ID: 1186497632

View in Genome Browser
Species Human (GRCh38)
Location X:10024515-10024537
Sequence CCTTTGGTTCGGAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186497622_1186497632 -4 Left 1186497622 X:10024496-10024518 CCCGAGCCATTCGGTTCTCCCTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497618_1186497632 12 Left 1186497618 X:10024480-10024502 CCGAGCCATTCAGTGCCCCGAGC 0: 1
1: 0
2: 0
3: 33
4: 139
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497625_1186497632 -10 Left 1186497625 X:10024502-10024524 CCATTCGGTTCTCCCTTTGGTTC 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497621_1186497632 -3 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497619_1186497632 7 Left 1186497619 X:10024485-10024507 CCATTCAGTGCCCCGAGCCATTC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497623_1186497632 -5 Left 1186497623 X:10024497-10024519 CCGAGCCATTCGGTTCTCCCTTT 0: 1
1: 0
2: 0
3: 1
4: 131
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188
1186497617_1186497632 23 Left 1186497617 X:10024469-10024491 CCTAAGATGCTCCGAGCCATTCA 0: 1
1: 0
2: 0
3: 9
4: 57
Right 1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497632 Original CRISPR CCTTTGGTTCGGAGGAAGGA GGG Intronic
900509001 1:3049361-3049383 CCTCAGGTTGGGAGCAAGGAGGG - Intergenic
900526652 1:3132578-3132600 CCCTCGGTAAGGAGGAAGGAAGG - Intronic
901768391 1:11518172-11518194 CCTGGGGTTGGGAGGATGGAGGG + Intronic
902569891 1:17340555-17340577 CCTGTGGTTTGGAGGAATGCAGG + Intronic
902854663 1:19192737-19192759 CTTTTGATTCGGAGGAGGGATGG - Intronic
903455739 1:23485080-23485102 CCTTTGGGGCGGATGAGGGATGG + Intergenic
905271055 1:36787727-36787749 CCTTTGGCACTGAGGAAGGGAGG + Intergenic
906166084 1:43687393-43687415 CCTCTGTTTGGGAAGAAGGAGGG + Intronic
906746104 1:48223202-48223224 CCTTGGGGTGGGAAGAAGGAAGG - Intronic
913236997 1:116793878-116793900 CCTGAGGTTAGGGGGAAGGAGGG - Intergenic
920646715 1:207809121-207809143 CCTATGGTGGGGAGGGAGGAGGG - Intergenic
1064147019 10:12833656-12833678 CCTTTGGATATGAGAAAGGAAGG + Exonic
1068884200 10:62081496-62081518 CCTCTGCTTCTGAGGAAGGGAGG + Intronic
1070469974 10:76769008-76769030 CCTTTGGTTAGAAGGCATGATGG + Intergenic
1070510776 10:77158675-77158697 CCTTTGTTTCATAGGGAGGAAGG + Intronic
1072095982 10:92180437-92180459 CCATTGGGTTGGAGGAATGAAGG - Intronic
1073255202 10:102146650-102146672 CCTGTGGTGGGGAGGGAGGATGG - Exonic
1073696734 10:105877665-105877687 CCTATGGTTAGGAGGAGGCAAGG + Intergenic
1073705707 10:105981590-105981612 GCTGTGGTTATGAGGAAGGATGG + Intergenic
1074408597 10:113202519-113202541 CGTTTGTTTGGGAGAAAGGAAGG + Intergenic
1076234899 10:128856035-128856057 CCTTAGGGTGGGAGAAAGGAAGG - Intergenic
1077869901 11:6252913-6252935 GCTTTAGATCGGAGTAAGGAAGG - Intergenic
1080974230 11:37316931-37316953 CCTTTGGAGAGGATGAAGGATGG - Intergenic
1083180649 11:60982603-60982625 CCTTTAGTTTGGTTGAAGGAGGG - Intronic
1083414623 11:62517547-62517569 CCTTTGGTCCTGAGAAATGAAGG + Exonic
1086109976 11:83189243-83189265 CCTTTTGTGAGTAGGAAGGAAGG - Intergenic
1087012759 11:93529319-93529341 GTTTTGTTTGGGAGGAAGGAGGG + Intronic
1088541955 11:110921925-110921947 CTCCTGGTTAGGAGGAAGGAGGG - Intergenic
1089602576 11:119624532-119624554 CCTTTGATGAGGAGGCAGGAGGG - Intronic
1092597433 12:10022871-10022893 CCTTGGGAACGGAGGAAGGTGGG + Intergenic
1092644192 12:10551473-10551495 CCCGTGGCTCGGAGGGAGGAGGG + Intergenic
1092956506 12:13555611-13555633 CACTTGGTTGGGAGAAAGGATGG + Exonic
1094168545 12:27466849-27466871 CCTTTGGTGCTGAGGAAAGGAGG + Exonic
1094205139 12:27831767-27831789 ACTTGGTTTCGGAGGAAGGCAGG - Intergenic
1097053609 12:56237760-56237782 CCTGTGGTTGGGGGGAAGGAAGG - Exonic
1098020700 12:66152785-66152807 CCTTTGGTGGGGAGAAGGGAAGG + Intronic
1098084934 12:66832460-66832482 TCGTTGGTTCCCAGGAAGGATGG - Intergenic
1100159921 12:91845990-91846012 ACTTTTTTTCTGAGGAAGGATGG - Intergenic
1101332191 12:103766119-103766141 CCTTGTGTTGGGAGGCAGGATGG - Intronic
1101601628 12:106214894-106214916 TCTTTGGTTCTGAGTAAGGGTGG - Intergenic
1104188367 12:126454474-126454496 CCATGGGGTCAGAGGAAGGATGG - Intergenic
1104208853 12:126667560-126667582 CCTTTGGTTCTAAGGGAGGCAGG - Intergenic
1105032323 12:132892539-132892561 CCTTGGGTTGGGAAGAAGGGCGG - Intronic
1105890385 13:24678392-24678414 CTTTTGGAACGGAAGAAGGAGGG + Intergenic
1108418116 13:50221595-50221617 CCTTTGGTGAAGAGGAGGGATGG + Intronic
1116548952 14:46209683-46209705 ACTTTGGATGGGAGGAAGGAAGG - Intergenic
1117417501 14:55510772-55510794 TCTGGGGTTAGGAGGAAGGAAGG - Intergenic
1118656616 14:67957396-67957418 CCTTTGGTTTTGAAAAAGGAAGG - Intronic
1119323715 14:73746360-73746382 CCTTTGCCTAGGAGGAAGGCAGG - Intronic
1119421760 14:74511449-74511471 CCTTTGGTTGGGGAGAGGGATGG + Intronic
1119821469 14:77619975-77619997 GGTTTGGTTAGGAGGAAGGAAGG - Intergenic
1120825892 14:88955023-88955045 CCTAGGGTTGGGAGGAAAGAAGG - Intergenic
1121860889 14:97316991-97317013 CCTTTTGTACGGCTGAAGGAGGG + Intergenic
1122601100 14:102922480-102922502 CCTTAGGTTCTCAGGAAGAAGGG - Intergenic
1125265019 15:37868736-37868758 CCTTTGTTTCTGGGGAAGTAGGG + Intergenic
1125781013 15:42268146-42268168 CCTTATGTTTGGAGAAAGGATGG - Intronic
1126991947 15:54388199-54388221 ATTTTGGTCTGGAGGAAGGAAGG - Intronic
1128081913 15:64861934-64861956 ATTTTTGTGCGGAGGAAGGAAGG + Intronic
1129902506 15:79161667-79161689 CCTTGAGTTCGGAGGCAGGAGGG + Intergenic
1130104344 15:80918359-80918381 CCATTGGGTAGGAGGGAGGAAGG - Intronic
1132032197 15:98447273-98447295 TCTTTGGGAGGGAGGAAGGACGG - Intronic
1134887486 16:17806570-17806592 CTTCTGGTTATGAGGAAGGAGGG - Intergenic
1136171836 16:28494595-28494617 CCTTTGGTCCTGGGGAAGGTTGG + Intronic
1137055252 16:35742814-35742836 CTTTGGGTTGGGAGGAAGGGTGG + Intergenic
1139264881 16:65629280-65629302 CCATTGGTGCAGAGGAAGGATGG - Intergenic
1139308712 16:66010210-66010232 CCTTTGGTCCAGAGAAAGAAAGG - Intergenic
1141716464 16:85729838-85729860 CCTTTGGCGCTGAGGAGGGAGGG + Intronic
1144087439 17:11823436-11823458 CTTTTGGTTTTGAGGATGGAAGG - Intronic
1144135660 17:12292363-12292385 CCTTTGATTCTGAGGAAACATGG + Intergenic
1144375425 17:14635207-14635229 CCCTTGGTTCCTAGGAAGCAAGG - Intergenic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146365813 17:32226833-32226855 TCTTTGGTTCAGAAGAAGGCAGG + Intronic
1146676830 17:34779470-34779492 CATGTGGTTAGGTGGAAGGAAGG + Intergenic
1147469012 17:40639562-40639584 CCTTTCTTTGGGAGAAAGGAGGG - Intronic
1147976395 17:44250491-44250513 CCTTTGATGAGGAGGAAGGTCGG - Exonic
1148615678 17:48998168-48998190 CCGTCGGTGGGGAGGAAGGATGG - Intronic
1148852643 17:50562195-50562217 ACTTTGGGGCGGGGGAAGGAGGG - Intronic
1149138542 17:53400776-53400798 CTTTGGGTTTGGGGGAAGGAAGG - Intergenic
1149435619 17:56631002-56631024 CCTGTGGTTCTTAGGAAGGATGG + Intergenic
1151202115 17:72476262-72476284 CCTTTGCTTCCGAGGTAGAAGGG - Intergenic
1152250963 17:79212330-79212352 CATTTGCCTGGGAGGAAGGAAGG + Intronic
1152511860 17:80795422-80795444 CCTTTGGTGCTGGGGAGGGAGGG - Intronic
1153301297 18:3594353-3594375 CTTTTGGTTGGGAGGGAGGGAGG - Intronic
1153568633 18:6445966-6445988 CCTTAGGCTTGGGGGAAGGAGGG - Intergenic
1156001435 18:32389053-32389075 CATTTGGTGGGGAGGGAGGAGGG + Intronic
1156043061 18:32845224-32845246 CCTTTGGTTTGGATAAGGGAGGG + Intergenic
1156211544 18:34949403-34949425 CCTCTTGTTCGTAGAAAGGAGGG + Intergenic
1156373465 18:36491574-36491596 CCTGGGGTTTGGAGGAGGGAGGG - Intronic
1160629241 18:80233775-80233797 CCTTTGCTTCTGAGACAGGATGG - Intronic
1161325354 19:3661078-3661100 CCTTCGCTGTGGAGGAAGGACGG + Exonic
1162427078 19:10603088-10603110 CCTTTGGTGAGGGGGCAGGAAGG + Intronic
1162549372 19:11350077-11350099 CCTTGGGGTGGGAGGAAGGAGGG - Intronic
1163427552 19:17247448-17247470 CCTTTGGTTCTGAGGCTGCATGG + Intronic
1163783083 19:19260766-19260788 ACCTTGCTTCTGAGGAAGGAGGG - Intronic
1165215697 19:34270616-34270638 CCATGGGTTCAGAGGAAGGAGGG - Intronic
1165938454 19:39403345-39403367 CCCCTGGTTCCGAGGGAGGAGGG + Intergenic
1166297236 19:41895144-41895166 CCTCTGGGTCTGAGGGAGGAGGG + Intronic
1166313451 19:41975996-41976018 CCTCTGGGTCTGAGGGAGGAGGG - Intronic
1166313493 19:41976108-41976130 CCCTTGGGTCTGAGGGAGGAGGG - Intronic
1166316296 19:41991884-41991906 CCCTTGGGTCTGAGGGAGGAGGG + Intronic
1166863970 19:45825252-45825274 CTTGTGGTTCTGAGGCAGGAGGG + Exonic
1167248774 19:48390152-48390174 CTTTTGGGTCTGAGGGAGGAAGG - Intronic
1167276650 19:48543932-48543954 CCTCTGGGTCTGAGGGAGGAGGG - Intergenic
1167327732 19:48835750-48835772 CCTCTGGGTCTGAGGGAGGAAGG + Intronic
1167489153 19:49781843-49781865 CTTCTGGTTCTGAGGGAGGAGGG + Intronic
1167560833 19:50225910-50225932 CCTCTGGGTCTGAGGGAGGAGGG + Intronic
1167560945 19:50226207-50226229 CCTCTGGGTCTGAGGGAGGAGGG + Intronic
1167630865 19:50625640-50625662 CCTCTGGGTCTGAGGGAGGAGGG - Intronic
1167678729 19:50906515-50906537 CCTCTGGGTCTGGGGAAGGAGGG + Exonic
1167689094 19:50974832-50974854 CTCTTGGGTCTGAGGAAGGAGGG + Intergenic
1167695969 19:51015803-51015825 CCCCTGGGTCTGAGGAAGGATGG - Intronic
1167743395 19:51337752-51337774 CCCTTGGGTCTGAGGGAGGAGGG + Intronic
1167746438 19:51353913-51353935 CTCTTGGGTCTGAGGAAGGAGGG - Intronic
1168116083 19:54222010-54222032 CATTTTGTTCTGATGAAGGAAGG - Exonic
1168119065 19:54241758-54241780 CATTTTGTTCTGATGAAGGAAGG - Exonic
1168185479 19:54697310-54697332 CATTTTGTTCTGATGAAGGAAGG + Intronic
1168237336 19:55071576-55071598 CCTTTGGGTCTGAGGGAGGAGGG - Intergenic
925247683 2:2398959-2398981 CCTTTGGAGCTGAGGAAGGTGGG - Intergenic
926196389 2:10765916-10765938 CCTTTGGCAGGAAGGAAGGAGGG + Intronic
926946982 2:18199093-18199115 CCTTTGGTTGGGAAGGAGGTGGG + Intronic
928927896 2:36597627-36597649 GGTTTGGTTTGCAGGAAGGAGGG + Intronic
930186889 2:48419958-48419980 CCTTTGGCTGGGAGCACGGAGGG + Intergenic
931974247 2:67625564-67625586 TTTTTGGTTTGGAGAAAGGAAGG - Intergenic
935011580 2:99141249-99141271 CCGGCGGATCGGAGGAAGGACGG + Intronic
936286924 2:111188088-111188110 CCTTTTGCTCAGAGGAAGGGAGG + Intergenic
938052182 2:128184514-128184536 CTTTTGTTAGGGAGGAAGGATGG - Intronic
941227777 2:162869358-162869380 CATTTGGTTGGGAGAAAGTAAGG + Intergenic
942318223 2:174713529-174713551 CCTGTGGTCAGGTGGAAGGAAGG + Intergenic
943625161 2:190190226-190190248 CCTTTGGGTGGGAAGAAGTAAGG - Intronic
947260212 2:228212855-228212877 CCTTTGGTTCAGAGGGAGAAAGG + Intergenic
1169122037 20:3102569-3102591 CCTTTGGGTGGAAGGGAGGAAGG + Intergenic
1172222401 20:33283031-33283053 CCTGAGGTTTGGAGAAAGGAAGG - Intronic
1173648123 20:44646256-44646278 CTTTTGCTTCGGAGGAGGAAGGG - Intronic
1179801851 21:43814942-43814964 CCTCTGTTTTGGAGGGAGGAAGG + Intergenic
1182327114 22:29521822-29521844 CCTTTGGTTCAGGGAAAGAATGG - Intronic
1184900947 22:47446052-47446074 CCTTTGGTGGGGAGGAAACAGGG + Intergenic
1185066832 22:48636686-48636708 CCTGGGGTTCGGAGGCAGCAGGG - Intronic
949947475 3:9202046-9202068 TCTTTGGTTTGGAGGATGGGGGG + Intronic
951634207 3:24755458-24755480 CCTTTGTTTCTGTTGAAGGAAGG - Intergenic
953687376 3:45088552-45088574 CCTGTGGCCCAGAGGAAGGAAGG - Intronic
957338074 3:78858307-78858329 CCTTTGGTCCTGGTGAAGGAGGG - Intronic
958443312 3:94182749-94182771 CCTTTCCTTGGGAGAAAGGAAGG - Intergenic
962851968 3:139314744-139314766 CCTCCCGTTCGGAGGGAGGAAGG - Intronic
964253818 3:154750914-154750936 CCTTTGTTTGGGAGAAAGTAAGG + Intergenic
967419851 3:189260861-189260883 CCTTTGGATCCGAGAAAGCAAGG - Intronic
969595975 4:8149491-8149513 CCACAGGTTCAGAGGAAGGAGGG + Intronic
969618770 4:8268546-8268568 CCTCTGGTCCAGAGGAGGGAGGG - Intergenic
970116757 4:12705954-12705976 CCTCTGGTTCTGAAGATGGAAGG - Intergenic
973738953 4:53901484-53901506 CTGTTGGTTCGAAGAAAGGAAGG + Intronic
976030100 4:80741643-80741665 CCTTGGGTTGGGGGGAGGGATGG + Intronic
976164485 4:82239945-82239967 ACTCTGGTTCAGAGCAAGGAAGG - Intergenic
979087977 4:116439277-116439299 GCTATTGTTCAGAGGAAGGAAGG + Intergenic
982245801 4:153349118-153349140 CCTTTGGTTTGGAGGAAATTTGG + Intronic
982371395 4:154637362-154637384 CTTGTGGTTCTGAGGAAAGAAGG + Intronic
982985505 4:162201052-162201074 CCTTGGGTCAGGTGGAAGGATGG + Intergenic
988029517 5:25745121-25745143 CCTTTGGTTAGGAGGGAAAAAGG + Intergenic
991993289 5:72362566-72362588 ACTTTGGTTGGGAGGAGGAAGGG - Intergenic
995066461 5:107868577-107868599 CCCTTGTTACGGAGGTAGGATGG + Intronic
996264356 5:121517979-121518001 CTTTTGATTGGGAGGAAGAAAGG - Intergenic
999231573 5:150065148-150065170 CCTTTGGTGGGGAGGATGGGAGG - Intronic
1001862223 5:175067380-175067402 CCTTTGGTGAGGAGGAAGAAAGG + Intergenic
1002983792 6:2168170-2168192 TCTTTCCTTCTGAGGAAGGAAGG - Intronic
1004196786 6:13512518-13512540 CCTTTGCTTGGGAGGAGGTATGG + Intergenic
1004350242 6:14884347-14884369 CCTGGGGGTAGGAGGAAGGAGGG + Intergenic
1005357058 6:24995046-24995068 CATCTGGTTCTGAGGAAGAAGGG + Intronic
1018077706 6:160231323-160231345 CTTTGGGTTGGGAAGAAGGACGG - Intronic
1019186413 6:170223231-170223253 CCCTTGGTGCGGAAGAAGCACGG + Intergenic
1021038501 7:15831319-15831341 CCTTTGGTGCATAGGAAGGCAGG - Intergenic
1021419938 7:20435136-20435158 ACTTTGGTTCAGAGGAATAAAGG - Intergenic
1022916632 7:34962430-34962452 CCATGGGTTAGGGGGAAGGAGGG + Intronic
1027484068 7:78737940-78737962 CCTTTGGGTCAGAGTAAGCAGGG - Intronic
1028101918 7:86831185-86831207 CCTTTGGGGCTGAGGAAGGGTGG + Intronic
1029317266 7:99726095-99726117 CTTTGGGTTGGGAAGAAGGATGG - Intronic
1030186695 7:106769465-106769487 CCTATGGCTCAGAGGACGGATGG + Intergenic
1030611710 7:111697185-111697207 TCTTTGGTTTGGAGCAAGAATGG - Intergenic
1032448419 7:132004386-132004408 CCTGGGGTTAGGAGGAGGGAGGG + Intergenic
1032916472 7:136495460-136495482 CCCTTGGTTTGGAAGAAGGTAGG + Intergenic
1033974964 7:147089850-147089872 CCTTTGGTGCAGAGTGAGGACGG - Intronic
1036184650 8:6613102-6613124 CCTGGGGTTCTGAGGAAGGCAGG + Intronic
1039455287 8:37701879-37701901 CCTCTTGTTGGGAGGAAGGAAGG + Intergenic
1041438860 8:57872119-57872141 CCTTTGTTTTAGAAGAAGGAAGG + Intergenic
1046613859 8:116454595-116454617 CTTTTGGATGGGAGAAAGGAGGG - Intergenic
1047463006 8:125086648-125086670 TCTTTGGGTTGAAGGAAGGAAGG - Intronic
1049236777 8:141516081-141516103 CCTTTGGCTGGGAGGAGGGATGG - Intronic
1051771230 9:20582393-20582415 GGTTTGGTGGGGAGGAAGGAAGG - Intronic
1054756084 9:68959456-68959478 CCTTTGGTGAGGAGGAAATAGGG - Intronic
1056306596 9:85296680-85296702 CTTGTGGTGGGGAGGAAGGAAGG - Intergenic
1056333616 9:85543300-85543322 CCTGTGATTCTCAGGAAGGAAGG + Intergenic
1056478821 9:86980257-86980279 TCTGTGGTTAGGAGGAGGGAGGG + Intergenic
1056845342 9:90032622-90032644 CCTGTGGTTCGGCAAAAGGAGGG - Intergenic
1060395284 9:123312369-123312391 CCTTGGGTGAGAAGGAAGGAAGG + Intergenic
1061119940 9:128636173-128636195 CCTTTGGCCCGGAGACAGGAAGG - Intronic
1061638405 9:131930051-131930073 CCTTTGTTTGGGAGAAAGTAAGG + Intronic
1062172807 9:135144813-135144835 TCTTTTGTCTGGAGGAAGGAGGG + Intergenic
1186497632 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG + Intronic
1190862145 X:54355395-54355417 ACTTTGGTTGGGAGGCAGGTAGG - Intronic
1192214218 X:69147058-69147080 CCTTTGGTTGTGAGGAGTGAAGG - Intergenic
1192784625 X:74324364-74324386 CCTTTTCTTGGGAGGAAGAAAGG + Intergenic
1193760868 X:85463340-85463362 CCATTGGTTTGGAGAAAGGGAGG + Intergenic
1194803328 X:98297981-98298003 GCTTTGCTTCTGATGAAGGAAGG - Intergenic
1196733247 X:118962582-118962604 CTTGTGGTAAGGAGGAAGGAAGG + Intergenic
1200370463 X:155719564-155719586 CCTTTCCTTAGGTGGAAGGAAGG - Intergenic
1200770268 Y:7118462-7118484 CCTTTTGTTCTGAGAAAGGCAGG - Intergenic