ID: 1186497635

View in Genome Browser
Species Human (GRCh38)
Location X:10024528-10024550
Sequence GGAAGGAGGGGTGAGAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4757
Summary {0: 1, 1: 5, 2: 47, 3: 501, 4: 4203}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186497621_1186497635 10 Left 1186497621 X:10024495-10024517 CCCCGAGCCATTCGGTTCTCCCT 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497622_1186497635 9 Left 1186497622 X:10024496-10024518 CCCGAGCCATTCGGTTCTCCCTT 0: 1
1: 0
2: 0
3: 7
4: 76
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497619_1186497635 20 Left 1186497619 X:10024485-10024507 CCATTCAGTGCCCCGAGCCATTC 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497631_1186497635 -10 Left 1186497631 X:10024515-10024537 CCTTTGGTTCGGAGGAAGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 216
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497625_1186497635 3 Left 1186497625 X:10024502-10024524 CCATTCGGTTCTCCCTTTGGTTC 0: 1
1: 0
2: 0
3: 14
4: 170
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497623_1186497635 8 Left 1186497623 X:10024497-10024519 CCGAGCCATTCGGTTCTCCCTTT 0: 1
1: 0
2: 0
3: 1
4: 131
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497629_1186497635 -9 Left 1186497629 X:10024514-10024536 CCCTTTGGTTCGGAGGAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203
1186497618_1186497635 25 Left 1186497618 X:10024480-10024502 CCGAGCCATTCAGTGCCCCGAGC 0: 1
1: 0
2: 0
3: 33
4: 139
Right 1186497635 X:10024528-10024550 GGAAGGAGGGGTGAGAGGAGTGG 0: 1
1: 5
2: 47
3: 501
4: 4203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186497635 Original CRISPR GGAAGGAGGGGTGAGAGGAG TGG Intronic
Too many off-targets to display for this crispr