480-10024502 CCGAGCCATTCAGTGCCCCGAGC 0: 1
1: 0
2: 0
3: 33
4: 139
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1186497621_1186497630 -4 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497630 Original CRISPR CCCTTTGGTTCGGAGGAAGG AGG Intronic
901637358 1:10676505-10676527 CCCCTTTGTTCAGAGGATGGTGG - Intronic
903768170 1:25748022-25748044 CTCTTTGGGTTGGAGAAAGGTGG + Intronic
910676935 1:89824157-89824179 TTCTTTGTTTAGGAGGAAGGGGG - Intronic
913702406 1:121385615-121385637 CTCTTTGCTGAGGAGGAAGGAGG + Intronic
914042969 1:144066111-144066133 CTCTTTGCTGAGGAGGAAGGAGG + Intergenic
914135117 1:144894377-144894399 CTCTTTGCTGAGGAGGAAGGAGG - Intronic
921545293 1:216467453-216467475 ACCTTTGGTTTGGAGGAAGTTGG - Intergenic
921753647 1:218826820-218826842 CCCTTTAGTTCAGAGGCAGTAGG - Intergenic
922342803 1:224671012-224671034 CCCTCTTGCTCGGAGGAAGTTGG - Intronic
1066546185 10:36503035-36503057 CCCTTGACTTAGGAGGAAGGAGG - Intergenic
1074214635 10:111372509-111372531 CCCTGTGGTTTAGAGAAAGGAGG - Intergenic
1074874036 10:117600654-117600676 CCCTTTAGCTGGGAGGGAGGAGG - Intergenic
1076074973 10:127526399-127526421 CCTATTTGTTAGGAGGAAGGTGG + Intergenic
1077543982 11:3160888-3160910 CCCTGTGCTTCTGAGCAAGGCGG - Intronic
1081704672 11:45174620-45174642 CCAATTGGTTAGGAGAAAGGAGG - Intronic
1082802001 11:57421573-57421595 AACTTTGGTTGGGAAGAAGGTGG - Intronic
1084207662 11:67605364-67605386 CCCTTTGGGGCAGAAGAAGGGGG - Intronic
1086894966 11:92301443-92301465 CCCTTCCGTTAGGAGGGAGGGGG + Intergenic
1088665021 11:112085929-112085951 CCTTTTGGGTGGGAGGAAGAGGG - Intronic
1089702611 11:120254613-120254635 GGCTTTGGTTTGGAGGAAGAGGG + Intronic
1091488657 12:914271-914293 CCCTTTGGTTAGGACCAAAGAGG + Intronic
1091724173 12:2834250-2834272 ACCTGTGGTTCGGGGGAAGCAGG + Intronic
1091772927 12:3164996-3165018 TCCTTTGGTTGGGAGGAAAGAGG + Intronic
1092597431 12:10022870-10022892 ACCTTGGGAACGGAGGAAGGTGG + Intergenic
1092644190 12:10551472-10551494 CCCCGTGGCTCGGAGGGAGGAGG + Intergenic
1095940550 12:47724206-47724228 CCTGTTGGTTGGGAGGAAGGTGG - Intronic
1097961193 12:65533449-65533471 CCTTTTGATCCTGAGGAAGGAGG - Intergenic
1098460232 12:70725041-70725063 CCCTTTCTTTCTCAGGAAGGTGG - Intronic
1101131638 12:101697201-101697223 CCTTTCTGTACGGAGGAAGGCGG - Intronic
1105592401 13:21805430-21805452 TCCTTTGGTCAGGGGGAAGGAGG + Intergenic
1105890384 13:24678391-24678413 CCTTTTGGAACGGAAGAAGGAGG + Intergenic
1106187999 13:27425549-27425571 CCCTTGGGGTGGGAGGCAGGTGG + Intronic
1107159810 13:37212361-37212383 CCCTTTAGTTTTGAGGAAGACGG + Intergenic
1113782359 13:112983885-112983907 CCTTTGGGTTAGGAGGCAGGTGG + Intronic
1114427213 14:22633974-22633996 CCCTTTGGTTCTGAGCAGTGTGG - Exonic
1115219911 14:31048836-31048858 CCCTGTGGTTTTGAGGGAGGAGG + Intronic
1119103908 14:71906354-71906376 TCCTTTGGTTTGGGGTAAGGTGG - Intergenic
1122459290 14:101882188-101882210 CCCGTAGGATTGGAGGAAGGTGG - Exonic
1129902504 15:79161666-79161688 ACCTTGAGTTCGGAGGCAGGAGG + Intergenic
1134272158 16:12742530-12742552 CACGGTGGTTTGGAGGAAGGTGG - Intronic
1134887487 16:17806571-17806593 CCTTCTGGTTATGAGGAAGGAGG - Intergenic
1135547702 16:23377044-23377066 CCCTGTGGTTAGGTGGCAGGAGG - Intronic
1135915960 16:26605700-26605722 CCCTTTTGTTTGGAGAAAGAAGG - Intergenic
1136294071 16:29291826-29291848 TCCTTCGGTTTGGATGAAGGTGG + Intergenic
1140931543 16:79632817-79632839 CCCTCAGATTCGGAGGAAGAGGG - Intergenic
1142099972 16:88265872-88265894 TCCTTTGGTTTAGATGAAGGTGG + Intergenic
1149458745 17:56810531-56810553 CCCTTTGCTTGGGAAGAGGGTGG - Intronic
1150246624 17:63680565-63680587 CTCTTGGGCTAGGAGGAAGGAGG + Intronic
1151145423 17:72036022-72036044 CCCTTTGGTCTAGAGGAAGATGG - Intergenic
1152379877 17:79936963-79936985 CACTTTGCCTCAGAGGAAGGAGG - Exonic
1153852357 18:9107494-9107516 CATTTTGGTTAGGGGGAAGGTGG + Intronic
1155244613 18:23895168-23895190 TCATTTGGATCAGAGGAAGGAGG - Intronic
1157280785 18:46345136-46345158 CCCTCTGGTTCCGTGGCAGGTGG - Intronic
1160741640 19:689031-689053 CCGTTAGGTTCAGAGGAAGCGGG + Intronic
1161775609 19:6260534-6260556 CCCGTGGATTCGGAGGCAGGTGG - Intronic
1162549374 19:11350078-11350100 GCCTTGGGGTGGGAGGAAGGAGG - Intronic
1164577262 19:29412853-29412875 CCCTTTGGCTCTGAGCATGGTGG - Intergenic
1165215699 19:34270617-34270639 GCCATGGGTTCAGAGGAAGGAGG - Intronic
1165434355 19:35788177-35788199 CCCGTTGTTTCTGGGGAAGGCGG - Exonic
1165735154 19:38171185-38171207 CCCTGTGGTAGGGAGGAGGGTGG + Intronic
1166399376 19:42466804-42466826 TCCTTTGGCTCTGGGGAAGGAGG + Intergenic
1168237338 19:55071577-55071599 GCCTTTGGGTCTGAGGGAGGAGG - Intergenic
925247685 2:2398960-2398982 TCCTTTGGAGCTGAGGAAGGTGG - Intergenic
925888448 2:8413369-8413391 CCCTTTGGTGCTGAGGCAAGGGG - Intergenic
925927438 2:8680361-8680383 CCCCTCAGTTTGGAGGAAGGAGG - Intronic
926946980 2:18199092-18199114 GCCTTTGGTTGGGAAGGAGGTGG + Intronic
928742385 2:34370520-34370542 AACTTTGGTTAGAAGGAAGGGGG - Intergenic
934060104 2:88284864-88284886 ACCTTTGGTTGGCAGGCAGGAGG - Intergenic
937986999 2:127642464-127642486 CCCTCTGGTTTGGAGGAGGAGGG - Intronic
938291415 2:130152758-130152780 CCCTGTGGGGCGGAGGCAGGTGG - Exonic
948987307 2:241533336-241533358 CCCTGTGCTAAGGAGGAAGGTGG - Intergenic
1168930931 20:1623371-1623393 ATCTTTGGTCTGGAGGAAGGTGG + Intergenic
1169346328 20:4830889-4830911 CACTTTGTTTAGCAGGAAGGTGG - Intergenic
1169656868 20:7934004-7934026 CACTTTGGTTTGGGGGAAGCAGG + Intronic
1172996236 20:39072274-39072296 CCCTTGGGATCGGAGAAATGGGG + Intergenic
1173648124 20:44646257-44646279 CCTTTTGCTTCGGAGGAGGAAGG - Intronic
1174128608 20:48326520-48326542 CCCTGTGGTTCTGATGCAGGCGG - Intergenic
1175771585 20:61627768-61627790 CCCTTTGATGTGGAGGAGGGTGG + Intronic
1175815315 20:61880555-61880577 GCCTCTGTTTCGGAGGGAGGTGG - Intronic
1181407903 22:22697859-22697881 CCCTTTGCCTCAGAGGAGGGCGG - Intergenic
1181632221 22:24157219-24157241 CCCTAAGGTTGGGAGGAAAGGGG - Intronic
1183856428 22:40637869-40637891 CCCATTGCTGGGGAGGAAGGCGG - Intergenic
1184027123 22:41866036-41866058 CCCTGTGGTGAGGAGGAAAGAGG + Intronic
1184099282 22:42333572-42333594 CCCTTTGCCTCTGAGGCAGGTGG - Intronic
1184900945 22:47446051-47446073 CCCTTTGGTGGGGAGGAAACAGG + Intergenic
949557835 3:5173258-5173280 GCCTTTGGGTGGGAGGAAGTGGG + Intronic
949947474 3:9202045-9202067 TTCTTTGGTTTGGAGGATGGGGG + Intronic
950012120 3:9731382-9731404 GCCTTGGTCTCGGAGGAAGGCGG - Intergenic
950452170 3:13071755-13071777 GCCTCTGGTTCGGGGGATGGCGG - Intronic
950452201 3:13071855-13071877 GCCTCTGGTTCGGGGGATGGCGG - Intronic
953713722 3:45297336-45297358 CCCTTTGGTAAGGATGATGGCGG + Intergenic
954686634 3:52373881-52373903 CCCGTAGGATTGGAGGAAGGTGG - Intronic
960609389 3:119541498-119541520 CCCTTTGGTTCTGAGCAAAGAGG + Intronic
962193503 3:133336238-133336260 CCCTTAGGTTGGGGGAAAGGTGG - Intronic
969499050 4:7542097-7542119 CCCTTTGGTTTGGCTGAAGCAGG - Intronic
970216831 4:13767491-13767513 CCCTTTGGGATGAAGGAAGGAGG + Intergenic
972280116 4:37593825-37593847 ACCTTTGGTCCGGGGGAAGGAGG + Intronic
973730352 4:53816787-53816809 CCCTCTGGTATGGAGGGAGGTGG + Intronic
976149741 4:82079952-82079974 CCCTGGGGTTGGGTGGAAGGTGG - Intergenic
985760349 5:1745737-1745759 TTCTTTGGTGCTGAGGAAGGAGG + Intergenic
987179727 5:15354922-15354944 CCCTGTGGTGGTGAGGAAGGGGG - Intergenic
991993290 5:72362567-72362589 CACTTTGGTTGGGAGGAGGAAGG - Intergenic
992768677 5:80027168-80027190 CCCTTTGTTTGCCAGGAAGGTGG - Intronic
995682343 5:114733559-114733581 GCCTCTGGTTAGGAGAAAGGTGG + Intergenic
996310035 5:122094254-122094276 ACCATTGGTTAGGAGAAAGGGGG - Intergenic
998725821 5:145013101-145013123 ACCAGTGGTTAGGAGGAAGGAGG + Intergenic
1001063885 5:168519741-168519763 GACTTGGGTTCGGGGGAAGGGGG + Intergenic
1002851693 6:1002566-1002588 CCCTCTGGCTCTGGGGAAGGGGG - Intergenic
1005357057 6:24995045-24995067 CCATCTGGTTCTGAGGAAGAAGG + Intronic
1006495550 6:34420543-34420565 GCCCTTGGTTCAGAGGAAGTTGG - Intronic
1014821493 6:125993022-125993044 CCTTCTGGTTGGGAGGAAAGGGG + Intronic
1018716433 6:166536244-166536266 CTCTTTGGAGCGGAGGCAGGAGG + Intronic
1018802834 6:167236663-167236685 CCCTTTAGTCAGGAGGAGGGAGG + Intergenic
1027869680 7:83691251-83691273 CCCTTGGGTTTGGAGCAAGCAGG + Intergenic
1031973286 7:128078757-128078779 TCCTTTGGCTTGGGGGAAGGCGG - Intronic
1032737391 7:134704819-134704841 CCCTTTGGGTGTGAGGAAGAGGG - Intergenic
1035274415 7:157738885-157738907 GACTTTGGTTTGGAGGAAGATGG + Intronic
1036949946 8:13131749-13131771 CCCTTTGGTGCAGATGAAGGAGG + Intronic
1046956930 8:120071530-120071552 CCCTTAGGTTAGAAGGGAGGTGG - Intronic
1048073096 8:131041271-131041293 CCATTTGGCTCGGAGCTAGGAGG + Exonic
1049586103 8:143433039-143433061 CCCTTGGGTTGGGAGGCTGGCGG - Intergenic
1055101026 9:72465927-72465949 CTTCTTGGTTTGGAGGAAGGAGG + Intergenic
1056478820 9:86980256-86980278 CTCTGTGGTTAGGAGGAGGGAGG + Intergenic
1056578409 9:87872808-87872830 CCCTGGGGCTGGGAGGAAGGTGG - Intergenic
1056845344 9:90032623-90032645 CCCTGTGGTTCGGCAAAAGGAGG - Intergenic
1061889601 9:133610911-133610933 CCCATTAGTTAAGAGGAAGGAGG - Intergenic
1186497630 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG + Intronic
1188702348 X:33280557-33280579 CCCTTTGTTTTGGACGAAGCAGG - Intronic
1195698282 X:107682903-107682925 CCATGTGGTTCTGAGGCAGGTGG - Intergenic
1198478550 X:137018964-137018986 CCCTTTGGTTCAGTGGAAGACGG + Intergenic
1199710454 X:150465610-150465632 GCCTTTGGTGGTGAGGAAGGGGG - Intronic
1200038313 X:153347307-153347329 CCCTTTGATTGCGAGGAATGCGG + Exonic