ID: 1186498369

View in Genome Browser
Species Human (GRCh38)
Location X:10031032-10031054
Sequence TGTTAAGAATAGAAGTTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186498369 Original CRISPR TGTTAAGAATAGAAGTTGGC TGG Intronic
901326625 1:8370084-8370106 TGTTAAGAATAGTTTCTGGCTGG - Intronic
902923571 1:19681204-19681226 TTTTAAGAGTTGGAGTTGGCTGG + Intergenic
905558195 1:38904733-38904755 TTTTAAAAATAAAAATTGGCCGG + Intronic
905829418 1:41053177-41053199 TCTTAAGCATACAATTTGGCCGG - Intronic
906921546 1:50070021-50070043 TGCTAAGTATAGAAGTGTGCAGG + Intronic
907623049 1:56001534-56001556 GGTGAGGAATAGAAGGTGGCAGG + Intergenic
909290209 1:73873505-73873527 AGTCAAGAATGGAATTTGGCTGG + Intergenic
911719401 1:101174169-101174191 CGTTAATAGTAGATGTTGGCCGG + Intergenic
915941923 1:160123734-160123756 TGTTAAGACTAGAAATGGGAGGG - Intronic
916043989 1:160985024-160985046 AATTAAAAATAAAAGTTGGCTGG + Intergenic
916388129 1:164299990-164300012 AGTTAAGAAAAGTGGTTGGCTGG + Intergenic
917447823 1:175121566-175121588 TGACAAGGATAGAAGTTGGGAGG + Intronic
918737920 1:188090205-188090227 TATTAAGAAGAGAAGGAGGCTGG + Intergenic
919150650 1:193693308-193693330 TGGACAGAATAGAAGTTGGTTGG + Intergenic
919408870 1:197218872-197218894 AGTTAAGGCTAGAAGTTGGAAGG + Intergenic
919618366 1:199835392-199835414 TGTTGGCAATAGAGGTTGGCGGG - Intergenic
919687364 1:200496725-200496747 TGTCAAGAAGATAATTTGGCAGG - Intergenic
921087887 1:211813278-211813300 TGTTAAAAATATAAGTTCCCAGG + Intronic
921382304 1:214536486-214536508 TATTAAGACTACAAGTTAGCTGG + Intronic
922823441 1:228501017-228501039 TGTTAAAAATTGAAGGTGGGTGG - Intergenic
923559280 1:235026578-235026600 TGTAAAGAAAAGAGGTTGCCTGG + Intergenic
924108486 1:240673935-240673957 TGAAAAGAAAAGAAATTGGCTGG - Intergenic
1063226889 10:4024098-4024120 TCGTAAGAAAAGAAGTTGACTGG - Intergenic
1063273120 10:4534435-4534457 TTTTAAAAATAGAAGGGGGCTGG + Intergenic
1065471734 10:26089239-26089261 AGTCATGAATAGAAGTTGCCTGG + Intronic
1073024238 10:100474942-100474964 GGTTAACAACACAAGTTGGCTGG + Intronic
1073205284 10:101766030-101766052 TGTTGAGACTAGAAGGTAGCAGG - Intergenic
1073666244 10:105537297-105537319 TGATAAGAAAAGGAGATGGCAGG + Intergenic
1075004169 10:118818609-118818631 TGTCAAGAATAAAAGCTGGTTGG + Intergenic
1075117032 10:119635595-119635617 TGTTAAGAATGGAACTAGGTAGG + Intergenic
1077636180 11:3842448-3842470 TTTTAAAAATATAAGTAGGCTGG - Intergenic
1077652608 11:3987051-3987073 TGGTAAGATTAGAAGTTGCTGGG + Intronic
1077913240 11:6592647-6592669 GGTTAAGAAGAAAAATTGGCCGG - Intronic
1078097415 11:8309088-8309110 TGATCAGAAAAGAAGTAGGCTGG + Intergenic
1080421705 11:32116744-32116766 TGTAAAGAGTTGAAGCTGGCTGG + Intergenic
1080460911 11:32454191-32454213 TATTAAAATTAGAAGTTGTCAGG - Intergenic
1081267083 11:41038089-41038111 TGTTACGAATGGCAGCTGGCTGG - Intronic
1083206377 11:61152028-61152050 TGTGCAGATTAGAAGTGGGCTGG - Intronic
1084106820 11:66985901-66985923 TGTTAATAATAGCACCTGGCTGG + Intergenic
1085603268 11:77874738-77874760 GGTTAAGACAAGAAGTTGGCCGG + Intronic
1088397038 11:109380309-109380331 TTTTAAGAATTTAATTTGGCAGG - Intergenic
1090104888 11:123842255-123842277 TTTTAAGAACAGAATTTAGCTGG - Intergenic
1090882082 11:130842572-130842594 TGATAGCATTAGAAGTTGGCTGG + Intergenic
1092560115 12:9603730-9603752 TGTTAGTAATAGAATTAGGCTGG - Intronic
1093624869 12:21333209-21333231 TGTTAAGAAAAGAAATTAGATGG + Intronic
1095391987 12:41718136-41718158 TGTTAAGAATATGTGTAGGCTGG - Intergenic
1095434212 12:42169707-42169729 TGAAAAGAGAAGAAGTTGGCTGG - Intronic
1096162638 12:49392753-49392775 AGATAAAAATAGAAGTAGGCCGG + Intronic
1096374725 12:51099187-51099209 TGTTAAGAATAGTACCTGGCTGG + Intronic
1099013527 12:77319905-77319927 TGCTAAAAATAGAAATTAGCCGG - Intergenic
1099516556 12:83603676-83603698 TGTTAATTACAGAAGTTGGGTGG + Intergenic
1100595360 12:96067019-96067041 TGTAGAGAAGTGAAGTTGGCAGG - Intergenic
1101714140 12:107295789-107295811 TCTTAAAGATAGATGTTGGCTGG - Intergenic
1102892281 12:116569156-116569178 TATAAAGAAAAGAAATTGGCCGG - Intergenic
1102917949 12:116769061-116769083 TGTAAAAAATAAAAGTTGGCCGG + Intronic
1103354008 12:120306177-120306199 TTTTAAGAAAGGAAATTGGCTGG + Intronic
1105483340 13:20800522-20800544 TGGGAATAATAGAAGTTGACGGG - Intronic
1107077874 13:36343085-36343107 TATTAAGAGTAGAAGTTTACTGG - Intronic
1108966778 13:56316992-56317014 TGTTAAGAATAAAAGTTAACTGG - Intergenic
1109399922 13:61813029-61813051 TTTGAAAAATAGAAGTAGGCCGG - Intergenic
1110410529 13:75199753-75199775 TTTTAAGAATAAAATCTGGCCGG - Intergenic
1111344820 13:86937730-86937752 ATTTCAGAATGGAAGTTGGCAGG + Intergenic
1111405850 13:87804480-87804502 TTGTAAGAATAAAAGTTGTCTGG + Intergenic
1111584155 13:90262402-90262424 TGTAAAGAAAATATGTTGGCTGG + Intergenic
1111809206 13:93077260-93077282 TTTTAAGAAAATAAGGTGGCTGG + Intergenic
1112276979 13:98030171-98030193 TGTTAAAGATGAAAGTTGGCGGG + Intergenic
1112365274 13:98751049-98751071 TCTTAAGAACAGATCTTGGCCGG - Intronic
1113156191 13:107325539-107325561 TTTTAAGAATATAATCTGGCTGG + Intronic
1113291387 13:108910790-108910812 TGTTCTGAAGAGAAGTTGGTGGG + Intronic
1113808665 13:113124196-113124218 TATTGGGAATGGAAGTTGGCAGG + Intronic
1113863290 13:113504959-113504981 TGAAAAGAATAGATGTTGGCAGG - Intronic
1115960534 14:38831616-38831638 TGTTAAGAATAAAAGGGGCCGGG - Intergenic
1117299748 14:54412968-54412990 GTTTAAGAGGAGAAGTTGGCTGG - Intronic
1117949113 14:61062973-61062995 TATAAAGAACAGAAATTGGCTGG - Intronic
1119167290 14:72505109-72505131 TGTAATGAATAGAAGCTGGAAGG - Intronic
1119236173 14:73021046-73021068 TTTTAAAAACTGAAGTTGGCTGG + Intronic
1119365941 14:74091899-74091921 TGTTAAGAATAGCTGTTTGGTGG + Intronic
1119551598 14:75518026-75518048 TTTTAAGAATAAAGGTAGGCTGG - Intergenic
1120341173 14:83222644-83222666 TGCTAAAAATACAAGTTAGCCGG - Intergenic
1121231040 14:92358628-92358650 GGTGAAGAAAAGAAGATGGCAGG - Intronic
1122876766 14:104670559-104670581 AGTTTAGAATACAAGTAGGCTGG + Intergenic
1123437862 15:20268854-20268876 TTTTAAAAGTAGTAGTTGGCTGG + Intergenic
1123691970 15:22845730-22845752 TGTTAGGAAATGAAGTGGGCAGG + Intronic
1124546460 15:30632123-30632145 TTTTAAGAATATAATTTAGCCGG + Intronic
1124779986 15:32621527-32621549 TTTTAAGAATATAATTTAGCCGG + Intronic
1126237421 15:46402030-46402052 TCCTAAGAAGAGAAGCTGGCTGG + Intergenic
1126251368 15:46571936-46571958 TCCTAAGAAGAGAAGCTGGCCGG + Intergenic
1127132068 15:55876999-55877021 TTTTAAAATGAGAAGTTGGCTGG - Intronic
1127321842 15:57854575-57854597 TGTTTGGAAAGGAAGTTGGCTGG + Intergenic
1128071595 15:64800387-64800409 TATTAATAATATAATTTGGCCGG - Intergenic
1129547311 15:76410087-76410109 AGTTCAGAAAAGAAGTAGGCCGG - Intronic
1130172524 15:81530574-81530596 TGGTAAGATTAGAAAGTGGCGGG - Intergenic
1130216432 15:81974693-81974715 GCTTAATAATAGCAGTTGGCAGG + Intergenic
1134037059 16:11039226-11039248 TGTTAAAAAGGGAGGTTGGCAGG - Intronic
1134655028 16:15941801-15941823 TGGTAAGAAAAGAAGTGGCCGGG + Intergenic
1135760466 16:25133868-25133890 TGTTAAAAACAGAAATTAGCTGG + Intronic
1136697724 16:32100454-32100476 TGTTGAGAATAGGAGATGCCTGG - Intergenic
1138176338 16:54901489-54901511 TGTTAAGAACAGATGGGGGCTGG - Intergenic
1139901267 16:70330285-70330307 TTTTAAGAATATAAGCTGGGCGG + Intronic
1141679193 16:85534416-85534438 TTTTAAAAAAAGAAATTGGCCGG - Intergenic
1141851854 16:86651647-86651669 TGATAATACCAGAAGTTGGCAGG - Intergenic
1143440532 17:6969557-6969579 TGTTATGAATATATGTTGTCGGG - Intronic
1144037090 17:11376825-11376847 TGTTAGGAATGGAAATTGTCAGG + Intronic
1144091222 17:11858539-11858561 TGAAAAAAATAGAAGTTGGTGGG - Intronic
1144215075 17:13048242-13048264 TGTTAAAAATATAAGTTATCAGG + Intergenic
1144864239 17:18324603-18324625 TGATGAGAAGAGAAGCTGGCTGG - Intergenic
1149611235 17:57959024-57959046 TGTTATTAATAAAACTTGGCTGG - Intergenic
1149925663 17:60699767-60699789 TTTTAAAAAGAGCAGTTGGCTGG + Intronic
1151520439 17:74625186-74625208 TATAAAGAACAAAAGTTGGCAGG + Intergenic
1154991767 18:21603943-21603965 AGTAAAGAATTAAAGTTGGCCGG + Intergenic
1155422454 18:25669773-25669795 TGAAAAGAATAGAAGCTGGCTGG + Intergenic
1155954580 18:31946398-31946420 TGTTAAGAATCTCTGTTGGCTGG + Intronic
1156656802 18:39298156-39298178 TATAAAGAATACAACTTGGCCGG + Intergenic
1159588067 18:70301231-70301253 TGTTGAGAATAGAATGGGGCAGG + Intronic
1161760195 19:6165536-6165558 TGCTCAGAATAGTAGTTGGCAGG - Intronic
1161896379 19:7084647-7084669 TGATCAGTTTAGAAGTTGGCTGG - Intronic
1163205023 19:15796066-15796088 TCTTCAGAATAGAACTTGGCCGG - Intergenic
1165033839 19:33018746-33018768 TTTTAAAAGTAGTAGTTGGCCGG + Intronic
1166669264 19:44700299-44700321 TATTAAAAATATAAGTTAGCTGG - Intronic
1167450492 19:49565450-49565472 TGTTATAAAAAGAAATTGGCTGG + Intronic
1167855993 19:52240280-52240302 TTTAAAAAATAGAAGTGGGCTGG - Intergenic
925069202 2:952825-952847 TGTTAAGTATTGGTGTTGGCAGG + Intronic
925788219 2:7453667-7453689 TGTCAAGAATACCTGTTGGCTGG - Intergenic
926476136 2:13325421-13325443 TGATAATAATAAAAGTTAGCTGG - Intergenic
927681613 2:25143360-25143382 TTTTAATAAGAAAAGTTGGCCGG + Intronic
927819686 2:26252482-26252504 TGTTAAAAATAATTGTTGGCTGG - Intronic
928497418 2:31848105-31848127 TCTTAAAAATAGAAATTGACAGG - Intergenic
928891375 2:36207280-36207302 AGTGAAAAACAGAAGTTGGCAGG + Intergenic
929565559 2:42981908-42981930 TCTTAAGAGTAGAAAGTGGCTGG - Intergenic
931354781 2:61527002-61527024 TTTAAAGATTAGGAGTTGGCTGG - Intronic
932954880 2:76339472-76339494 TGTTAAGAATGCAAGTTTTCAGG + Intergenic
936271622 2:111053616-111053638 TGTTTAGGGTGGAAGTTGGCAGG + Intronic
936693851 2:114924913-114924935 TGTTAAAAACATAGGTTGGCTGG + Intronic
936764240 2:115826423-115826445 TGTTAAGAAATGACCTTGGCCGG + Intronic
940210291 2:151249677-151249699 TCTTAAGATCACAAGTTGGCCGG - Exonic
942284117 2:174396498-174396520 TGTTAAGAATAAACCTTGGCCGG + Intronic
944385027 2:199154603-199154625 TATTAAGAAAAGAAGGGGGCAGG + Intergenic
944653028 2:201850993-201851015 TATAAAGAACAGAAATTGGCCGG + Intronic
944950246 2:204740316-204740338 TGTAAAGAATTAAAGTTGGCCGG - Intronic
945310716 2:208309002-208309024 TGTTAATACTAGTAGTGGGCCGG - Intronic
946501307 2:220250096-220250118 TATAAAGAAAAGACGTTGGCCGG - Intergenic
947659896 2:231858738-231858760 TATTAAAAATAGAAATAGGCTGG - Intergenic
1168863509 20:1063666-1063688 AGTAAAGAATAGAAGTAGGGAGG - Intergenic
1169106460 20:2999987-3000009 TGTTAAGAAAATAAGTAGGCTGG + Intronic
1169170513 20:3460977-3460999 TGTTAACTAAAGAAATTGGCCGG - Intergenic
1169419270 20:5446354-5446376 TTTTCAGAATAGAAATTGACTGG + Intergenic
1169691811 20:8340718-8340740 TGTTAAAACTAGAATTTGGCCGG - Intronic
1169818600 20:9684807-9684829 TCTTAAGACTAAAAGCTGGCTGG + Intronic
1172508495 20:35481995-35482017 TTTCAAGAATAAAAGTAGGCTGG - Intronic
1172994653 20:39061137-39061159 TGTTAAAAATAGATGAAGGCTGG - Intergenic
1173489456 20:43468088-43468110 TGTTTAAAAAAAAAGTTGGCTGG - Intergenic
1174881915 20:54289244-54289266 TGGTGGGAATATAAGTTGGCAGG + Intergenic
1176986367 21:15442413-15442435 TAATAATAATAAAAGTTGGCTGG + Intergenic
1178001750 21:28167603-28167625 TGTTAAGAATAGATGTAGGATGG + Intergenic
1179423081 21:41251502-41251524 TATAAAGAATAAAAGTGGGCTGG + Intronic
1180735179 22:18011247-18011269 TATCAAGAAGAGAAGCTGGCTGG + Intronic
1182533380 22:30980598-30980620 TGTTGAGAGTAGAATTTGGAGGG + Intergenic
1183460617 22:37947808-37947830 TTTTAAAAATAAAAGTTGGCCGG + Intronic
949630703 3:5923311-5923333 TGAGAATAAGAGAAGTTGGCTGG + Intergenic
949813952 3:8038802-8038824 TTTTAAGAATGGCAGATGGCTGG - Intergenic
950171297 3:10840663-10840685 TGTTAAGAAGGGAAAGTGGCAGG + Intronic
951229194 3:20157293-20157315 TGTTAACAGCAGAAGATGGCAGG - Intergenic
951994649 3:28713826-28713848 TTTTAAGAAGAAAAGTAGGCAGG - Intergenic
953559335 3:43972658-43972680 TATTATTAATAGATGTTGGCTGG + Intergenic
953822480 3:46220343-46220365 TAATAATAATAGATGTTGGCAGG + Intronic
955668123 3:61371773-61371795 AGTTCAGAGTAGAAGTTGGCTGG - Intergenic
956134627 3:66086786-66086808 TCTTTAGAAAAGAAGTTGGTTGG + Intergenic
956312554 3:67897470-67897492 TGTGAAGAAGAAAAATTGGCAGG - Intergenic
956637798 3:71383519-71383541 TGAAAAGAATAGAGGGTGGCAGG + Intronic
956807355 3:72828530-72828552 TATTAAAAATACAAGTTAGCTGG + Intronic
957244527 3:77700996-77701018 TTTAAAAAAAAGAAGTTGGCTGG + Intergenic
957787773 3:84904164-84904186 TGTTAATAATAGAAGTTTGGAGG - Intergenic
959260790 3:104077189-104077211 AGATAAGAATTGAGGTTGGCTGG + Intergenic
960157164 3:114307773-114307795 TGGTAAGAACATAAGTTTGCTGG + Intronic
964216468 3:154290337-154290359 TGATAAGACTAGATGTAGGCCGG + Intronic
965962691 3:174447519-174447541 TTTTAAAAATAAAATTTGGCCGG + Intronic
968277016 3:197447628-197447650 TATAAAGAAAAGAGGTTGGCTGG + Intergenic
968696995 4:2035728-2035750 TGTTAGGAATACCTGTTGGCAGG + Intronic
969099321 4:4757020-4757042 TATAAAGAATAGAAGGTTGCTGG - Intergenic
969250639 4:5966177-5966199 TTTTAATAATAAAAGTAGGCCGG + Intronic
970772761 4:19635271-19635293 TGTCAATAATAAAAGTTGGTTGG - Intergenic
971095176 4:23392651-23392673 TGTTAAGAATATCAGTAGGAGGG + Intergenic
972490837 4:39585591-39585613 TTTTAATAATAGAAGTAGGCTGG - Intronic
974515424 4:62901962-62901984 TGTTAAGTATTGAAGATGGTTGG - Intergenic
975509069 4:75172242-75172264 TCTTAAGAATGGAAATTGGCCGG - Intergenic
976614041 4:87058105-87058127 AGTTAAGTATGGCAGTTGGCAGG + Intronic
977618806 4:99113536-99113558 TGTCAACAATAGGAGATGGCTGG + Intergenic
979041679 4:115806071-115806093 TGTGATGATTAGAAGTTGGAAGG + Intergenic
979127704 4:116997465-116997487 TGTTAAGAATAGAACCGGGATGG - Intergenic
979283192 4:118890582-118890604 AGTCTAGAATAGCAGTTGGCTGG + Intronic
982420168 4:155185332-155185354 TATTAAAAATATATGTTGGCTGG - Intergenic
983232915 4:165147244-165147266 TTTTAAGAAAAGAAACTGGCCGG - Intronic
983479042 4:168250819-168250841 TTTTAAAAAAATAAGTTGGCCGG - Intronic
983611674 4:169653341-169653363 TATAAAGAAAAGAGGTTGGCTGG + Intronic
984125511 4:175804747-175804769 TGTTAAAAATGAAAGTGGGCCGG + Intronic
984428227 4:179614961-179614983 TATAAAGAACAGAAGTTGGCTGG - Intergenic
984987568 4:185346153-185346175 AGTTAACAATAGAAAATGGCCGG - Intronic
985108857 4:186526780-186526802 GGTTAAGAATGGAAGGTTGCTGG - Intronic
985288894 4:188366192-188366214 TGCGTAGAATAGAAGCTGGCAGG + Intergenic
986153744 5:5152568-5152590 GTCTCAGAATAGAAGTTGGCTGG + Intronic
986544876 5:8884843-8884865 TGTTAAGAAAAGAAGGTAGTTGG - Intergenic
989602936 5:43216761-43216783 TGTTGAGAATGTAAGCTGGCTGG + Intronic
989658062 5:43766786-43766808 TATTAAGAATAGAGTTAGGCCGG + Intergenic
989675605 5:43968791-43968813 TTTTAAGACTAGAAGGGGGCTGG - Intergenic
989810412 5:45666008-45666030 TGTCAAGAAGAGAACTTGGGGGG - Intronic
990597631 5:57327278-57327300 TTGTAAGAATAGAATATGGCTGG - Intergenic
991472890 5:66988104-66988126 TTTTAAGAATGACAGTTGGCTGG + Intronic
991691156 5:69226025-69226047 TGGTAAGAATGAAAGCTGGCTGG - Intronic
991708178 5:69380175-69380197 TTTTAAAAAAAAAAGTTGGCCGG - Intronic
992442196 5:76806687-76806709 TGTTAAGAATAGAAGCAGGCCGG + Intergenic
993635374 5:90336402-90336424 TCTAAAGAATAGATGTTTGCCGG - Intergenic
994089166 5:95793630-95793652 TTTTAGGAATAGAAATTTGCCGG + Exonic
994537077 5:101045891-101045913 CATTAAGAACAGAAGGTGGCAGG - Intergenic
995514591 5:112941479-112941501 TGTTAAGAATGAAACTCGGCTGG + Intergenic
996005623 5:118417948-118417970 TATTTAGACTAGAAGTTGGATGG - Intergenic
997488983 5:134256708-134256730 TGTTAAGAATAAAAGGAGGCTGG - Intergenic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
998614037 5:143719954-143719976 TGATAGGAAGAGAAGGTGGCAGG - Intergenic
1001111055 5:168896723-168896745 TGTGCAGAGGAGAAGTTGGCAGG + Intronic
1002993575 6:2260611-2260633 TGTTAAGAATAGAACATAGCTGG - Intergenic
1003134523 6:3424076-3424098 TGGGAAGAATAGAAGGTGACAGG - Intronic
1005982503 6:30847284-30847306 TGTTAAGAATGTATATTGGCTGG + Intergenic
1007069389 6:39024529-39024551 TGTTTAAAATGGAAGTTGCCTGG + Intronic
1007441870 6:41868621-41868643 TATAAAAAACAGAAGTTGGCTGG - Intronic
1010147027 6:72682298-72682320 TGTTAATCAGGGAAGTTGGCTGG - Intronic
1011056878 6:83214556-83214578 AGTTAAGAAGAGAAGTGGTCAGG - Intronic
1011426099 6:87232108-87232130 TGTAAAGAATAGAGGGTAGCAGG + Intronic
1011531696 6:88329985-88330007 GTTTAAGAATAAAAGTTAGCTGG + Intergenic
1011880257 6:92015372-92015394 TATTAAAAATACAAGCTGGCCGG - Intergenic
1011916911 6:92517746-92517768 TGTTAAAAATAGAATTGGGGTGG - Intergenic
1012634941 6:101526319-101526341 TTTTAAAAATAGAAATTGGATGG + Intronic
1013137340 6:107295227-107295249 TGTTAAGAACAGAACTGGCCGGG - Intronic
1013310554 6:108889742-108889764 TTAAAAGAATAAAAGTTGGCCGG - Intronic
1014492283 6:122077305-122077327 TGTTAAGAAAAATGGTTGGCAGG + Intergenic
1014751750 6:125264750-125264772 TGGTAAAAAAAGAAGGTGGCAGG - Intronic
1015340820 6:132098396-132098418 TGTTGAAATTAAAAGTTGGCTGG - Intergenic
1015986081 6:138885322-138885344 TGTTAAGAATGTGTGTTGGCCGG - Intronic
1017272917 6:152530114-152530136 CTTTAAGAATAGACCTTGGCTGG - Intronic
1017953381 6:159157550-159157572 AGTTAAGAAGTGGAGTTGGCTGG - Intergenic
1018470261 6:164090091-164090113 TGTTAAGACTATAAGGTGGAAGG + Intergenic
1021117714 7:16762586-16762608 TGTTAGGAATAGAGTTTAGCCGG + Intronic
1021485050 7:21158259-21158281 AGTTAAGAATAGAGGGAGGCAGG - Intergenic
1028180154 7:87711028-87711050 TGTAAAGAATATACATTGGCCGG + Intronic
1028228909 7:88282441-88282463 TATTAAGAATAAAAGTTTGCCGG - Intronic
1028266865 7:88736488-88736510 TGTTAAGAAAACAATTTGGGAGG + Intergenic
1028566038 7:92232222-92232244 TTTTAAGAATAAGTGTTGGCCGG - Intronic
1029197058 7:98812436-98812458 TCTTAAGAATAAATGTGGGCTGG - Intergenic
1029672994 7:102046875-102046897 TGTCAAGAACAGAAGTGAGCTGG - Intronic
1030026153 7:105326763-105326785 TGTAAAGAATTAAAGGTGGCCGG + Intronic
1030169933 7:106590896-106590918 TATAAAGAACAGAAATTGGCCGG + Intergenic
1030209897 7:106985936-106985958 TATTAAAAAAAAAAGTTGGCAGG + Intergenic
1030924144 7:115430662-115430684 TGTGAAGGAATGAAGTTGGCTGG - Intergenic
1032148549 7:129406753-129406775 TGATCAGAAAAGAAATTGGCAGG + Intronic
1032200489 7:129819171-129819193 TGCTAAAAATACAAGTTAGCCGG + Intergenic
1032212199 7:129925935-129925957 AGTTAGGAATTGTAGTTGGCTGG - Intronic
1034102825 7:148465620-148465642 TTTTAAGAATAGACTTGGGCCGG - Intergenic
1035147449 7:156834302-156834324 TGTTACAAACAGAAATTGGCTGG + Intronic
1035387457 7:158483839-158483861 TTTAAAGTATAGGAGTTGGCCGG + Intronic
1037042338 8:14251346-14251368 TCTTGAAAATAAAAGTTGGCCGG - Intronic
1037853187 8:22349720-22349742 TGAGCAGAATAGAAATTGGCAGG + Intronic
1037894577 8:22643328-22643350 TGTTAAAAAAAAAAGTTGGGGGG - Intronic
1037972126 8:23179800-23179822 TCTTAAAAGTAGAAGATGGCCGG - Intergenic
1038294685 8:26280268-26280290 TGGTAAAAATGGAAGTGGGCAGG + Intergenic
1039061869 8:33578214-33578236 TCTTAAAAATAAAAATTGGCCGG - Intergenic
1039193576 8:35004548-35004570 TGTTAATTTTAGAAGTTAGCAGG - Intergenic
1040684802 8:49859188-49859210 TTTTAAGATAAGAAGTTGGGGGG + Intergenic
1042544414 8:69938372-69938394 TACCAAGAATAGAAGTTGGCTGG + Intergenic
1043749257 8:83915227-83915249 AGATAGGAATAGAAGTGGGCAGG - Intergenic
1043831472 8:84994346-84994368 TTTTAAAAAGTGAAGTTGGCAGG + Intergenic
1044899524 8:96929028-96929050 TGTGCAAAATAGACGTTGGCTGG - Intronic
1046108731 8:109695705-109695727 TGTTATGAATAAAAGTTGTTCGG - Intergenic
1046196317 8:110867045-110867067 TGTTAAGAATAGAAGGGGGCCGG - Intergenic
1047289196 8:123514338-123514360 GGATAAAAATAGAAGTTGCCAGG + Intronic
1049704854 8:144037032-144037054 TGTTAAGAATGAATTTTGGCCGG + Intronic
1050920969 9:11200084-11200106 AGATAATAAAAGAAGTTGGCTGG + Intergenic
1051642905 9:19239780-19239802 TTTAAAGAATATAAATTGGCTGG - Intronic
1051657106 9:19393530-19393552 TTTTAAGAGTAAAAGTTGGCTGG - Intergenic
1053294532 9:36903231-36903253 GTTTAAGAAAAGCAGTTGGCTGG + Intronic
1053862138 9:42397485-42397507 TGTAAAGAAAAGAAATTGGCTGG + Intergenic
1054989390 9:71304994-71305016 TTTTAAGAATAGAATGTGACAGG - Intronic
1055576227 9:77662359-77662381 TATTAAAAATACAAGTTAGCCGG - Intergenic
1055695052 9:78874343-78874365 TGTAAAGAAGAAAAATTGGCAGG + Intergenic
1057093833 9:92286065-92286087 TGTTAAGAAAAGCAACTGGCAGG + Intronic
1057350582 9:94293715-94293737 GGTTAAGAATAGAAACTGGCTGG - Intronic
1058146901 9:101422516-101422538 TGTTAAAAATAGAAATTCCCTGG + Intronic
1058597109 9:106626852-106626874 TGTAAAGCATAGAAAATGGCTGG + Intergenic
1059103641 9:111492877-111492899 TTTTAAAAATATAATTTGGCCGG - Intergenic
1059702173 9:116785848-116785870 TGTGAAGAATAGACGTTAGTGGG - Intronic
1061067831 9:128289768-128289790 TGTTAAAAATAAATTTTGGCCGG + Intergenic
1061830299 9:133287975-133287997 TTTAAAGAATCAAAGTTGGCTGG - Intergenic
1062531259 9:137001545-137001567 TGTTAAGAAGTGGGGTTGGCTGG + Intergenic
1186474034 X:9843227-9843249 TGTTAACAATAGGGGATGGCAGG - Intronic
1186498369 X:10031032-10031054 TGTTAAGAATAGAAGTTGGCTGG + Intronic
1186656437 X:11616622-11616644 TATTAAGAAAAGAGGTTGGCTGG - Intronic
1186668998 X:11749937-11749959 TGTTAAGAAAATAAGGTTGCAGG + Intergenic
1187953456 X:24493060-24493082 TGTATAGAATAGATGTTGGAAGG + Intronic
1188039372 X:25354293-25354315 AGTTAAGAATACACCTTGGCTGG + Intergenic
1188763768 X:34064303-34064325 TGTGATGCATAGAAGATGGCTGG + Intergenic
1189233891 X:39473096-39473118 TGTTAAGAATAGAATCTTGTAGG - Intergenic
1190477720 X:50844278-50844300 TTTAAAGAATCAAAGTTGGCTGG - Intergenic
1191837978 X:65485550-65485572 TGTTAAAAAGAGTTGTTGGCTGG - Intronic
1192070592 X:67936435-67936457 TGATAAGAAAATATGTTGGCTGG + Intergenic
1193518274 X:82497254-82497276 TGTCAAGAAAAGCAGTTTGCAGG - Intergenic
1194000884 X:88427422-88427444 AGTTAAGGATTGAAGCTGGCAGG - Intergenic
1194767821 X:97863001-97863023 TGTTCAGAAAAGGAATTGGCAGG - Intergenic
1195038834 X:100995062-100995084 GGTTAAGAATACTAGTTGGCAGG - Intergenic
1195225262 X:102785644-102785666 TGTTAAGAAGAATAGTTGGCTGG - Intergenic
1198865938 X:141123135-141123157 TCTTAAGAAGAGATGGTGGCCGG + Intergenic
1199618003 X:149673328-149673350 TTTTAAAAATAGAAATTGACAGG + Intergenic
1199624639 X:149729921-149729943 TTTTAAAAATAGAAATTGACAGG - Intergenic
1199854990 X:151752707-151752729 TTTTAAGAAAGGAAGTTCGCAGG + Intergenic
1201298160 Y:12483031-12483053 TGTTAAAAATAGAAATTGGGCGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic