ID: 1186497634

View in Genome Browser
Species Human (GRCh38)
Location X:10024523-10024545
Sequence TCGGAGGAAGGAGGGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 1, 2: 6, 3: 70, 4: 847}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186497623_1186497634 3 Left 1186497623 X:10024497-10024519 CCGAGCCATTCGGTTCTCCCTTT 0: 1
1: 0
2: 0
3: 1
4: 131
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847
1186497625_1186497634 -2 Left 1186497625 X:10024502-10024524 CCATTCGGTTCTCCCTTTGGTTC 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847
1186497622_1186497634 4 Left 1186497622 X:10024496-10024518 CCCGAGCCATTCGGTTCTCCCTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847
1186497621_1186497634 5 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847
1186497619_1186497634 15 Left 1186497619 X:10024485-10024507 CCATTCAGTGCCCCGAGCCATTC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847
1186497618_1186497634 20 Left 1186497618 X:10024480-10024502 CCGAGCCATTCAGTGCCCCGAGC 0: 1
1: 0
2: 0
3: 33
4: 139
Right 1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG 0: 1
1: 1
2: 6
3: 70
4: 847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497634 Original CRISPR TCGGAGGAAGGAGGGGTGAG AGG Intronic
900332414 1:2142575-2142597 TCGAAGGAGGGATGGGTGAGAGG - Intronic
900466453 1:2827866-2827888 AGGGAGGAGGGAGGTGTGAGGGG + Intergenic
900493479 1:2965112-2965134 TGGGTGGAAGGATGGATGAGTGG - Intergenic
900522737 1:3113476-3113498 TCGGAGGAAGGAGGGAGGGAGGG + Intronic
900717814 1:4156481-4156503 TGGGAGGCAGGAGGGGGCAGAGG + Intergenic
901005810 1:6171039-6171061 TGGGAGGAAGCAGGAGGGAGAGG - Intronic
901178529 1:7322948-7322970 ACGGAGGAAGGGGAGGGGAGGGG - Intronic
901266425 1:7914210-7914232 GCGGGGGAGGGAGGGGGGAGGGG - Intergenic
901343754 1:8519702-8519724 TGGGTGGAAGGAGAGGTAAGTGG - Intronic
901391564 1:8949444-8949466 TAAGAGGAAGGGGTGGTGAGGGG + Intronic
901539084 1:9903175-9903197 TAGAAGGAAGGAGGGGAGGGAGG + Intronic
901790939 1:11653532-11653554 GCGGGGGAATGGGGGGTGAGGGG + Intronic
901884105 1:12210747-12210769 CAGGAGGAAGTAGGGGTGGGGGG - Intergenic
901906291 1:12414603-12414625 GGGGAGGAAGGAGGAGGGAGTGG + Intronic
902049374 1:13549710-13549732 TCAGAGGAAGGAGGGGCGCTGGG + Intergenic
902083354 1:13836970-13836992 TCAGGGGAAGGTGGGGTGGGAGG - Intergenic
902175981 1:14651311-14651333 TCTGAGGATGGAGGGGTGAGTGG + Intronic
902659021 1:17888435-17888457 GCGGCGGAAGGAGAGGTGGGAGG - Intergenic
902823391 1:18956735-18956757 GCAGAGGGAGGAGGGGTGGGCGG - Intergenic
902936609 1:19769311-19769333 GCAGAGAGAGGAGGGGTGAGGGG - Intronic
903016611 1:20366045-20366067 TTGGAGGAAGGAGGGGTGAGGGG - Intergenic
903212228 1:21824618-21824640 GCGGAGGAAGAGCGGGTGAGGGG + Exonic
903345673 1:22682642-22682664 TGGGAGGGAGGATGGGTGGGGGG - Intergenic
903524196 1:23980394-23980416 GCGGAGGTAGGAGGGGGAAGTGG - Intronic
903733483 1:25515160-25515182 TGGGAGGAAGGAGGTTGGAGAGG - Intergenic
903847875 1:26289333-26289355 TTGGAGGAGGTAGGGGTGAGTGG - Intronic
904329595 1:29749564-29749586 GGGCAGGAAGGAGGGGAGAGAGG + Intergenic
904366153 1:30012054-30012076 TGGGAGGAAAGAGGGAGGAGCGG + Intergenic
904807125 1:33140101-33140123 TAAGAGGAAAGAGGGGAGAGAGG + Intergenic
904928790 1:34069764-34069786 TTGGAGAAAGGAGGGGAAAGGGG + Intronic
905182972 1:36178017-36178039 TCGGAGGAAGGAGGAGGCAAAGG + Exonic
905261328 1:36721394-36721416 TCAGAGGCAGGAGGGGTGAGTGG - Intergenic
905400217 1:37696337-37696359 TGGGAGGAAGGAGATGAGAGGGG - Intronic
905422758 1:37859632-37859654 CCGGAGGAAGGTGGGGACAGAGG + Intergenic
905732970 1:40308812-40308834 TCAAAGGAAGGAGGGGTCTGGGG + Intronic
905868215 1:41387843-41387865 GGAGGGGAAGGAGGGGTGAGTGG - Intergenic
906460362 1:46031563-46031585 CCGAAGGAATGAGGAGTGAGAGG - Exonic
906557032 1:46722105-46722127 TCTGAGGAAGGAGGCCAGAGAGG - Intergenic
906591018 1:47024011-47024033 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
906815555 1:48874735-48874757 CTGGAGGAAGGAGTGGGGAGGGG + Intronic
906826981 1:48992579-48992601 TGGGAGGAACCAGGGTTGAGGGG - Intronic
907118448 1:51989763-51989785 TGGGAGAATGGAAGGGTGAGAGG - Intronic
907275251 1:53313417-53313439 GTGGAGGAAGGAGGGGTGGAGGG - Intronic
907567005 1:55444662-55444684 TCAGAGGGAGGAGGGGAGTGAGG + Intergenic
907730308 1:57059628-57059650 TCAGAGCAGGGAGGGGTGTGTGG + Intronic
907907757 1:58799803-58799825 TGGGAGGAAGGAAGGGACAGAGG - Intergenic
908406865 1:63823311-63823333 TCGATGGATGGATGGGTGAGTGG - Intronic
911437304 1:97877349-97877371 TCGCAGAAATAAGGGGTGAGGGG + Intronic
912345026 1:108956025-108956047 TGGGAGGATGGATGGATGAGAGG - Intronic
912375541 1:109206804-109206826 TGGGTGGCTGGAGGGGTGAGTGG + Intergenic
913384271 1:118242283-118242305 TAGGAGGAAGGAAGGGAGAATGG - Intergenic
914417000 1:147493522-147493544 TGAGATGAAGGAGGGGTGGGTGG + Intergenic
914855062 1:151344708-151344730 TCGGTGGGTGGAGGGGTGGGTGG - Exonic
915131277 1:153697364-153697386 GCCTGGGAAGGAGGGGTGAGGGG - Intergenic
915233882 1:154466139-154466161 GCAGAGGAAGGAGAGGAGAGGGG + Exonic
915358136 1:155268845-155268867 CCGGAGGGAGGCGGGGTGGGTGG + Intronic
915430211 1:155860297-155860319 TCTGGGGAAAGAGGGGTGCGGGG + Intronic
915446746 1:155978482-155978504 TTGGGGGAAGGCGGGGGGAGGGG + Exonic
915536816 1:156541323-156541345 TGGGAGCAAGCAGGGCTGAGTGG - Intronic
916239047 1:162621217-162621239 GAGGAGGAAGAAGGGGTGAAAGG + Intergenic
916361488 1:163975184-163975206 TGGGAGGAAGAAGGAGTGAGGGG - Intergenic
916902776 1:169247632-169247654 TCAGAAGAGGGAGGGTTGAGGGG - Intronic
917127970 1:171707927-171707949 TGGGAGAGAGAAGGGGTGAGTGG + Intronic
917725221 1:177821371-177821393 TTGGAGGAAGGAGGGAGAAGGGG + Intergenic
918420493 1:184359862-184359884 TAGGGGGAAGGAGGAGTGGGAGG - Intergenic
918809781 1:189101108-189101130 TCAGAAGAATGAGGGGAGAGAGG + Intergenic
919506595 1:198406457-198406479 TCAGAGGGTGGAGGGGGGAGGGG + Intergenic
919816383 1:201443393-201443415 CCTGAGGCAGGAGGGGAGAGAGG + Intergenic
920086653 1:203422390-203422412 GAGGACGGAGGAGGGGTGAGTGG - Intergenic
920284628 1:204870686-204870708 CCGGCCGAGGGAGGGGTGAGTGG + Intronic
920422869 1:205847360-205847382 GCTGAGGAAGGATGGGTCAGAGG - Intronic
920423587 1:205854377-205854399 GCTGAGGAAGGATGGGTCAGAGG + Intergenic
920909478 1:210201852-210201874 TTGGGGGAAGGAAGGCTGAGAGG + Intergenic
921023743 1:211259329-211259351 GCGGAGGGAGGAGGGGAGAGAGG + Intronic
921379744 1:214512314-214512336 TAGGAGGCAGAAGGAGTGAGGGG - Intronic
922251216 1:223850245-223850267 TCTGAGGAATGAGGGGAGGGAGG + Intergenic
922723325 1:227909904-227909926 GGGGAGGAAGGAGGGGAGAAAGG + Intergenic
923008764 1:230072094-230072116 TTGGATGAATGATGGGTGAGTGG + Intronic
923014846 1:230118887-230118909 TCGGATAAAGGCAGGGTGAGGGG - Intronic
923431004 1:233920321-233920343 TCGGAGAAAGGAGTATTGAGTGG + Intronic
924214712 1:241809193-241809215 TTGGGGGGAGGGGGGGTGAGGGG + Intergenic
924474060 1:244367891-244367913 GAGGAGGAAGCAGGGGAGAGAGG - Intronic
924519499 1:244794087-244794109 TGGGAAGAAGGAGGGAAGAGGGG - Intergenic
924562534 1:245169129-245169151 TCGGTGGAAGGACGAGGGAGGGG - Intronic
1062833593 10:622289-622311 AGGGAGGGAGGAGGGGGGAGAGG + Intronic
1063507939 10:6618529-6618551 TAGGAGGAAGGAGGGGGTTGGGG + Intergenic
1063645499 10:7878440-7878462 CCTGAGGAGGGAGGGGTGACGGG + Intronic
1063710776 10:8475882-8475904 TAGGAGGATGGAGGAGTCAGAGG + Intergenic
1063754991 10:8997592-8997614 TGGGAGGGAGGAAGGGAGAGGGG - Intergenic
1064670960 10:17713499-17713521 TCGGGGGTGGGAGGGGTGTGGGG - Intronic
1064984355 10:21195131-21195153 TAGGAGAAAGGAGGGTTGACAGG - Intergenic
1065550416 10:26863816-26863838 TAGGAGGAAGGAGAGGAGAAAGG + Intergenic
1066546183 10:36503026-36503048 TAGGAGGAAGGAGGAGAGTGTGG - Intergenic
1067714458 10:48678752-48678774 TTGGAGGAAGGAGGGAGGATTGG - Intergenic
1067815918 10:49476820-49476842 GCGAAGGAGGGAGGGTTGAGAGG - Intronic
1068800959 10:61139317-61139339 AGGGAGGAAGGAAGGGAGAGAGG - Intergenic
1068880282 10:62041340-62041362 TCATAGGGAGGAAGGGTGAGAGG + Intronic
1068935937 10:62635855-62635877 TCTGAGCAGGGAGGGGAGAGTGG + Intronic
1069117706 10:64528483-64528505 CAGGAGGAAGGCGGGGTGGGAGG - Intergenic
1069878582 10:71578018-71578040 GTGGAGGACAGAGGGGTGAGAGG - Intronic
1070383751 10:75904971-75904993 ACAGTGGAAGGAGGGGAGAGAGG + Intronic
1070565695 10:77602393-77602415 GCTGGGGAAGGAGGGGTGTGGGG + Intronic
1070648618 10:78219178-78219200 CCGGAGGAAAGAGAGGTGGGAGG + Intergenic
1070648827 10:78220450-78220472 CTGGAGGAAGAAGGGATGAGTGG + Intergenic
1070739900 10:78895880-78895902 GCGGAGGAAGGGAGGGTGGGAGG - Intergenic
1071270639 10:84003809-84003831 GGTGAGGAAGGAGGGGTCAGGGG - Intergenic
1071444891 10:85736269-85736291 AAGGAGGGAGGAGGGGAGAGAGG + Intronic
1071480022 10:86058107-86058129 AGGGAGGAAGGAAGGGAGAGAGG + Intronic
1071679555 10:87690995-87691017 ACTGAGGGAGGTGGGGTGAGGGG + Intronic
1071800756 10:89057079-89057101 ACAGAGAAAGGAGGAGTGAGGGG + Intergenic
1072015550 10:91342868-91342890 GTGGAGGGAGGAGGGGTGATTGG - Intergenic
1072538503 10:96381038-96381060 TTGGAGGAAGGAAGGGAGAGAGG - Intronic
1072717756 10:97762901-97762923 TGGGAGGGAGGAGAGGAGAGAGG - Intergenic
1073067663 10:100772987-100773009 TCTGAGAAATGAAGGGTGAGAGG - Intronic
1073435596 10:103513894-103513916 GAGGAGGAAGGGGAGGTGAGAGG + Intronic
1073592200 10:104767823-104767845 TAGGAGGAAGGGGAGGAGAGGGG - Intronic
1073654045 10:105393178-105393200 AGGAAGGAAGGAAGGGTGAGAGG + Intergenic
1074165670 10:110872063-110872085 TCCGAGGAGGGATGGGGGAGAGG - Intronic
1074309875 10:112312929-112312951 TAGGAGGATGGAGGGGGAAGAGG - Intergenic
1074776795 10:116773124-116773146 TGGGAGGAAGGAGGGCCCAGGGG - Intergenic
1074813800 10:117130027-117130049 AAGGAGGAAGGAGGGGAGAAAGG + Intronic
1074925250 10:118062443-118062465 TAGTAGGGAGGAGGGGTGAGGGG - Intergenic
1075416134 10:122265738-122265760 TAGGAGGCAGAAAGGGTGAGGGG + Intergenic
1075669724 10:124256140-124256162 TGGGAAGAATGAGGGGAGAGGGG + Intergenic
1075849122 10:125573436-125573458 TGGGAGGAAGTGGGGGTTAGGGG + Intergenic
1075876115 10:125807093-125807115 GCAGAGGCAGGAGGTGTGAGTGG - Intronic
1076516661 10:131049176-131049198 TGGGAGGGAGTAGGGGTGAGCGG - Intergenic
1076563889 10:131385567-131385589 TCGGAGGGAGGAGCAGAGAGAGG + Intergenic
1076564146 10:131386726-131386748 GCGGAGGGAGGAGCGGAGAGAGG + Intergenic
1076776466 10:132700581-132700603 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
1076907985 10:133372909-133372931 TCGGACGGAAGAGGGGTGCGGGG + Intronic
1077163257 11:1123131-1123153 AGGGAGGAAGGAAGGGGGAGGGG - Intergenic
1077357403 11:2124892-2124914 TGGGTGGATGGAGGAGTGAGTGG + Intergenic
1077357723 11:2126478-2126500 TAGGTGGATGGATGGGTGAGTGG + Intergenic
1078108192 11:8371826-8371848 AAGGAGGAAGGAAGGGTGGGAGG - Intergenic
1078895288 11:15592032-15592054 ATGGAGGAAGGAGGGGTGGAAGG + Intergenic
1078897511 11:15610042-15610064 TTGGATGAAGGAGGGGAGTGTGG - Intergenic
1078987262 11:16607894-16607916 GGGGAAGAAGGAGGGGAGAGCGG + Intronic
1079110154 11:17600865-17600887 ACGGAGCAAGGATGGGTGAGTGG - Intronic
1079137590 11:17784746-17784768 GCGGAGGGAGGAGGGAGGAGCGG - Intergenic
1080657080 11:34266615-34266637 TCGGAGGAAGGGGGTGGCAGGGG - Intronic
1080970236 11:37265430-37265452 TGGAAAGAAGGAGGGATGAGAGG - Intergenic
1081492140 11:43577330-43577352 TGGGGGGAAGGAGGGGTGAGTGG + Intronic
1081680710 11:45000456-45000478 TCGGTGGATGGATGGGTGGGTGG - Intergenic
1081761306 11:45577974-45577996 TCAGTGGAAGGATTGGTGAGGGG + Intergenic
1082079405 11:48000575-48000597 TCGGAGGGTGGAGGGGAGGGAGG - Intronic
1082081999 11:48019353-48019375 TCGGGGGAAGGTGGGGTGGAGGG - Intronic
1082825092 11:57571773-57571795 CCAGAGGAAGGGGGGGTGTGGGG - Intergenic
1083768601 11:64854145-64854167 GCGGGGGAGGCAGGGGTGAGAGG - Exonic
1083913041 11:65721011-65721033 GAGGGGGAAGGAGGGGGGAGGGG - Intergenic
1084104911 11:66975051-66975073 GGGGAGGAGGGAGGGGGGAGAGG + Intergenic
1084454930 11:69263000-69263022 TGGGTGGAAGGATGGGTGGGTGG - Intergenic
1084545909 11:69815036-69815058 TGGGTGGATGGATGGGTGAGTGG + Intronic
1084594966 11:70111410-70111432 TCAGAGGCAGGCGGTGTGAGCGG - Intronic
1084697803 11:70766426-70766448 TGGGAGGAAGGAGAAGTCAGAGG + Intronic
1084771234 11:71344074-71344096 GCGGAGGGAGGAGGAGGGAGAGG - Intergenic
1084780074 11:71402181-71402203 GCTGAGGAAGGAGAGGTGAGGGG + Intergenic
1084962723 11:72725818-72725840 TTGGAGGAGGAAGGGGTGTGCGG - Intronic
1085478879 11:76805663-76805685 GCTGAGGTAGGAGGGATGAGTGG - Intergenic
1085645396 11:78219184-78219206 TGGGAGGAAGAACGGGAGAGGGG + Exonic
1086220513 11:84437615-84437637 TGGGAGGAGGGAGGGGTTGGGGG + Intronic
1087405802 11:97728462-97728484 TGGGAGGAAGGGTGGGAGAGGGG + Intergenic
1087611485 11:100439297-100439319 TCTGAGGAAGGCTGGCTGAGGGG + Intergenic
1088471167 11:110188503-110188525 TAGGAGGAAGGATGGGAGGGGGG + Intronic
1088692985 11:112343846-112343868 GAGGAGGAGGGAGGGGAGAGTGG - Intergenic
1088737351 11:112738675-112738697 CCAGAGGATGGAGGGGTGAGGGG - Intergenic
1088779949 11:113124218-113124240 AAGGAGGAAGGAGGGGCAAGTGG + Intronic
1088907752 11:114167666-114167688 TCAGAGGAAGGAGGGGTCGCTGG - Intronic
1089083130 11:115794286-115794308 CAGGAGGAATGTGGGGTGAGGGG + Intergenic
1089671893 11:120062445-120062467 CCGGAGGAGGGAGGGATGGGAGG + Intergenic
1089780515 11:120870279-120870301 TGGGAGGAAGAAGGGGAGAATGG + Intronic
1089991593 11:122866259-122866281 AGGGAGTAAGGAGAGGTGAGAGG - Intronic
1090124874 11:124075418-124075440 TCAGAGGATGGAGAGGTGACAGG - Intergenic
1090618977 11:128544481-128544503 TGGGAGAAGGCAGGGGTGAGGGG - Intronic
1090959298 11:131541849-131541871 ATGGAGGAAGTAGGGGAGAGAGG - Intronic
1091168682 11:133502015-133502037 TGGAAGGAAAGGGGGGTGAGAGG - Intronic
1091612712 12:2024846-2024868 TTGGAGGAGGGATGGGTGATTGG - Intronic
1091691727 12:2601773-2601795 TGGGAGGAAGGGGTGGTGTGAGG + Intronic
1092776060 12:11946111-11946133 ACAGAGGAAGGATGGGTGCGGGG + Intergenic
1092960367 12:13591222-13591244 AGGGTGGAAGGAGGGCTGAGTGG + Intronic
1093357181 12:18180172-18180194 CTAGAGGAAGGAGTGGTGAGAGG - Intronic
1094041556 12:26125272-26125294 TCGGCAGGAGGAGGGGGGAGTGG + Intronic
1094095529 12:26700178-26700200 TCAGAGGAAGGAGGGATCTGTGG + Intronic
1094388284 12:29919326-29919348 GGGGAGGAAAGAGGGGGGAGAGG - Intergenic
1094502400 12:31033111-31033133 TGGGAGGAAGGAGGGTTGGTTGG - Intergenic
1094768525 12:33625653-33625675 TTGGTGTATGGAGGGGTGAGAGG + Intergenic
1095139988 12:38649942-38649964 TGGTAGGAAAGTGGGGTGAGGGG + Intronic
1095515901 12:43005129-43005151 ACAGAGGAAGAAGGGGGGAGGGG - Intergenic
1096813397 12:54185915-54185937 TGGGAGGAAGGAGAAGGGAGGGG + Intronic
1097156052 12:57013171-57013193 TAGGAGGAAGCTGGTGTGAGGGG - Intronic
1100448654 12:94684440-94684462 GCAGAGGAACGAGGGCTGAGAGG + Intergenic
1100879855 12:99004606-99004628 TGAGAGGAAGGTGGGGTGCGGGG + Intronic
1101119633 12:101565490-101565512 TTGGAGGAAGTCGGTGTGAGTGG - Intergenic
1102189512 12:110976232-110976254 TGGGAGGAAGGAGGGAGGGGAGG + Intergenic
1102191680 12:110993469-110993491 TGGGGTGAGGGAGGGGTGAGGGG - Intergenic
1102426571 12:112848637-112848659 TGGTAGGAAGGAGGGGAAAGTGG + Intronic
1102746070 12:115250171-115250193 TAGGAGAAAGGAGGGGGCAGAGG + Intergenic
1103004374 12:117409428-117409450 TGGGTGTATGGAGGGGTGAGTGG + Intronic
1103030109 12:117606352-117606374 AGGGAGGAAGGAGGGGAGGGAGG - Intronic
1103030118 12:117606372-117606394 AGGGAGGAAGGAGGGGAGGGAGG - Intronic
1103030134 12:117606412-117606434 AGGGAGGAAGGAGGGGAGGGAGG - Intronic
1103030143 12:117606432-117606454 AGGGAGGAAGGAGGGGAGGGAGG - Intronic
1103030152 12:117606452-117606474 AGGGAGGAAGGAGGGGAGGGAGG - Intronic
1103180686 12:118908770-118908792 TAGGAGGAAGGTGGGGAGGGAGG - Intergenic
1103239002 12:119397980-119398002 TGGGAGGAAGGGGCGGTGTGGGG + Intronic
1103307989 12:119981485-119981507 TGGGAGGAAGGAGGTGTTATTGG - Intergenic
1103366810 12:120389701-120389723 GAGGAGGAAGGAAGGGAGAGAGG + Intergenic
1103425458 12:120830293-120830315 GAGGGGGAAGGAGGGGGGAGGGG + Intronic
1103698347 12:122835057-122835079 TGGGTGGAAGGAGGAGGGAGGGG + Intronic
1104103670 12:125639149-125639171 GCAGGGGAAGGAGGGGTGTGGGG - Intronic
1104414823 12:128589392-128589414 AGGGAGGCAGGCGGGGTGAGAGG - Intronic
1104925700 12:132313093-132313115 TGGGTGGATGGATGGGTGAGTGG - Intronic
1104950456 12:132437568-132437590 AGGGAGGAGGGAGGGGAGAGAGG + Intergenic
1105472802 13:20707107-20707129 TTGGAGGGAGGAGGGCAGAGAGG - Intronic
1105514203 13:21076045-21076067 GCGGGGGGAGGAAGGGTGAGAGG - Intergenic
1105657956 13:22460894-22460916 TAGGGGGATGGATGGGTGAGAGG - Intergenic
1106135346 13:26969151-26969173 TCTCAGGAAGGAGGTGAGAGGGG - Intergenic
1107108687 13:36673739-36673761 TCGGGGGGAGGAGGGGGGAGTGG - Intergenic
1107184928 13:37506448-37506470 TCTGGGGGAGGAGGGGTGCGAGG - Intergenic
1107885036 13:44868006-44868028 CCTGAGGGAGGAGGGGTGTGAGG - Intergenic
1108929318 13:55795570-55795592 TGGGAAGAGGGAGAGGTGAGAGG + Intergenic
1109259662 13:60129218-60129240 TGGGAGGAGGGGGGAGTGAGGGG - Intronic
1110831893 13:80041405-80041427 AGGGAGGGAGGAGGTGTGAGGGG - Intergenic
1111006430 13:82255718-82255740 TAGGAGGAAGGAGAGGTGGAGGG - Intergenic
1111025025 13:82509886-82509908 CAGTAGGAAGGAGGGATGAGTGG + Intergenic
1111048369 13:82846604-82846626 AGGGAGGAAGGAAGGGAGAGAGG + Intergenic
1111396349 13:87672939-87672961 ACGGAGGAAGAAGGGGAGGGAGG - Intronic
1111721428 13:91950342-91950364 TGGGAGGGAGGAGGAGGGAGGGG - Intronic
1111832906 13:93352645-93352667 TTGGAGGGAGGAGTGGGGAGTGG + Intronic
1112049186 13:95628855-95628877 TAGCTGGAAGGAGGGGGGAGTGG + Intronic
1112484254 13:99805567-99805589 TGGGAGGAAGGAGGGGGTGGGGG + Intronic
1113074208 13:106451997-106452019 AGGGAGGAAGGAAGGGAGAGAGG + Intergenic
1113137367 13:107107557-107107579 TAGGAGAAAGGAGGGGAGATAGG - Intergenic
1113420767 13:110170046-110170068 AGGGAGGAAGGAGGGGAGGGAGG + Intronic
1113449396 13:110396153-110396175 TCGGAGGAACTAGGGGTGAGAGG - Intronic
1113494175 13:110714484-110714506 GAGGAGGAAGGAGGCGCGAGAGG + Intronic
1113712548 13:112477850-112477872 GCGGAGGAAGGAAGGGAGGGAGG + Intergenic
1113719651 13:112545184-112545206 TTGGTGGAAGGTAGGGTGAGGGG - Intronic
1113909671 13:113836228-113836250 TGGGAGGAGGAAGGGGGGAGGGG + Intronic
1113930248 13:113964590-113964612 AGGGAGGAAGGAGGGGGGAGAGG - Intergenic
1114363784 14:22005141-22005163 TGGGTGGGAGGAGGGGGGAGGGG - Intergenic
1114712759 14:24795040-24795062 TTGGAGGGAGGAGGGAAGAGTGG - Intergenic
1115301745 14:31892928-31892950 TTTGAGGACGGAGGGGTTAGCGG + Intergenic
1115378255 14:32703171-32703193 TGGGAAGAAGGCGGGGAGAGGGG + Intronic
1116280963 14:42907006-42907028 TTGGTGGAAGGAGGAGAGAGTGG + Intergenic
1117335311 14:54752382-54752404 TGGGAGGCAAGAGTGGTGAGTGG + Intronic
1118427019 14:65676594-65676616 AAGAAGGAAGGAGGGGTGGGGGG - Intronic
1118920973 14:70149747-70149769 TGGGAGGAAGAAGGGCTGGGAGG - Intronic
1119133526 14:72196028-72196050 TTGGAGGAAGGAGAGGTGATAGG + Intronic
1119218565 14:72888158-72888180 TGGAAGCAGGGAGGGGTGAGAGG - Intronic
1119472887 14:74910285-74910307 TGGGAGGGAGCAGAGGTGAGGGG - Intronic
1119563724 14:75611211-75611233 TCGGAGGAAGCAAGGGTGAGAGG - Intronic
1120489951 14:85164805-85164827 TGGGGGGAAGGATGGGAGAGGGG + Intergenic
1120635328 14:86943924-86943946 AGGGAGGAAGGAGGGGAGAGAGG - Intergenic
1120666384 14:87311282-87311304 TGGGAGGAAGGAAGGGCGGGAGG - Intergenic
1120666390 14:87311298-87311320 AGGGAGGAAGGAAGGGTGGGAGG - Intergenic
1120909731 14:89655374-89655396 AGGGAGGAAGGAAGGGAGAGAGG - Intergenic
1121119182 14:91365175-91365197 TGGGAGGGGTGAGGGGTGAGGGG - Intronic
1121173153 14:91871009-91871031 TGGGAGGCAGGAGGAGGGAGGGG + Intronic
1121253451 14:92515338-92515360 AGGGAGGAAGGGGAGGTGAGGGG + Intronic
1121369835 14:93347064-93347086 ACAGAGAAAGGAGTGGTGAGCGG + Intronic
1121410195 14:93744264-93744286 ACTGAGGAAGGAGTGGTGTGGGG + Intronic
1122424366 14:101597073-101597095 CCGGAGGCAGGAGGGCAGAGAGG + Intergenic
1122923890 14:104891091-104891113 TGGGTGGATGGAGGGGTGGGTGG + Intronic
1122958379 14:105083321-105083343 TGGATGGATGGAGGGGTGAGTGG - Intergenic
1122958507 14:105083775-105083797 AGGGAGGATGGAGGGGTGGGTGG - Intergenic
1123016253 14:105377066-105377088 TGGCTGGAAGGAGGGGTGTGCGG + Intronic
1123126311 14:105948670-105948692 TGGGTGGATGGATGGGTGAGTGG - Intergenic
1123679912 15:22755458-22755480 AAGGAGGAAGGAGGAGGGAGGGG - Intergenic
1123811677 15:23932753-23932775 CAGGAGGAGGGAGGGTTGAGAGG + Intergenic
1123996372 15:25720640-25720662 TGGGAGGGAGGATGGGTGAGTGG + Intronic
1124045168 15:26142452-26142474 TGGAAGGAAGGAGGGGAGGGAGG - Intergenic
1124332126 15:28829906-28829928 AAGGAGGAAGGAGGAGGGAGGGG - Intergenic
1124410230 15:29430707-29430729 TGGGAGGAAGGAGGGAGGAATGG + Intronic
1124554365 15:30711280-30711302 CCGGGGGAAGGGGGGTTGAGGGG + Intronic
1124805543 15:32878242-32878264 TAGTGGGCAGGAGGGGTGAGTGG + Intronic
1124864199 15:33472996-33473018 TCAGAGCAAGGTGGGATGAGTGG - Intronic
1125463978 15:39933377-39933399 TGGGAGGAAGGAGGGTGGGGGGG + Intergenic
1125477708 15:40058625-40058647 TCAGGGGAAGGAGAGGAGAGGGG + Intergenic
1125477962 15:40060368-40060390 TCCCAGGGAGCAGGGGTGAGGGG - Intergenic
1126167603 15:45666928-45666950 TGGGAGAAAGGAGAGGAGAGGGG - Intronic
1126778510 15:52119312-52119334 AGGGAGGGAGGAGGGGTGACAGG + Exonic
1127914334 15:63442981-63443003 TGGGAGGAAGGCGGGTTGGGGGG - Intergenic
1128213066 15:65915787-65915809 GAGGAGGAAGTAGGGGTGAGTGG - Intronic
1128245908 15:66132633-66132655 GCTGAGGAAGGGGGGCTGAGTGG + Intronic
1128484338 15:68070036-68070058 TTGGAGGAAGGAGATGTGGGAGG + Intronic
1128505833 15:68272036-68272058 CCGGAGGAAGGAGAGGTGGGTGG - Intergenic
1128793644 15:70449952-70449974 TGGGTGGATGGAGGGATGAGTGG + Intergenic
1129161832 15:73752004-73752026 TAGGAGGGAGGATGGGTGACTGG - Intronic
1129225675 15:74169042-74169064 ACGGAGGAGGGAGGAGAGAGGGG + Intergenic
1129265629 15:74391812-74391834 CCTGAGGAAGGAGGGGAGACAGG - Intergenic
1129442083 15:75588865-75588887 TAGGGGAAAAGAGGGGTGAGGGG + Intergenic
1129484817 15:75860501-75860523 TTTGAGGAAGGGGAGGTGAGTGG - Intronic
1129619260 15:77128925-77128947 TCTGAGGCAGGATGGGTTAGAGG + Intronic
1129667977 15:77590146-77590168 ACAGGGGCAGGAGGGGTGAGGGG + Intergenic
1129872583 15:78950114-78950136 TGGGTGGAAGGAGGGATGAATGG + Intergenic
1130202975 15:81850606-81850628 CAGGAGGCAGAAGGGGTGAGGGG + Intergenic
1130759731 15:86806090-86806112 TGGAAGGAAGGAAGGGTGGGAGG + Intronic
1130761534 15:86825670-86825692 AGGGAGGAAGGAAGGGAGAGAGG + Intronic
1130893165 15:88150436-88150458 TCAGAGGAAGGAGGGGTCCTGGG + Intronic
1131117072 15:89802235-89802257 TCTCAGGAAAGAGGAGTGAGAGG + Intronic
1131312611 15:91304578-91304600 GAGGAGGAAGGACGGGGGAGAGG + Intergenic
1131899029 15:97067705-97067727 AGGGAGGGAGGAAGGGTGAGTGG - Intergenic
1132143587 15:99413755-99413777 TTGGCGGCAGGAGGGGTGGGGGG + Intergenic
1132333449 15:101027943-101027965 TCCAAGGAAAGAAGGGTGAGAGG - Intronic
1132644742 16:993721-993743 TGGGAGGGTGGATGGGTGAGTGG - Intergenic
1132671634 16:1104304-1104326 GGGGAGGAAGGAGGGATGCGAGG + Intergenic
1132766771 16:1538312-1538334 TGCGAGGAAGGAAGGCTGAGAGG + Intronic
1133204755 16:4226640-4226662 TGGAAGGAAGGAAGGGTGAATGG + Intronic
1133587709 16:7211942-7211964 TAGGAGGGAGTAGGGGTGAGAGG - Intronic
1133593998 16:7272986-7273008 AGGGAGGAAGGAAGGGAGAGAGG - Intronic
1133823601 16:9258385-9258407 CAGGAGGAAGGAGGGATGTGCGG - Intergenic
1134141082 16:11719974-11719996 TCTGAGGAAGGAGAAGCGAGTGG + Intronic
1134235058 16:12459080-12459102 ACGGTGGGAGGAGGGGGGAGTGG - Intronic
1134501512 16:14772497-14772519 GAGGATGAGGGAGGGGTGAGAGG - Intronic
1134579050 16:15356382-15356404 GAGGATGAGGGAGGGGTGAGAGG + Intergenic
1134723536 16:16401168-16401190 GAGGATGAGGGAGGGGTGAGAGG - Intergenic
1134943893 16:18310702-18310724 GAGGATGAGGGAGGGGTGAGAGG + Intergenic
1135302863 16:21345814-21345836 AGGAAGGAAGGAGGGGGGAGGGG - Intergenic
1135949741 16:26902968-26902990 TGGAAGGATGGATGGGTGAGTGG + Intergenic
1136054374 16:27677466-27677488 CCGGGGGAAGGTGGGGTGGGGGG - Intronic
1136091705 16:27925390-27925412 TGGGAGGGAGGAGGGGTGGAAGG + Intronic
1136154957 16:28376321-28376343 GAGGATGAGGGAGGGGTGAGAGG + Intergenic
1136208134 16:28738937-28738959 GAGGATGAGGGAGGGGTGAGAGG - Intergenic
1136290950 16:29270952-29270974 TGGGTGGAAGGATGGGTGGGTGG + Intergenic
1136367173 16:29814192-29814214 AGGGAGGAAGGAGGAGTGAAGGG - Intronic
1136539884 16:30923463-30923485 GTGGAGGAAGGAGGGGGAAGGGG + Intronic
1136578550 16:31138819-31138841 CCGGAGGAGGGAGGAGGGAGGGG + Intergenic
1136628022 16:31473518-31473540 TAGGATGGGGGAGGGGTGAGAGG - Exonic
1137658864 16:50185801-50185823 TCTGAGGAAGTGGGGGTAAGGGG - Intronic
1138041935 16:53680771-53680793 TGGGAGTAAGGAAGGGAGAGAGG + Intronic
1138144187 16:54594561-54594583 TAGATGGAAGGAGGGGAGAGGGG - Intergenic
1138352218 16:56352116-56352138 ACGAAGGAAGAAGGGGAGAGAGG - Intronic
1138413917 16:56860352-56860374 CCAGAGGAAGGAGAGGGGAGAGG - Intergenic
1138474781 16:57264231-57264253 GCCGAGGAAGGAGGGTTGTGAGG - Intronic
1138544083 16:57705930-57705952 TGGGAGGATGGATGGATGAGAGG - Intronic
1139367510 16:66442393-66442415 TCTAAGGAAGGAGGGGTTTGGGG + Intronic
1139545525 16:67647944-67647966 TCCGAGGACAGTGGGGTGAGTGG + Exonic
1140487875 16:75308343-75308365 TCCCAGGAAGCAGGTGTGAGTGG - Intronic
1140692642 16:77499059-77499081 GAGGAGGAATGAGAGGTGAGAGG + Intergenic
1141185550 16:81784494-81784516 TCCAAAGAAGGAGGAGTGAGAGG - Intronic
1141388957 16:83648474-83648496 TGGGAGGGAGGAGGGGTGGCAGG - Intronic
1141430859 16:83969565-83969587 GGGGAGTTAGGAGGGGTGAGGGG - Intronic
1141497168 16:84418312-84418334 AAGGGGCAAGGAGGGGTGAGGGG - Intronic
1141517840 16:84558370-84558392 TGGGAGGAGGGAGGGAAGAGGGG - Intergenic
1141690884 16:85595668-85595690 TGGGAGGAAGGAAGGGAGGGAGG - Intergenic
1141895613 16:86956984-86957006 TGGGAGGAAGGTGGGGGGAGGGG + Intergenic
1141913491 16:87077015-87077037 TCTGAGGAATGAGGTGTGTGGGG - Intergenic
1141952619 16:87348521-87348543 TCCCAGGAAGAAGGGGTGACCGG + Intronic
1142096825 16:88244454-88244476 TGGGTGGAAGGATGGGTGGGTGG + Intergenic
1142355065 16:89598148-89598170 TGGGTGGACGGATGGGTGAGTGG - Intergenic
1142511226 17:394735-394757 TAGAAGGAAGGAGGGGGGATAGG + Intergenic
1143379915 17:6489588-6489610 TCTGAGGAGGCAGGGCTGAGGGG - Intronic
1143462875 17:7115025-7115047 TCGGAGGCAGGAAGTGAGAGGGG - Intronic
1144143677 17:12376372-12376394 GGGGAGGAGGGAGGGGGGAGGGG + Intergenic
1145269648 17:21397896-21397918 AAGGAGAAGGGAGGGGTGAGAGG - Intronic
1145271621 17:21407823-21407845 ATGGAGGAAGGATGGATGAGTGG - Intronic
1145309833 17:21695271-21695293 ATGGAGGAAGGATGGATGAGTGG - Intronic
1146689595 17:34864083-34864105 TTGGAGGCAGCAGGGGTGAGAGG - Intergenic
1146698407 17:34930392-34930414 TCTGAGGAAGGAGGTGAGAGAGG - Intronic
1146935998 17:36813070-36813092 TGGGAAGAAGGGGGGCTGAGAGG + Intergenic
1147157628 17:38552200-38552222 TCTGAGGGAGGTGGGGTGGGAGG + Intronic
1147263449 17:39222064-39222086 AGGGAGGAAGGAGGGCTGATAGG - Intronic
1147548013 17:41418255-41418277 TGGGGGGAAGGAGGGGAGGGTGG + Intergenic
1147607994 17:41785282-41785304 ACTGAGGAAGGTGGGGGGAGTGG - Intronic
1147722452 17:42547424-42547446 TGGGAGGATTGATGGGTGAGTGG + Intergenic
1147723639 17:42553604-42553626 TGGGAGGATTGATGGGTGAGTGG + Exonic
1147760743 17:42796042-42796064 CGGGAGGATGGAGGAGTGAGAGG + Intronic
1147965692 17:44193246-44193268 TTGGAGGCAGGAGCGCTGAGAGG + Exonic
1148219148 17:45849954-45849976 TTGGAGGATGTAGGGGTGTGTGG - Intergenic
1148258350 17:46156504-46156526 TAGGAGGAGGGAGTGGTTAGAGG - Intronic
1148461462 17:47841200-47841222 TTGGAGGAAGAGAGGGTGAGGGG - Exonic
1148489212 17:48012507-48012529 GCGGAGGAGGGAGGGGGGAGGGG - Intergenic
1148736005 17:49865343-49865365 TCGGAGGGAGTGGGGGTGAAAGG - Intergenic
1148951916 17:51320924-51320946 TGGGAGGAGGGATGGGTGGGTGG - Intergenic
1149007503 17:51821060-51821082 AGGGAGGAAGGAAGGGAGAGAGG - Intronic
1149233252 17:54560943-54560965 TCGAAGGAATGATGGGCGAGAGG - Intergenic
1149407654 17:56370600-56370622 GTGGAAGAAGGAGGGGGGAGTGG + Intronic
1150155874 17:62852537-62852559 AGGGAGGAAGCAGGGGTGAGAGG - Intergenic
1151152888 17:72103270-72103292 TAGGATGAAGGAGGGGTTGGAGG - Intergenic
1151652030 17:75476025-75476047 CTGCAGGAAGGAGGGGAGAGGGG - Intronic
1151684353 17:75637965-75637987 TAGAAGGAAGGAGGCGGGAGCGG + Exonic
1152033582 17:77858383-77858405 TGGGTGGAAGGATGGGTGAATGG - Intergenic
1152312604 17:79559999-79560021 TGGGTGGAAGGATGGGTGGGTGG + Intergenic
1152353143 17:79794478-79794500 GGGGAGGAAGGAGGGATGAAAGG + Exonic
1152473710 17:80504075-80504097 TAGGTGGATGGAGGGATGAGTGG + Intergenic
1152577988 17:81151314-81151336 TGTGGGGGAGGAGGGGTGAGGGG - Intronic
1152767318 17:82148422-82148444 TGGGTGGATGGATGGGTGAGTGG + Intronic
1153167436 18:2278949-2278971 TCGAAGTATGGAGGGGTGAGAGG - Intergenic
1154194689 18:12257048-12257070 TCAGAGGATGGTGGGGTCAGTGG - Intronic
1157475956 18:48023804-48023826 TGGGATGAAGGAGGGATGGGCGG + Intergenic
1157605318 18:48922772-48922794 TCTGTGGAAGGAGGGGAGAGAGG - Intronic
1157614298 18:48977663-48977685 AGGGAGGAATGGGGGGTGAGGGG - Intergenic
1158009936 18:52716984-52717006 TGGCAGGCAGGAGGGGCGAGGGG - Intronic
1158685471 18:59610399-59610421 TGGGGGGCAGGAGGGGTAAGGGG - Intronic
1159076028 18:63682931-63682953 GAGGAGGAAGGAAGGGAGAGAGG - Intronic
1159508817 18:69369375-69369397 TCAGAGGAAGGTGGGGGGAGGGG + Intergenic
1159936450 18:74371946-74371968 GCAGAGGATGCAGGGGTGAGAGG + Intergenic
1160319290 18:77875202-77875224 TTGGGGGAAGGAGGGATGAGTGG - Intergenic
1160709590 19:544895-544917 TGGGAGGAAGGAGGAATGATGGG - Intronic
1160758690 19:771828-771850 AGGGAGGAAGGAGAGGAGAGGGG - Intergenic
1160758730 19:771947-771969 AGGGAGGAAGGAGAGGAGAGGGG - Intergenic
1160812154 19:1017532-1017554 CCGGAGGAAGGAAGGGTCATAGG - Intronic
1160881365 19:1322222-1322244 CCGGGGAAAGGAGGGGTGAAGGG + Intergenic
1160894373 19:1395787-1395809 TCCCAGGAAGGATGGGTGTGCGG - Intergenic
1160899206 19:1418717-1418739 CCGAAGGAAGGATGGGTAAGGGG + Exonic
1160965605 19:1745836-1745858 ACGGAGGAAGCAGAGGAGAGGGG + Intergenic
1161139613 19:2639750-2639772 GGGGAGGAAGGAGGGGGGAAGGG + Intronic
1161404083 19:4082068-4082090 GAGGAGGAAGGAGGGAGGAGGGG - Intergenic
1161422643 19:4184311-4184333 GGGGAGGAAGGAGGTGGGAGAGG + Intronic
1161477679 19:4495550-4495572 GTGGAGGGAGGAGGGGAGAGAGG + Intronic
1161658167 19:5528864-5528886 TGGGAGGGAGGAAGGGAGAGAGG + Intergenic
1161956228 19:7496974-7496996 ACTGGGGAAGGAGGGGTGACCGG + Intronic
1161974130 19:7599522-7599544 TGGGTGGAAGGATGGATGAGTGG - Intronic
1162388823 19:10377457-10377479 TGGGAGGATGGATGGGTGGGTGG + Intronic
1162717046 19:12640738-12640760 AGGGAGGAAGGAAGGGAGAGAGG + Intergenic
1162789391 19:13055224-13055246 TGGGAGGGAGGAGTGGGGAGGGG - Intronic
1162872286 19:13595414-13595436 TGGGTGGATGGATGGGTGAGTGG + Intronic
1163112025 19:15167196-15167218 TCACAGGTAGGATGGGTGAGGGG + Intronic
1163635360 19:18434805-18434827 CAGGTGGAAGGAGGGCTGAGTGG + Exonic
1163675804 19:18654717-18654739 TGGGTGGAGGGAGGGGTGAATGG - Intronic
1163783076 19:19260758-19260780 TCTGAGGAAGGAGGGGGGCGGGG - Intronic
1163849078 19:19653464-19653486 GTGGAGGATGGATGGGTGAGAGG + Intronic
1164603460 19:29579098-29579120 TGGAAGGAAGGAGGGGTGGGTGG - Intergenic
1164729757 19:30494574-30494596 TGGAAGGAAGGAGGGATGACAGG - Intronic
1164731014 19:30504475-30504497 TGGGAGGGAGGAAGGGAGAGAGG - Intronic
1164766836 19:30778815-30778837 TTGGGGGAAGGAGGGGACAGAGG + Intergenic
1165016085 19:32880969-32880991 TCAAAGAAAGGAGGGGTGGGTGG + Intronic
1165737319 19:38184956-38184978 ACAGAGCAAGGAGGGGAGAGTGG - Intronic
1165906302 19:39196733-39196755 TCTGAGGGAGGAGGGGCTAGGGG + Intergenic
1165906328 19:39196807-39196829 TCTGAGGGAGGAGGGGCTAGGGG + Intergenic
1165938363 19:39403096-39403118 TCTGAGGGAGGAGGAGTTAGGGG + Intergenic
1166046274 19:40232855-40232877 TGGGGAGAGGGAGGGGTGAGGGG + Exonic
1166314995 19:41984802-41984824 TCTGAGGGAGGAGGGGCTAGAGG - Intronic
1166331058 19:42078223-42078245 TCAGTGGAAGGAGGTCTGAGTGG + Intronic
1166336945 19:42114061-42114083 GCTGGGGAAGGAGGAGTGAGAGG + Intronic
1166398659 19:42461699-42461721 GGGGAGGGAGGAGGGGTGAAAGG - Intergenic
1166571862 19:43802201-43802223 TCTGAGGGAGGAGGGGTTGGGGG - Intronic
1166648077 19:44547570-44547592 TCAGAGGAAGGAAGGGAGGGAGG + Intergenic
1166679676 19:44758998-44759020 TCTGAGGGAGGAGGGGCCAGGGG - Intronic
1166685490 19:44793808-44793830 TCTGAGGGAGGAGGGGCTAGGGG + Intronic
1166688867 19:44811038-44811060 TCTGAGGGAGGAGGGGACAGGGG + Intronic
1166730928 19:45058732-45058754 CCAGAGGAAGGAGGGCTGGGCGG - Intronic
1166778059 19:45324184-45324206 TCTGAGGGGGGAGGGGAGAGGGG + Intergenic
1167049110 19:47067883-47067905 GAGGAGCAGGGAGGGGTGAGTGG + Intronic
1167144121 19:47671958-47671980 TGGAAGGATGGAGGGGTGGGTGG + Intronic
1167248645 19:48389815-48389837 TCTGAGGGAGGAGGGGTTGGGGG - Intronic
1167248674 19:48389889-48389911 TCTGAGGGAGGAGGGGTTGGGGG - Intronic
1167248702 19:48389963-48389985 TCTGAGGGAGGAGGGGTTGGGGG - Intronic
1167248797 19:48390218-48390240 TCTGAGGGAGGAGGGGTTGGGGG - Intronic
1167286153 19:48599786-48599808 TCTGAGGGAGGAGGGGTTGGGGG + Intergenic
1167314285 19:48754996-48755018 TCTGAGGAAGGAGGGGCAGGGGG - Intronic
1167314356 19:48755217-48755239 TCTGAGGGAGGAGGGGTGGGGGG - Intronic
1167314476 19:48755757-48755779 TCGGAGGGAGGAGGGGTGCTGGG - Exonic
1167352713 19:48985714-48985736 TCTGAGGTAGGAGGGGTCTGGGG + Intronic
1167441707 19:49512915-49512937 TCTGAGGGAGGAGGGAGGAGGGG + Intronic
1167441729 19:49512961-49512983 TCCGAGGGAGGAGGGGTTGGGGG + Intronic
1167593109 19:50415029-50415051 TCTGAGGGAGGAGGGGTTTGGGG - Intronic
1167600487 19:50451686-50451708 TCTGAGGGAGGAGGGGTTGGGGG + Intronic
1167601124 19:50455461-50455483 TGGGGGGAATGAGGGGTCAGGGG - Intronic
1167630906 19:50625750-50625772 TCTGAGGGAGGAGGGGCCAGGGG - Intronic
1167630932 19:50625824-50625846 TCTGAGGGAGGAGGGGCCAGGGG - Intronic
1167665890 19:50822648-50822670 CAGGAGGAGGGAGGCGTGAGTGG + Intronic
1167678734 19:50906523-50906545 TCTGGGGAAGGAGGGGTTGGGGG + Exonic
1167678747 19:50906560-50906582 TCTGAGGGAGGAGGGGTTGGGGG + Exonic
1167689099 19:50974840-50974862 TCTGAGGAAGGAGGGGCTGGGGG + Intergenic
1167689133 19:50974924-50974946 TCTGAGGAAGGAGGGGCTGGGGG + Intergenic
1167689194 19:50975091-50975113 TCTGAGGAAGGAGGGGCTGGGGG + Intergenic
1167693693 19:51002052-51002074 TCTGAGGGAGGAGGGGCTAGGGG + Intronic
1167699064 19:51031772-51031794 TCAGAGGAAGGATGGGTAAAGGG - Intronic
1167746255 19:51353424-51353446 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746270 19:51353461-51353483 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746285 19:51353498-51353520 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746300 19:51353535-51353557 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746315 19:51353572-51353594 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746330 19:51353609-51353631 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746358 19:51353683-51353705 TCTGAGGAAGGAGGGGATGGGGG - Intronic
1167746446 19:51353942-51353964 TCTGAGGAAGGAGGGGCTGGGGG - Intronic
1167786979 19:51645073-51645095 TCGGTGGCAGGAGGGGGAAGTGG + Intronic
1167795392 19:51704956-51704978 TCTGAGGGAGGAGGGGGCAGGGG - Intergenic
1168057206 19:53870134-53870156 TCCGAGGAAGGAGGGGCTGGGGG + Intronic
1168077711 19:53990460-53990482 TCTGAGGGAGGAGGGGGCAGGGG - Intergenic
1168077869 19:53990863-53990885 TCTGAGGGAGGAGGGGTTGGGGG - Intergenic
1168082108 19:54017709-54017731 GAGGAGGAGGGAGGGATGAGAGG - Intergenic
1168143903 19:54408529-54408551 AGGGAGGAAGGAGGGGAGGGAGG + Intergenic
1168149204 19:54435890-54435912 TCTGAGGGAGGAGGGGCGGGGGG + Intronic
1168252181 19:55147359-55147381 TCTGAGGAAGGAGGGGCTGGGGG + Intronic
1168252296 19:55147696-55147718 TCTGAGGGAGGAGGGGCCAGGGG + Intronic
1168263393 19:55208547-55208569 TCTGAGGGAGGAGGGGTTGGGGG + Intronic
1168263498 19:55208840-55208862 TCTGAGGGAGGAGGGGTTGGGGG + Intronic
1168291701 19:55360487-55360509 TCTGAGGGAGGAGGGGTGGGGGG - Intronic
1168291724 19:55360560-55360582 TCTGAGGGAGGAGGGGTGGGGGG - Intronic
1168294898 19:55373598-55373620 TCTGAGGGAGGAGGGGTTGGGGG - Intergenic
1168302037 19:55410619-55410641 TCTGAGGTGGGAGAGGTGAGGGG + Intergenic
1168322131 19:55517050-55517072 TCGGAGGACGTAGGGAGGAGGGG + Intronic
1168328776 19:55553902-55553924 AAGGAGGAGGGAGGGGTGGGAGG - Intergenic
1168527449 19:57100218-57100240 GCAGAGGGAGGAGGAGTGAGTGG + Intergenic
925216630 2:2101728-2101750 TAGGTGGATGGATGGGTGAGTGG - Intronic
925421669 2:3717750-3717772 ACAGAGGGAGGAGCGGTGAGAGG - Intronic
925425635 2:3746956-3746978 TGGGAGCGAGGAGGTGTGAGAGG + Intronic
925712020 2:6750352-6750374 AAGGAGGAAGGAAGGGAGAGAGG + Intergenic
925720176 2:6820091-6820113 CGGGAGGAAGGAAGGCTGAGTGG + Intergenic
925818371 2:7775408-7775430 TGGGGGGAAGGAGGGGAGGGAGG + Intergenic
926681077 2:15664805-15664827 TCGGAGGCAGGAGGAGAGCGAGG - Intergenic
927107065 2:19836901-19836923 TAGAAGGAAGGAAGGGAGAGAGG - Intergenic
927430776 2:23024742-23024764 GCTGTGGAAGGAGGGGTGGGGGG - Intergenic
927516121 2:23672558-23672580 TATGAGGAAGGAGGGGTGGGTGG - Intronic
928103415 2:28452551-28452573 TGGGAGGCAGGTGGGGGGAGCGG - Intergenic
929021254 2:37555509-37555531 TCTGAGAAAGAAGAGGTGAGAGG + Intergenic
929520652 2:42647516-42647538 TGGGAGGCAGGTGGGGTGGGGGG - Intronic
929922780 2:46184501-46184523 GAGAAGGAAGAAGGGGTGAGAGG - Intronic
931449941 2:62360116-62360138 GGGGAAGAAAGAGGGGTGAGAGG + Intergenic
931833060 2:66072398-66072420 TCTCAGGGAGCAGGGGTGAGGGG + Intergenic
931868998 2:66439657-66439679 CAGGAGGAAGGGGAGGTGAGCGG + Intronic
933155505 2:78968884-78968906 GCTGTGGATGGAGGGGTGAGGGG - Intergenic
933717225 2:85370321-85370343 TCGGAGGAGGCTGAGGTGAGGGG + Intronic
933792422 2:85893728-85893750 TGTGAGGCAGGAGGGGTGAGGGG + Intergenic
933890066 2:86759814-86759836 GGGGAGGAAGGAAGGGGGAGGGG + Intronic
934113318 2:88762730-88762752 TCGGGGGATGGGGGGGTGGGGGG - Intergenic
935112616 2:100106023-100106045 TCGGAGGTGGGTGAGGTGAGAGG - Exonic
935465830 2:103397101-103397123 TCTCAGGTAGAAGGGGTGAGAGG - Intergenic
937126154 2:119476233-119476255 GGGGATGAAGGAGGGGTGGGTGG + Intronic
937277201 2:120692669-120692691 AGAGAAGAAGGAGGGGTGAGGGG - Intergenic
937279468 2:120707446-120707468 GCAGAGGCAGGAGAGGTGAGTGG + Intergenic
937419255 2:121740835-121740857 AAGGAGGAAGGAAGGGAGAGAGG - Intronic
937509054 2:122572490-122572512 GAGTAGGAAGGAGGGGTGAAAGG - Intergenic
937720809 2:125093369-125093391 AGGGTGGAAGGATGGGTGAGTGG - Intergenic
937977290 2:127589576-127589598 TAGGTGGATGGATGGGTGAGTGG + Intronic
937977364 2:127589818-127589840 TAGGTGGAAGGATGGGTGAGTGG + Intronic
938107832 2:128545291-128545313 CCAGGGGAGGGAGGGGTGAGAGG + Intergenic
938968393 2:136408298-136408320 TCTGAGGATGGAGGGGTGGAGGG + Intergenic
939043707 2:137223895-137223917 TAGGAGGAAGCGGGGGTGGGAGG - Intronic
941848117 2:170151620-170151642 ATGGAGGAAGGAAGGGAGAGAGG + Intergenic
942450755 2:176106891-176106913 GAGGAGGAAGGAGGGGGAAGAGG - Intronic
942482285 2:176402786-176402808 AAGGAGGAAGGAGGGGAGGGAGG - Intergenic
943629158 2:190231722-190231744 ACGGAGGAAGGAAGGGAGAGAGG + Intronic
944211197 2:197208329-197208351 AAGGTGGAAGGAGAGGTGAGTGG - Intronic
944320616 2:198337269-198337291 TGGGGGGAAGGAGGGGAAAGAGG + Intronic
944875332 2:203958941-203958963 TCCCAGGAAGAAGGGGTGAGGGG + Intronic
945231231 2:207592543-207592565 GGGGAGGAAGGAGGGAAGAGAGG - Intronic
946018365 2:216621975-216621997 TCGGAGGAGACAAGGGTGAGTGG + Intergenic
946422291 2:219571577-219571599 TGGGAGGGAGGAGGGGGAAGAGG - Intronic
946428708 2:219613454-219613476 TGGGGGGGAGGTGGGGTGAGTGG + Intronic
946921172 2:224584282-224584304 TCGGAGGAAGGCCGGGTGGGGGG - Intronic
947011250 2:225569420-225569442 TGAGAGAAAGGAGGAGTGAGGGG + Intronic
947634512 2:231673272-231673294 TCGGAGGAAGGAGGCGTTTGGGG + Intergenic
947741760 2:232487919-232487941 CAGGAGGAAGGAGGGGCGCGCGG - Intergenic
948091942 2:235302210-235302232 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
948735057 2:239998220-239998242 GTGAAGGAGGGAGGGGTGAGGGG - Intronic
948922824 2:241073701-241073723 TTGGAGAAGTGAGGGGTGAGGGG - Intronic
948943846 2:241209656-241209678 CAGGAGGATGGAGGCGTGAGCGG - Intronic
1168900314 20:1358308-1358330 TGGGAAGAAGGAGGAGGGAGGGG + Intronic
1169027877 20:2385390-2385412 TTGTAGGGAGGAGGGCTGAGAGG + Intronic
1169130479 20:3164215-3164237 TAGGAGGAGGGCAGGGTGAGTGG - Exonic
1169260716 20:4136181-4136203 GTGGAGGAAGGTGGGGTGAGGGG + Intronic
1170205413 20:13792671-13792693 CCGGAGAAAAGAGGGCTGAGGGG + Intronic
1171010136 20:21505168-21505190 TCTGAGGAGGGAGGGGAGAAGGG + Intergenic
1171204253 20:23266871-23266893 TAGTAGGAAGGGGGGGTGGGAGG + Intergenic
1171349632 20:24492646-24492668 GCGGGGGAAGGAGGGGTGGAGGG - Intronic
1172035986 20:32010991-32011013 TCAGAGTCAGAAGGGGTGAGGGG - Intronic
1172619043 20:36307447-36307469 GCGGAGGAAGAAGGGGAGAAGGG - Intronic
1172801001 20:37576186-37576208 AAGGAGGAAGGGAGGGTGAGAGG - Intergenic
1173185185 20:40834958-40834980 TTGGAGGAAGGAGGGGTTTGTGG + Intergenic
1173301861 20:41810528-41810550 ACTGTGGAGGGAGGGGTGAGTGG - Intergenic
1173655339 20:44696621-44696643 TGGGAGGAAGGAGGGAGGGGAGG - Intergenic
1175279445 20:57793411-57793433 TCGGGGGTGGGAGGGGTGAGGGG + Intergenic
1175333794 20:58181967-58181989 GCAGAGGAAGGACAGGTGAGAGG - Intergenic
1175817964 20:61893401-61893423 ATGGTGGATGGAGGGGTGAGTGG + Intronic
1175901164 20:62360418-62360440 TGGGTGGAGGGATGGGTGAGTGG + Intronic
1175934890 20:62509985-62510007 GTGGAGGATGGAGGGGTGAAGGG - Intergenic
1175934988 20:62510253-62510275 GTGGAGGATGGAGGGGTGAAGGG - Intergenic
1175994090 20:62804693-62804715 TCGGGGGAGGGAGGGGCGCGGGG + Intergenic
1176257260 20:64158857-64158879 GTGGAGGTAGGAGGGGGGAGGGG - Intronic
1177847817 21:26312093-26312115 TGGGAGGAAGGATGGGAGTGGGG + Intergenic
1178342049 21:31794041-31794063 TCAGAGGATGGAAGCGTGAGTGG - Intergenic
1178393094 21:32215258-32215280 AGGGGGAAAGGAGGGGTGAGAGG - Intergenic
1178661378 21:34510394-34510416 GGGGAGGAAGGAGGGGAGAATGG - Intergenic
1179086719 21:38224982-38225004 GCTGAGGAAGGAGGGGTATGTGG - Intronic
1179511465 21:41876828-41876850 TCGGAGGCAGAAGGGGAGATGGG - Intronic
1179626757 21:42653521-42653543 ACGGGGGAGGGAGGGGGGAGGGG + Intergenic
1180003998 21:45011575-45011597 AGGTTGGAAGGAGGGGTGAGTGG - Intergenic
1180024909 21:45155594-45155616 TGGGTGGATGGATGGGTGAGTGG - Intronic
1180069340 21:45428279-45428301 TCTGAGGAAGGTGGGGCCAGGGG + Intronic
1180182381 21:46123761-46123783 TGGGGGGATGGATGGGTGAGTGG + Intronic
1180651333 22:17379410-17379432 CCGCAGGGAGGAGGGGTGAGGGG + Intronic
1180996131 22:19966298-19966320 TCGGAGGCACGAGGGGTGAGGGG + Intronic
1180998396 22:19976732-19976754 CCGGAGGAAGCAGAGGAGAGAGG + Intronic
1181437187 22:22917839-22917861 AGGGAGGAAGGGGAGGTGAGCGG - Intergenic
1181936579 22:26443072-26443094 GGGGGGGAAGGAGGGGTGAGAGG - Intronic
1182086690 22:27565734-27565756 TGGATGGAAGGAAGGGTGAGTGG + Intergenic
1182104442 22:27679337-27679359 ACGGAGGAAGGATGGGGGCGGGG + Intergenic
1182744680 22:32596504-32596526 TCTGAGGAAGGTGGGCTGGGAGG + Intronic
1183002363 22:34871981-34872003 TGGGAGGCAGGAGGGTTCAGTGG - Intergenic
1183095260 22:35548113-35548135 TGGGGGGAAGAAGGGGTGAGTGG + Intronic
1183320894 22:37164455-37164477 TGGCAGGAGTGAGGGGTGAGGGG + Intronic
1183517675 22:38276576-38276598 TTGCATGGAGGAGGGGTGAGAGG - Intergenic
1184091112 22:42293495-42293517 TCTGAGGACAGCGGGGTGAGGGG + Intronic
1184359650 22:44007266-44007288 TGGGAGGAAGGTGGGCTGGGGGG + Intronic
1184444631 22:44540011-44540033 TGGGTGGATGGATGGGTGAGTGG + Intergenic
1184653352 22:45929380-45929402 TGGAAGGATGGATGGGTGAGTGG - Intronic
1184653411 22:45929640-45929662 TGGGTGGAAGGATGGATGAGTGG - Intronic
1184653433 22:45929720-45929742 TCGGTGGGTGGATGGGTGAGTGG - Intronic
1184855218 22:47142804-47142826 TAGGAGGATGGATGGATGAGTGG - Intronic
1184867618 22:47210185-47210207 TGGGAGGAATGAGGGGTCAGTGG - Intergenic
1184997886 22:48223663-48223685 TCAGAAAGAGGAGGGGTGAGAGG - Intergenic
1185222765 22:49637201-49637223 TCTGAGGCAGGACGGGGGAGCGG + Intronic
1185245131 22:49769425-49769447 GGGGAGGAGCGAGGGGTGAGGGG - Intergenic
1185281474 22:49971774-49971796 CAGGAGGAGGGAGGGGAGAGGGG + Intergenic
1185287944 22:50010793-50010815 TGGGGGGAAGGTGGGGGGAGCGG + Intronic
1185391066 22:50562130-50562152 GCGGGGTGAGGAGGGGTGAGGGG + Intronic
1185391186 22:50562453-50562475 GCGGGGTGAGGAGGGGTGAGGGG + Intronic
1185391203 22:50562496-50562518 GCGGGGTGAGGAGGGGTGAGGGG + Intronic
950018067 3:9768201-9768223 TCGGGGGAAGGAGGAGGGAAAGG - Intronic
950025792 3:9819151-9819173 TGGGAGGATGGAAGGATGAGTGG - Intronic
950098389 3:10343254-10343276 TCGGGGGCTGGAGGGGAGAGGGG - Intronic
950441524 3:13013588-13013610 TGGGCGCAAGGAGGGGTAAGCGG - Intronic
950475862 3:13214472-13214494 TTGGAGGAAGGAGGGCTACGAGG - Intergenic
950540164 3:13607703-13607725 TCTGAGGAGTGAGGGATGAGAGG + Intronic
951202638 3:19892004-19892026 TCTGAGGAGGGAGGGGTCAGAGG - Intronic
952815270 3:37442160-37442182 GCGGGGCAAGAAGGGGTGAGGGG - Intergenic
953386418 3:42508757-42508779 TGGGAGGCAAGAGGGGAGAGAGG - Intronic
954036314 3:47852950-47852972 TGGGAGGAGGGAAGGGAGAGGGG + Exonic
954219411 3:49143870-49143892 TCTGAGGAAGGAGGGCTGAATGG - Intergenic
956148851 3:66220691-66220713 GCGGAGGGAGGAGTCGTGAGGGG - Intronic
956805339 3:72804421-72804443 TCGGAGGGTGGCGGGGTGGGGGG - Intronic
958465335 3:94450255-94450277 ACGGGAGAAGGAGGGGTGATTGG + Intergenic
958769947 3:98414323-98414345 TGGGAGGTAGGAGGAGGGAGAGG - Intergenic
959257126 3:104029852-104029874 CAGGTGGAAGAAGGGGTGAGGGG - Intergenic
959380030 3:105630604-105630626 TGATAGGAAGGAGGGGAGAGGGG - Intergenic
960332471 3:116378762-116378784 TGGGAGGAAGGTGGAGTAAGAGG - Intronic
961324268 3:126101080-126101102 CCGGGGGAAGGAGGGGTGTGCGG - Intronic
961553109 3:127680206-127680228 GGGTGGGAAGGAGGGGTGAGAGG + Intronic
961676707 3:128572060-128572082 TCGGAGGAAGGATGAGTCTGAGG - Exonic
961825876 3:129598754-129598776 TTGGAGGAATGAGGGGTCACAGG + Intronic
962701756 3:138007540-138007562 TCGGGGGTCGGGGGGGTGAGGGG + Intronic
962745060 3:138390735-138390757 TAGCAGGGAGGAGGGGTGTGTGG - Intronic
962752092 3:138441023-138441045 TCTGAGAAAGCATGGGTGAGGGG + Intronic
963060708 3:141222500-141222522 TGGGAGGGAGGAAGGGTCAGAGG + Intergenic
963108252 3:141664665-141664687 TTGGGGGAAGGAAGGGAGAGAGG - Intergenic
963591267 3:147262576-147262598 TGGGAGGAAGGAGGAGTTCGGGG - Intergenic
964479378 3:157126868-157126890 TGGGAGGGAGGAGAGGTAAGGGG - Intergenic
965881648 3:173395643-173395665 GCGGCGGCAGGAGGGGTGAAGGG - Intergenic
966623767 3:181994400-181994422 TGGGAGGAAGGTTGGGAGAGGGG - Intergenic
966882941 3:184360195-184360217 TAGGAGGAGGGAGGTGAGAGTGG + Intronic
967817703 3:193813280-193813302 TCTGAGGTAGTGGGGGTGAGGGG - Intergenic
968441552 4:626917-626939 TCTGAGGAAGAAGGGGAGGGGGG + Intronic
968585394 4:1413939-1413961 GGGGAGGAAGGAGGAGTAAGGGG + Intergenic
968598483 4:1497612-1497634 TGGAAGGACGGATGGGTGAGTGG + Intergenic
968983337 4:3862748-3862770 GCCGAGGCAGGTGGGGTGAGTGG - Intergenic
969256765 4:6007736-6007758 TCTGAGGATGGACAGGTGAGTGG + Intergenic
969344283 4:6561461-6561483 TCGGAAGGAGGTGGGGGGAGGGG + Intronic
969392844 4:6902360-6902382 CCGAAGGAAGTAGGGATGAGAGG + Intergenic
969847399 4:9930132-9930154 AGGGAGGAAGGAGAGGGGAGGGG - Intronic
969959109 4:10925098-10925120 TTGGAGAAAAGAGGGGAGAGTGG - Intergenic
971074131 4:23128563-23128585 TCCGAGGAAGGTGGTGTCAGTGG + Intergenic
971864837 4:32156290-32156312 GGGGAGGGAGGAGGGGAGAGGGG - Intergenic
972099023 4:35388765-35388787 TCAGAGGAAAGAAGGGTGGGAGG - Intergenic
972254601 4:37339821-37339843 TGGGAGGATGGGAGGGTGAGAGG - Intronic
972279599 4:37589579-37589601 AAGGAGGAAGGAGGGGTAAGGGG - Intronic
972782869 4:42301202-42301224 GGGAGGGAAGGAGGGGTGAGAGG + Intergenic
973309078 4:48687491-48687513 TCGGGGGGGGGGGGGGTGAGGGG + Intronic
974683718 4:65196213-65196235 GGGGAGGAAGGAGGGGAGGGAGG - Intergenic
974715819 4:65668845-65668867 GCCGCGGCAGGAGGGGTGAGGGG - Intronic
974855821 4:67459459-67459481 TCGGGGGTGGGAGGGGCGAGGGG + Intergenic
975144487 4:70952723-70952745 TCTGAGGTAGGTGGGGTAAGAGG + Intronic
976801692 4:88999703-88999725 GGGGAGAAAGGAGGGGTAAGAGG - Intronic
977685853 4:99846970-99846992 TCATTGGAAGGAGGGGAGAGAGG + Intronic
978728341 4:111997019-111997041 ATGGAAGAAGGAGAGGTGAGTGG - Intergenic
980567757 4:134567451-134567473 TCTGAGGAAGGTGGAGTGACAGG - Intergenic
983599203 4:169505317-169505339 GCTGAGGAAGGAGGAGTAAGAGG - Intronic
983649049 4:170020615-170020637 TGGGAGGAGGGAGGGGGGAGGGG - Intronic
983904415 4:173169158-173169180 GCGGAGGAAGGGGCGGCGAGGGG - Intronic
984093294 4:175402690-175402712 TCGGGGGAAGGAGGGGTCTGTGG + Intergenic
984888973 4:184474626-184474648 GCGGAGGGAGGAGGGCGGAGAGG - Intergenic
985139853 4:186828803-186828825 TGGGAGGAGGGAGAGGTGAATGG - Intergenic
985211846 4:187604034-187604056 GGGGAGGAAGGGGGGGAGAGGGG - Intergenic
985723109 5:1501054-1501076 TCTGAGGTGGGAGGGGTAAGGGG + Intronic
985821159 5:2161129-2161151 TGGGTGGATGGATGGGTGAGGGG - Intergenic
985851616 5:2392588-2392610 TGGGAGGAGGGAAGGGAGAGAGG - Intergenic
985903450 5:2814592-2814614 TCTGAGGGAGGAGGAGTGAAGGG + Intergenic
985993689 5:3584567-3584589 ACGGAGGGAGGAGGGATGGGAGG + Intergenic
986035592 5:3933954-3933976 CCTGAGAAAGGAGGGGTAAGAGG + Intergenic
986283973 5:6346502-6346524 TGGAAGAAAGGAAGGGTGAGAGG + Intergenic
986304662 5:6506361-6506383 TGGGAGGAAGCAGGGCTGCGTGG + Intergenic
986390878 5:7287235-7287257 AAGGAGGAAGGAGGAGGGAGGGG - Intergenic
987050330 5:14143318-14143340 GGGAAGGAAGGAGGGGGGAGGGG - Intergenic
987237727 5:15959839-15959861 TATGAGGAGAGAGGGGTGAGGGG + Intergenic
987374091 5:17218038-17218060 TCGCATGGTGGAGGGGTGAGGGG + Intronic
988669191 5:33362700-33362722 ACTAAGGGAGGAGGGGTGAGGGG + Intergenic
988731423 5:33976577-33976599 GTGGAGGTTGGAGGGGTGAGGGG + Intronic
989679210 5:44009281-44009303 TCAGGGGAAGTAGGGGAGAGGGG - Intergenic
990449933 5:55924622-55924644 GAGGGGGAAGGAGGGGTGGGAGG - Intergenic
991004202 5:61811841-61811863 TGGGAGGAAGTAAGGGTTAGTGG + Intergenic
991511571 5:67382992-67383014 AATGAGGAAAGAGGGGTGAGTGG - Intergenic
991655693 5:68901950-68901972 TCGGAGGCAGGGGTGGTGGGTGG - Intergenic
992008121 5:72499655-72499677 TCTCTGGAAGTAGGGGTGAGAGG + Intronic
993299125 5:86184630-86184652 TCAGAGCCAGGAGGAGTGAGGGG + Intergenic
994603893 5:101942824-101942846 CCGGAGGAGGGAGCTGTGAGAGG - Intergenic
995016792 5:107318887-107318909 GAGGAGGAAGGAGGGGAGAAAGG + Intergenic
996009529 5:118466239-118466261 TTGGAGGGTGGGGGGGTGAGAGG - Intergenic
996030750 5:118701977-118701999 CCTTTGGAAGGAGGGGTGAGGGG + Intergenic
996088245 5:119325805-119325827 TCAGGGGAAGGAGGGGACAGGGG - Intronic
996553196 5:124751195-124751217 TGGGAGGAAGGAGGTGGGGGTGG - Intergenic
997093752 5:130886884-130886906 TCTGAAGAAGGAGGTGTGAGTGG - Intergenic
997340138 5:133138070-133138092 TTGGAGGATGGAGTGGGGAGAGG + Intergenic
997413556 5:133708145-133708167 ACGAAGGAAGGAAGGGAGAGAGG + Intergenic
997723986 5:136105015-136105037 TCGGAGGGAATGGGGGTGAGAGG + Intergenic
997873855 5:137530806-137530828 TGGGAGAAAGGAGGGCTAAGTGG + Intronic
998006912 5:138663158-138663180 CTGGAGATAGGAGGGGTGAGTGG - Intronic
998206343 5:140159418-140159440 TAGGAGGAAGGAGGGAGAAGGGG - Intergenic
998611508 5:143694301-143694323 GAGGAGGAGGGAGGGGGGAGGGG - Intergenic
999185655 5:149706502-149706524 TGGGAGGAAGGGAGGGAGAGTGG - Intergenic
999481628 5:151953745-151953767 TTGGGGACAGGAGGGGTGAGAGG + Intergenic
999643415 5:153694919-153694941 TAGGAGGAAGGAAGGGAGAAAGG + Intronic
999737621 5:154524390-154524412 ACTGAGGAAGGAGAGCTGAGCGG + Intergenic
1000064547 5:157683520-157683542 GAGGAGGAGGGAGGGGTGGGGGG - Intergenic
1000781040 5:165481630-165481652 TCATAGGTTGGAGGGGTGAGCGG - Intergenic
1000808841 5:165835154-165835176 TGGGAGGTAGGAGTGGTGGGTGG + Intergenic
1001108372 5:168875138-168875160 AGGGAGGAAGGAGGGAAGAGAGG + Intronic
1001409719 5:171502213-171502235 CGGGAGGGAGGAGGGGTGACTGG - Intergenic
1001597400 5:172907031-172907053 GCGGAGGAGGGTGAGGTGAGGGG - Intronic
1001828780 5:174767836-174767858 TGGGTGGAAGGATGGGTGGGTGG - Intergenic
1001919511 5:175589029-175589051 CAGGAGGAAAGAAGGGTGAGAGG + Intergenic
1002074590 5:176700550-176700572 GAGGAGGAAGGAGTGCTGAGCGG + Intergenic
1002854907 6:1027780-1027802 ACGGAGGAAGGAAGGGAGAGAGG + Intergenic
1002904901 6:1440333-1440355 CTGGAGCAGGGAGGGGTGAGAGG + Intergenic
1002917973 6:1544256-1544278 TGGGTGGATGGATGGGTGAGTGG + Intergenic
1002921782 6:1578049-1578071 TGAGACGCAGGAGGGGTGAGAGG + Intergenic
1003973173 6:11318355-11318377 AGGAAGGAAGGAGGGGTGAGAGG + Intronic
1004350243 6:14884355-14884377 TAGGAGGAAGGAGGGAGCAGCGG + Intergenic
1005048980 6:21666391-21666413 AGAGAGGAAGAAGGGGTGAGAGG + Intergenic
1005080680 6:21953664-21953686 TCTGAGGAAGGAGGGGTTGTGGG - Intergenic
1005490353 6:26342050-26342072 TGGGAGGAGGGAGAGGAGAGAGG + Intergenic
1005564894 6:27081292-27081314 TCAGAGGAAGGAAGGGTGACTGG - Intergenic
1005959105 6:30683835-30683857 TCCTAGGATGGAGGGGAGAGGGG - Intronic
1006454745 6:34125352-34125374 TCGGAGGAAGCAGGCTTGAGAGG + Intronic
1007102811 6:39261671-39261693 TAGGATGAAGGTGGGGAGAGAGG + Intergenic
1007423855 6:41734883-41734905 TCGGAGGTAGGGGAGGTGTGCGG - Intronic
1007914056 6:45544367-45544389 TGAGAGGAAGGAGTGGGGAGGGG + Intronic
1007959692 6:45947470-45947492 GCAGTGGATGGAGGGGTGAGGGG - Intronic
1008140045 6:47821761-47821783 TCGGATGTATGAGGTGTGAGTGG - Intronic
1008390212 6:50941753-50941775 GTGGAGGAAGGAGGGGTTTGGGG + Intergenic
1008545211 6:52577399-52577421 GCGGAGGAAGGAGCGGAGCGAGG - Intergenic
1008881586 6:56385712-56385734 TGGGAGGAAGGGAGGGGGAGTGG - Intronic
1011743643 6:90387989-90388011 TGGGAAGGAGGAGGGGAGAGAGG - Intergenic
1013188917 6:107785498-107785520 TGGGTGGATAGAGGGGTGAGTGG + Intronic
1013245135 6:108279170-108279192 TGGCAGGGAGGTGGGGTGAGGGG - Intergenic
1013364283 6:109424099-109424121 AGGGTGGCAGGAGGGGTGAGCGG + Intronic
1014023299 6:116616072-116616094 ACGGAGGAAGGAAGGGAGGGAGG - Intergenic
1014176369 6:118335749-118335771 TGGGAGGAAGGAGAGGGGAAGGG + Intergenic
1014734330 6:125074356-125074378 TGGGAGGAAGGGGGAGAGAGAGG + Intronic
1014802330 6:125790935-125790957 CGGGTGGAAGGAGGGGTCAGGGG - Exonic
1015244709 6:131063124-131063146 TCGGGGTAAGGAGGCGTGCGGGG - Intronic
1015303464 6:131680112-131680134 TTGGAGGAAGCAGGGGAAAGTGG + Intronic
1015620603 6:135127859-135127881 TGGGGGGAAGGATGGGAGAGGGG + Intergenic
1015770899 6:136767355-136767377 AGGGAGGAAGGAGGAGGGAGGGG + Intronic
1016058912 6:139607938-139607960 AAGGAGGAAGGAGTGGTGAGGGG - Intergenic
1016093602 6:140009086-140009108 ACTGAGGAAGGAGGGATGGGAGG + Intergenic
1017027429 6:150193616-150193638 GGGGAGGAGGGAGGGGTGGGAGG + Intronic
1019017653 6:168891542-168891564 TCTGAGGTTGGAGGGGTGGGAGG - Intergenic
1019055244 6:169218766-169218788 TGGGTGGATGGAGGGATGAGTGG + Intronic
1019549455 7:1594819-1594841 TGGGAGGATGGATGGGTGGGAGG - Intergenic
1019549472 7:1594871-1594893 TGGGAGGATGGATGGGTGGGAGG - Intergenic
1019660894 7:2223485-2223507 CCCGAGGAAGGCAGGGTGAGAGG - Intronic
1019999098 7:4744771-4744793 TGGGCGGAAGGAGGGGAAAGGGG - Intronic
1020331111 7:7017803-7017825 TGGGTGGCAGGAGGTGTGAGGGG - Intergenic
1020852110 7:13367483-13367505 TGGGAGGGAGGAAGGGAGAGAGG - Intergenic
1021697083 7:23286248-23286270 GAGGGGGAAGGAGGGGGGAGAGG - Intergenic
1022378872 7:29841308-29841330 GAGGAGCAAGAAGGGGTGAGGGG - Intronic
1022973709 7:35538624-35538646 TGGGAGGAAGGAGAGGTTGGGGG - Intergenic
1023113357 7:36836650-36836672 TCGGAGGATGGGGGGGCAAGAGG + Intergenic
1023382486 7:39623228-39623250 TTGGGGGAAGGAGGGGAGAGCGG - Intergenic
1023533402 7:41183012-41183034 TGGGAGGAGGGAGGGAGGAGAGG - Intergenic
1023563499 7:41500396-41500418 TGGGAGGAAGGACTGGTGGGTGG + Intergenic
1023757319 7:43431847-43431869 TGGGATGAAGAAGGGGTGGGAGG - Intronic
1023867672 7:44245977-44245999 AGGGAGGAAGGAAGGGAGAGAGG + Intronic
1024300521 7:47884176-47884198 TGGGGGGAAGGCGGGGGGAGTGG + Intronic
1024300649 7:47885087-47885109 TCTGGGAAAGGAGGGCTGAGGGG - Intronic
1024696072 7:51857859-51857881 AAGGAGGAACGAGGGGAGAGAGG + Intergenic
1025198692 7:56949388-56949410 GGGGAGGAAGGAGAGGGGAGAGG - Intergenic
1025673256 7:63627543-63627565 GGGGAGGAAGGAGAGGGGAGAGG + Intergenic
1025995745 7:66526315-66526337 TCGGTGCAAGGATGGGAGAGTGG + Intergenic
1026122512 7:67550295-67550317 AGGGAGGAAGGAGAGGGGAGGGG - Intergenic
1026361068 7:69600592-69600614 TGGGAGAAAGGAGGGAGGAGGGG + Intronic
1026817182 7:73522035-73522057 TGGGGGAAGGGAGGGGTGAGAGG + Exonic
1029436154 7:100565162-100565184 TGGGACGAGGGAGGGGAGAGAGG - Exonic
1029588789 7:101493274-101493296 ATGGAGGAAGGAGGGAAGAGTGG - Intronic
1029653965 7:101912232-101912254 GAGGAGGAGGGAGGGGGGAGGGG - Intronic
1030403403 7:109081042-109081064 TCTGAGGAAGAAGAGGTGTGAGG + Intergenic
1030617871 7:111757123-111757145 TGAGAGGGAGGAGGGGTGAGTGG + Intronic
1031630202 7:124034482-124034504 TCGGGGGAAGGAGGAGAAAGAGG - Intergenic
1031846547 7:126811971-126811993 TTGAAGGGTGGAGGGGTGAGAGG + Intronic
1032240095 7:130153568-130153590 TAGGAGGAAGGAGGAAGGAGAGG + Intergenic
1032948091 7:136874573-136874595 TGGGAGGGAAGAGGGGAGAGAGG - Intronic
1033225488 7:139559209-139559231 TTGGATGAAGGTGGGCTGAGGGG + Intergenic
1033643831 7:143286307-143286329 TCAGCGGGAGGAGGGGTCAGAGG + Intronic
1033658881 7:143390554-143390576 TGGGAAGAAGGAAGGGTGAGGGG - Intronic
1034274417 7:149817801-149817823 TCAGTGGAGGGAGGGGTTAGAGG + Intergenic
1034461337 7:151199600-151199622 TGGGAGGAAGGAGGGGCCAGGGG - Intronic
1034470521 7:151252052-151252074 GCGGAGGGAGGAGGGATGCGGGG + Intronic
1034859478 7:154583367-154583389 GAGGAAGAGGGAGGGGTGAGCGG - Intronic
1035659313 8:1334857-1334879 TCAGAGGAAAGAGGCGAGAGAGG - Intergenic
1036690362 8:10941163-10941185 CCGGAGGAAGGACAGGAGAGAGG - Intronic
1036729657 8:11250983-11251005 TGGGAGGTAGCAGGGTTGAGGGG - Intergenic
1037098063 8:15008814-15008836 ACGGAGGGAGGAAGGGAGAGAGG + Intronic
1037930579 8:22877829-22877851 TCGGAGGAGGGTGGAGGGAGAGG + Intronic
1038314754 8:26474787-26474809 TGGGGAGAAGGAGGGATGAGTGG - Intronic
1038475957 8:27868221-27868243 TCGGGGGAAGGAGAGGCAAGGGG + Intergenic
1039059910 8:33565264-33565286 AAGGAGGAAGGCGGGGTGGGGGG + Intronic
1039616467 8:38958516-38958538 TCGGCGGAAGGAGTTGTGACAGG - Intronic
1039854281 8:41398946-41398968 TCTGAAGAAGGAGCTGTGAGGGG - Intergenic
1039854359 8:41399578-41399600 CCGTAGGAAGTAGGGGTGAAAGG - Intergenic
1040079760 8:43274875-43274897 TCAGAAGGAGGAGGAGTGAGAGG - Intergenic
1042230013 8:66545678-66545700 TTGGAGGAAGGAGGGGAGGGAGG + Intergenic
1042591274 8:70402122-70402144 CCGGAGGAAGGAAGGGGGCGGGG - Intronic
1043320135 8:78974251-78974273 TAGGAGGAAGGAAGGAAGAGTGG + Intergenic
1043624170 8:82233737-82233759 TAGGTGGAAGGAGCGATGAGAGG + Intergenic
1043837178 8:85061266-85061288 CTGGAGCCAGGAGGGGTGAGGGG + Intergenic
1044698769 8:94948769-94948791 GGGGAGTGAGGAGGGGTGAGAGG + Intronic
1044916219 8:97115080-97115102 GGGGAGGAAGGAGGTGTGACAGG + Intronic
1045520466 8:102898660-102898682 TGGGAGGAAGGAGAGAAGAGGGG + Intronic
1045553758 8:103195550-103195572 TACGAGGAGGGAGGGATGAGTGG + Intronic
1045747495 8:105440793-105440815 TCAGAGGTAGGAGGAGAGAGAGG - Intronic
1045806465 8:106168179-106168201 TTGGAGGAAAGAGGGAGGAGAGG - Intergenic
1045844677 8:106619936-106619958 TAGGAGGGAGGAGGAGAGAGAGG - Intronic
1046547467 8:115669237-115669259 GGGGAGGGAGGAGGGGGGAGAGG - Intronic
1046967493 8:120183863-120183885 TCGGAGAAAGGAAGGGAGGGAGG - Intronic
1047321119 8:123784089-123784111 TCATAGGCAGCAGGGGTGAGTGG - Intronic
1047701763 8:127456098-127456120 TGAGAGGAAGGAAGGGTGGGTGG - Intergenic
1048445093 8:134487388-134487410 TGTGAGGAAGGCAGGGTGAGGGG + Intronic
1048541622 8:135347117-135347139 GGGGAGGAAGGAGAGGGGAGGGG + Intergenic
1048551915 8:135441442-135441464 CAGGAGGAAGGAGGGGAGTGTGG + Intergenic
1048833387 8:138497115-138497137 GCGGAGGAAGGAGAGGAGTGAGG - Intergenic
1049038648 8:140096231-140096253 TCGGAGGGAGGAGAGGAGACAGG + Intronic
1049109819 8:140635697-140635719 GGGGAGGAAGGAGGAGGGAGGGG + Intergenic
1049162595 8:141106774-141106796 TAGGGGGAAGGAGGAGTGAGAGG - Intergenic
1049274316 8:141712048-141712070 TGGGAGGAAGGAGGGGTCACTGG + Intergenic
1049370276 8:142261081-142261103 AAGGAGGAAGGAGGGAAGAGAGG + Intronic
1049407084 8:142456619-142456641 TCGGTGCAAGGAGGGGCTAGAGG - Intronic
1049440828 8:142608855-142608877 CCGGAGGCTGGAGGGGTGGGTGG - Intergenic
1049477159 8:142802082-142802104 TAGAAGGGAGGAGGGGTGGGTGG + Intergenic
1049635780 8:143688383-143688405 TGGGAGGGACGAGGGGTCAGGGG + Intronic
1050000247 9:1069943-1069965 TAGGAGGAAGGAGGAGGAAGAGG + Intergenic
1050088675 9:1993399-1993421 AAGGAGGAAGGAAGGGTGAGAGG - Intergenic
1050908261 9:11032997-11033019 AAGGAGCAAGTAGGGGTGAGTGG - Intergenic
1051068606 9:13135482-13135504 TCAGAGGTAGCAGGGGAGAGAGG - Intronic
1051910925 9:22154101-22154123 TGAGAGGAAAGCGGGGTGAGCGG - Intergenic
1053431542 9:38044920-38044942 ACAGAGGAGGGAGGGGTGGGAGG + Intronic
1054380964 9:64488686-64488708 CCGGAGGAAGGAGCGGGCAGTGG + Intergenic
1054741541 9:68811051-68811073 TAGGAGGAAGGAGAGGAGCGAGG - Intronic
1055052698 9:71995977-71995999 CTGGAGGAAGGAGAGGTTAGAGG + Intergenic
1055422616 9:76160170-76160192 TTGGAGGAAGCAGGGAGGAGAGG - Intronic
1055533428 9:77211260-77211282 TCTGGGGAAGGACGGGTGGGTGG - Intronic
1055954431 9:81760987-81761009 CAGGAGCAAGGAGGGGTCAGTGG - Intergenic
1056271722 9:84953994-84954016 TTGGGGGAAGGAGGGCGGAGAGG + Intronic
1056682321 9:88730539-88730561 TAGGTGGAAGGATGGGTGGGTGG - Intergenic
1058063180 9:100521262-100521284 TTTCAGGAAGGAAGGGTGAGGGG - Intronic
1058297448 9:103326920-103326942 TTGGAGGCAGTAGGGGTCAGGGG - Intergenic
1059327009 9:113510083-113510105 TCGGGGGAAGGATGGGAGGGGGG - Intronic
1059352943 9:113678481-113678503 ACGGAGGAAGGAAGGAAGAGAGG - Intergenic
1059470474 9:114501625-114501647 GCGATGGAAGGTGGGGTGAGGGG - Intronic
1059517018 9:114905501-114905523 GCTGAATAAGGAGGGGTGAGGGG + Intronic
1059641643 9:116222680-116222702 CCAGAGGCAGGTGGGGTGAGTGG + Intronic
1059671243 9:116494386-116494408 CCTGAGGGAGCAGGGGTGAGGGG - Intronic
1059787817 9:117605647-117605669 TAGGAGGCAGGAAGGGCGAGAGG + Intergenic
1060283385 9:122228547-122228569 TTGCAGGAAGGAGGGGTACGAGG - Intronic
1060858844 9:126937320-126937342 TGGGAGGAAGGATGAGAGAGTGG + Intronic
1060875297 9:127078914-127078936 TCAGAGGAAGGAGTGTTGAGAGG - Intronic
1060949510 9:127592679-127592701 TCGCATGGAGGAGGGGTGAAGGG - Intergenic
1061375103 9:130219566-130219588 TCGAAGGAATGGGGGGCGAGAGG - Intronic
1061385920 9:130289332-130289354 GCGGAAGATGGGGGGGTGAGGGG + Intronic
1061483409 9:130908488-130908510 TGGGTGGAAGGAGGGGAGATGGG - Intronic
1061493147 9:130957179-130957201 TAGGTGGAGGGTGGGGTGAGGGG + Intergenic
1061719769 9:132544331-132544353 TCGAGGGCAGGAGCGGTGAGAGG - Intronic
1062080846 9:134622615-134622637 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
1062080877 9:134622714-134622736 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
1062080908 9:134622815-134622837 GAGGAGGGAGGAGGGGGGAGGGG - Intergenic
1062127368 9:134870795-134870817 TAGGACGAAGGTGGGGTGGGAGG + Intergenic
1062146960 9:134994865-134994887 TGGGGGGAAGGAGAGGTGGGAGG - Intergenic
1185462189 X:338547-338569 TCAGTGGGAGGACGGGTGAGTGG - Intronic
1185829736 X:3289233-3289255 TGGGAGGAAGGAGATGAGAGAGG - Intergenic
1186122877 X:6382463-6382485 CTGGGGCAAGGAGGGGTGAGTGG - Intergenic
1186284352 X:8027458-8027480 TGGAAGGAAGGAAGGATGAGTGG - Intergenic
1186309022 X:8297151-8297173 AGGGAGGAAGGAAGGGGGAGCGG - Intergenic
1186430099 X:9497880-9497902 GAGGAGGAAGGAGGGGAGGGAGG - Intronic
1186497634 X:10024523-10024545 TCGGAGGAAGGAGGGGTGAGAGG + Intronic
1186838446 X:13460960-13460982 AGGGAGGAAGGAAGGGAGAGAGG + Intergenic
1187055440 X:15738046-15738068 TAGGAGGGAGCAGGGGTGAATGG + Intronic
1187425943 X:19177166-19177188 TCTGAGGGAGGAAGGGAGAGAGG + Intergenic
1189124831 X:38435467-38435489 AGGGAGGAAGGAAGGATGAGAGG - Intronic
1189347217 X:40251288-40251310 TAGAAGGAAGGAGGGGTGACTGG + Intergenic
1189710542 X:43807154-43807176 TCTGATGAAGGAGGGATAAGTGG - Intronic
1189763239 X:44343701-44343723 ACGGAGGGAGGAGGGGCGGGGGG + Intergenic
1191707097 X:64104873-64104895 AAGGAGGGAGGGGGGGTGAGGGG + Intergenic
1191899756 X:66028699-66028721 TCTGAGGTAGAAGGGGTAAGGGG - Intronic
1192222670 X:69207943-69207965 TCTGTGGAGGGTGGGGTGAGGGG + Intergenic
1193698811 X:84739811-84739833 TTGGAGAGAGGAGGGGAGAGAGG - Intergenic
1193721999 X:84997966-84997988 TGGGAGGTGGGAGGGGTGTGAGG + Intergenic
1194005879 X:88491321-88491343 TACAAGGAAGAAGGGGTGAGTGG + Intergenic
1194847729 X:98832519-98832541 AAGGAGGAAGGAGGGGTAAGGGG - Intergenic
1195083299 X:101390815-101390837 CGGGAGGAAGTCGGGGTGAGTGG + Exonic
1195803554 X:108737037-108737059 TGGCGGGAGGGAGGGGTGAGAGG + Intergenic
1196829294 X:119763611-119763633 TCTGAGGCTCGAGGGGTGAGTGG + Intergenic
1196920453 X:120580186-120580208 TAGGGTGAATGAGGGGTGAGGGG - Intergenic
1197103139 X:122680205-122680227 TCGGGGGAGGGATGGGTGGGAGG - Intergenic
1197547277 X:127840368-127840390 TTGGTGGAGGGAGTGGTGAGGGG + Intergenic
1197618294 X:128718802-128718824 TTGGGGGGTGGAGGGGTGAGGGG - Intergenic
1197776669 X:130122560-130122582 TAGGAGCAAGGGGGGGTGGGAGG + Intergenic
1198228796 X:134670328-134670350 TAGGAGGCAGGAGGTGGGAGGGG - Intronic
1198310619 X:135424055-135424077 TGGGAGGAGGGAGGGGGAAGTGG + Intergenic
1198321479 X:135521840-135521862 GGGGAGGAAGGAGGGGCCAGAGG - Intronic
1198441383 X:136666659-136666681 TTTGGGGAGGGAGGGGTGAGTGG + Exonic
1199744938 X:150766524-150766546 TGGGCGGAAGGAGGTGTGCGTGG - Exonic
1200135752 X:153873819-153873841 TGGGAGGAAGGAGGGAGAAGAGG - Intronic
1200384912 X:155880896-155880918 TAGGAGAAAGGATTGGTGAGGGG + Intergenic
1200979618 Y:9250440-9250462 TAGGAGGAAAGAGGAGTCAGAGG - Intergenic
1201516634 Y:14825324-14825346 ACAGTGGAAGGAGGGGAGAGAGG - Intronic
1201517642 Y:14835328-14835350 AGGGAGGAAGGAGGGAGGAGGGG + Intronic
1201517645 Y:14835335-14835357 AAGGAGGGAGGAGGGGTGGGAGG + Intronic
1201698521 Y:16854231-16854253 AGGAAGGAAGGAGGGGGGAGGGG - Intergenic
1201765414 Y:17569849-17569871 ACGGAGGAAGGGAGGGAGAGAGG + Intergenic
1201836138 Y:18336140-18336162 ACGGAGGAAGGGAGGGAGAGAGG - Intergenic
1202231787 Y:22666274-22666296 ATGGAGGAAGGAAGGGAGAGAGG - Intergenic
1202311371 Y:23529891-23529913 ATGGAGGAAGGAAGGGAGAGAGG + Intergenic
1202559431 Y:26140703-26140725 ATGGAGGAAGGAAGGGAGAGAGG - Intergenic