ID: 1186498782

View in Genome Browser
Species Human (GRCh38)
Location X:10033907-10033929
Sequence CCAAAGTCTGCATTTTCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186498779_1186498782 3 Left 1186498779 X:10033881-10033903 CCAGCTCAGTAAATATTTGATGG 0: 1
1: 0
2: 1
3: 30
4: 172
Right 1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG 0: 1
1: 0
2: 0
3: 33
4: 274
1186498778_1186498782 10 Left 1186498778 X:10033874-10033896 CCTAGTGCCAGCTCAGTAAATAT 0: 1
1: 0
2: 25
3: 16
4: 197
Right 1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG 0: 1
1: 0
2: 0
3: 33
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186498782 Original CRISPR CCAAAGTCTGCATTTTCTTA AGG Intronic
900869706 1:5293262-5293284 CCAAAGTCTGCAATTCCAAAGGG + Intergenic
901182477 1:7351162-7351184 CCAAAGTGAGCATTTTCTCAGGG + Intronic
902198267 1:14814512-14814534 CCAAAGGCTGCATCTTCTATTGG + Intronic
902266491 1:15270739-15270761 CCAAAGTCTTCATCTTTTAAGGG - Intronic
902947650 1:19853818-19853840 CCACAGTCTCCATTTTGCTATGG - Intergenic
906349538 1:45046120-45046142 CCAAAGTCATCTTTTTCTCATGG - Intronic
907928589 1:58978098-58978120 ACAAAGTCTGCTTTTAATTAGGG + Intergenic
909160373 1:72140475-72140497 CCAAAGTCTCCTTTTTATAATGG + Intronic
909618682 1:77642949-77642971 CCAAAGTGTTAATTTTTTTATGG - Intronic
910160322 1:84265426-84265448 CCAGAGCCTGCATCTTCTTTAGG + Intergenic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
912257579 1:108076599-108076621 CCACAGTCTGCATTTTCTCCTGG + Intergenic
912528713 1:110304627-110304649 CCAGAGTCAACATTTCCTTAAGG - Intergenic
912578039 1:110693575-110693597 CAGAAGGCTGCCTTTTCTTAGGG - Intergenic
913424327 1:118710108-118710130 CCAAAGTAGGCATTAACTTAAGG - Intergenic
913515508 1:119602280-119602302 GCAAATTCTGCAATTTCTTGGGG - Intergenic
913550919 1:119916091-119916113 CCAAAGGCTGCATTTCATGAAGG + Exonic
914001588 1:143699185-143699207 CCATAGTCTCCATTCTCTTGGGG - Intergenic
915819029 1:159001862-159001884 CAATTGTCTGCATTTTCTTTGGG - Intronic
917125681 1:171685433-171685455 CCAAAGTCAGGATCTTGTTAGGG - Intergenic
917599982 1:176564135-176564157 CCCAAATCTGCATTTGCGTAAGG - Intronic
917941042 1:179921891-179921913 TTAAAGTCTTCGTTTTCTTAGGG + Intronic
918222050 1:182444214-182444236 CCAAAGGATGCATTTGCTTTAGG - Intergenic
918925308 1:190777760-190777782 CCAAAGTATGTATTATCTAAAGG - Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
1063150861 10:3335112-3335134 CAAAAGTCTCCATGTTCTGATGG - Intergenic
1068428548 10:56900897-56900919 TCTAAGTCTGTATTTTTTTAAGG + Intergenic
1069067633 10:63960527-63960549 TCCAAGTCTGAATTTTCTTCTGG + Intergenic
1069620017 10:69831561-69831583 CCAACATCTTCATTTTCCTAGGG - Intronic
1070285417 10:75079852-75079874 CCAAATTCTGCATTTCCTAAGGG + Intergenic
1070559689 10:77556819-77556841 CCAAGGATTACATTTTCTTAGGG - Intronic
1070696330 10:78566378-78566400 GCAAAGTCTGGTTTTTGTTAGGG - Intergenic
1070724430 10:78778618-78778640 CCAAACTGTGCACTTCCTTAGGG - Intergenic
1071882579 10:89915601-89915623 CCTAAGTCTGTATTTCTTTAGGG + Intergenic
1072505746 10:96064511-96064533 ACAAAGTCTGTATTCTCTTCTGG - Intergenic
1073743822 10:106442709-106442731 CCAAATTCTGCATTTTATCATGG + Intergenic
1074084414 10:110196999-110197021 CAAATGCATGCATTTTCTTAGGG + Intergenic
1074326807 10:112458481-112458503 CCAAAGGCTTATTTTTCTTAGGG + Intronic
1074498400 10:114000217-114000239 CCAAAGACTGTATTTTCCAAAGG + Intergenic
1074522572 10:114239197-114239219 CCAAAGTCAACATTTTTTCAAGG + Intergenic
1075293698 10:121253598-121253620 CCAAAGTGGGCATTTTCTAAAGG + Intergenic
1075788999 10:125069940-125069962 CCAAAGTCTGTAGTTACTTAGGG - Intronic
1075850749 10:125585002-125585024 CCTAAGGCTGGATTTTCTAAGGG - Intronic
1079054489 11:17194010-17194032 CCAAAGCCTGCATCTTCTTTAGG - Intronic
1080839992 11:35975219-35975241 CGAAATTCTGTATTTTATTAGGG + Intronic
1080841453 11:35987215-35987237 CTGAAGTCTGCATATTTTTAGGG + Intronic
1081777843 11:45688453-45688475 CCAACGTCTGCCTTTTGTCAAGG - Intergenic
1085980279 11:81716476-81716498 CCAAATTCATCATTTTCCTAGGG - Intergenic
1087801686 11:102511295-102511317 CCAATTTATGCATTTTCTTAAGG - Intergenic
1088125083 11:106414646-106414668 CTAAAGAAAGCATTTTCTTAAGG + Intergenic
1090561265 11:127935361-127935383 CCAAAGTCTACATTTTTGTAAGG + Intergenic
1091328489 11:134711870-134711892 CCAAAGGAAGCGTTTTCTTAAGG - Intergenic
1092784693 12:12016662-12016684 CCCATGTCTGCAGTTTCTGATGG - Intergenic
1092832174 12:12455239-12455261 CCAAAGGCTGCCTCTTTTTAGGG - Intronic
1093522168 12:20063760-20063782 CTTAAGTCTAGATTTTCTTAGGG - Intergenic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1095987519 12:48009440-48009462 CGAAATATTGCATTTTCTTAAGG + Intergenic
1096019224 12:48308243-48308265 ACAAAGTGTGCATATTCCTAAGG - Intergenic
1097813114 12:64040150-64040172 GGAAAATCAGCATTTTCTTATGG - Intronic
1098231722 12:68377893-68377915 ACAAAGCCTCAATTTTCTTAAGG + Intergenic
1098469745 12:70829583-70829605 TCAAAGGACGCATTTTCTTATGG - Intronic
1099300166 12:80883228-80883250 GCCAAGTATGTATTTTCTTAGGG + Intronic
1099408560 12:82294356-82294378 GCAATGGCTTCATTTTCTTATGG - Intronic
1099472258 12:83065801-83065823 CCAAATTCTGCATTAACTTATGG + Intronic
1099500275 12:83405448-83405470 CCTGAGTCACCATTTTCTTATGG + Intergenic
1099954823 12:89343460-89343482 CCTAAGTCTGCATTTGGTCAGGG - Intergenic
1100417131 12:94389763-94389785 CCAAATACTGCATTTTCCCAAGG + Intronic
1102521911 12:113483073-113483095 CCAATGACTGCATTCTCTTGGGG - Intergenic
1102673138 12:114637139-114637161 CCTGAGTCTGCCTTTTCTTCTGG - Intergenic
1103581607 12:121919577-121919599 TCAGAGTCTGCATTTTCTCATGG - Intronic
1106445106 13:29822701-29822723 CCAAAGACTGCATTTTAAAAAGG + Intronic
1107873649 13:44769738-44769760 CCACAGTCTGCTTTTTATTGGGG - Intergenic
1108448816 13:50538966-50538988 CCAACGGCTGTATTTTCTTGTGG + Intronic
1109313836 13:60726788-60726810 CCAAAGTCTGCAGGGTCTCAGGG + Intergenic
1109471717 13:62815719-62815741 CCTAAGTCTGATTCTTCTTATGG - Intergenic
1110034098 13:70656904-70656926 CCAAAATCAGCATTTATTTAAGG + Intergenic
1110770354 13:79336118-79336140 CCTAAGTCTGAATTTTCAAAAGG + Intronic
1112837736 13:103536340-103536362 CGAAAGCCTGCATTTCCTTTGGG - Intergenic
1113138516 13:107120635-107120657 CCAAGGTATGGATTTTTTTAAGG - Intergenic
1113403249 13:110014844-110014866 GCTAAGTCTGCATTTACTCATGG - Intergenic
1113678823 13:112227636-112227658 CAAAAATATGCATGTTCTTAGGG - Intergenic
1114164622 14:20208274-20208296 CAAAACTCTGCATTTGTTTATGG + Intergenic
1116372071 14:44149012-44149034 CCAAAGTCTGCAGTTTACTTAGG - Intergenic
1119959944 14:78843836-78843858 CCCAAGTCTGCATTGACATAAGG + Intronic
1120005147 14:79348164-79348186 TCCAAGACTGCATTTTCTCATGG - Intronic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1120121960 14:80691706-80691728 CCAAAATCTGCAATTTCATTTGG - Intronic
1120242495 14:81965731-81965753 CCAAAGCCAGAATTCTCTTAGGG - Intergenic
1123172128 14:106383322-106383344 CGATAGTCTACAATTTCTTATGG + Intergenic
1124402629 15:29363045-29363067 CAAAATTCTGCATTGTTTTAAGG + Intronic
1125340516 15:38670994-38671016 CCTAAGTCTGGCTCTTCTTACGG + Intergenic
1125552111 15:40552946-40552968 CCAAAGTCTGGACTGTCTGAGGG + Intronic
1126283013 15:46978821-46978843 GGAAAGTCTGAATCTTCTTAGGG + Intergenic
1126628360 15:50708324-50708346 CCAAAGTTTAAATTATCTTACGG - Intronic
1127513538 15:59668693-59668715 CCTAAGTTAGCATTTTCTTCAGG - Intronic
1130293984 15:82630232-82630254 GCACAATCTGCATTATCTTAAGG + Intronic
1131089702 15:89614200-89614222 CCAATGTCTGGACTTTCTCAGGG + Intronic
1131360553 15:91786710-91786732 CCAAAGGATGCAATTTCCTAGGG - Intergenic
1131459420 15:92607839-92607861 CAAAAGTCTGCAATTCCTCATGG + Intergenic
1132041006 15:98524657-98524679 CCAAGGTCAGCATCTTCTTGGGG - Intergenic
1133052692 16:3126238-3126260 CCAAAGGCTCCTTTTCCTTAGGG - Intergenic
1133837433 16:9379324-9379346 CCAAATTTTGCATTTTCCTAGGG + Intergenic
1134122407 16:11594490-11594512 TCATAGTCTGCATTCTTTTAGGG - Intronic
1136015091 16:27392236-27392258 CCAATGTCTGGACTTTTTTAGGG - Intergenic
1137670483 16:50275449-50275471 CCAAAGTCAGCATTTCCCAAAGG + Intronic
1139210685 16:65073761-65073783 GCAGAGTCTGCATTTTAATAAGG - Intronic
1140548397 16:75835307-75835329 CCAAAATCTGCATTTGTTTCTGG + Intergenic
1141386525 16:83626745-83626767 CCAAAGTCTGCTTTTGGTCATGG - Intronic
1146461786 17:33051821-33051843 TCACAGACTGGATTTTCTTAAGG - Intronic
1149043921 17:52222377-52222399 CCAGAGTCTGTATTATCATAGGG + Intergenic
1151063663 17:71125985-71126007 CCAAAATCTACATTTTCATTTGG - Intergenic
1153684297 18:7529542-7529564 TCCAATTCTGCATTTTCTCAGGG - Intergenic
1155374136 18:25137636-25137658 CCAGATTCTGCACTTCCTTATGG + Intronic
1156179961 18:34591716-34591738 CCAAAGTTGACAGTTTCTTAGGG - Intronic
1157322101 18:46642498-46642520 CCAAGGTCTGCATCTACTTGGGG - Intronic
1158236320 18:55319745-55319767 TCATATTCAGCATTTTCTTACGG + Intronic
1159791716 18:72789702-72789724 CCAAGGTCTGTATTTTCTTGAGG + Intronic
1160569446 18:79806869-79806891 CAAAAATCTGCATTGACTTAAGG + Intergenic
1162857926 19:13483319-13483341 CCCAAGTCTGCAGTAGCTTAAGG - Intronic
1164252419 19:23492073-23492095 CTACAGTATGAATTTTCTTATGG + Intergenic
1165336337 19:35172635-35172657 CCAAACCCTGCAGTTTCTTTGGG - Intergenic
1167127398 19:47559546-47559568 TCAAAGTCACCTTTTTCTTAGGG - Intergenic
925048649 2:794532-794554 AGAATGTCTGCATTCTCTTACGG - Intergenic
925767969 2:7255682-7255704 CAAGAGTCCGCATTTTCTTCAGG + Intergenic
927350811 2:22111898-22111920 ACAAAGTATGCATTTACTTCTGG - Intergenic
929259525 2:39849494-39849516 CCCAATTCTGCATTTTAATATGG - Intergenic
930294108 2:49531592-49531614 CCAAAGTCTCCTTTTCTTTAAGG - Intergenic
930464554 2:51731103-51731125 CCAGAGTCTGCATTTCTTTCTGG + Intergenic
930577687 2:53171847-53171869 CCAAAGTCTGTGCTTTCTTATGG - Intergenic
930932650 2:56906142-56906164 CAAAAGTCTGCATTTGCTTTTGG - Intergenic
931065014 2:58576125-58576147 CCAGACTCTGCATTTTATCAGGG - Intergenic
931084497 2:58814389-58814411 CCTAAGTCTGCAGTTCCTTTTGG - Intergenic
932468810 2:71940491-71940513 CCAAACTCTTCATTTTGTTGGGG + Intergenic
933226591 2:79756038-79756060 CCAAAGTTTGCATTAGCTGAGGG + Intronic
933326639 2:80846280-80846302 ACAAAGTCTTCATTTACTTCTGG - Intergenic
933486682 2:82933366-82933388 CCTAAATCTGCAATTTCTAAGGG - Intergenic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
934566812 2:95346118-95346140 CCAACTTCTGCATTTTCAAAGGG + Intronic
934593068 2:95575604-95575626 ATAAAGACTGCATTTTCTTTAGG - Intergenic
937733727 2:125264225-125264247 CCAAAATCTGTGCTTTCTTAGGG + Intergenic
937797937 2:126047607-126047629 CCTCAGTCTGCTTTCTCTTAAGG + Intergenic
938473440 2:131586890-131586912 CCAAAGTGTGCATTTCCTAAGGG - Intergenic
938742195 2:134243530-134243552 TCAAGGTCTGAATTTTCTTAGGG - Intronic
939895784 2:147789729-147789751 CCAAAGACTGACTTTTCTAATGG + Intergenic
941590808 2:167418021-167418043 CCAAAGTCTGCCATTTTTAAGGG - Intergenic
942369212 2:175263759-175263781 CAAAAGTCTGCATTTTATATAGG - Intergenic
942764259 2:179435219-179435241 CCAAATTGTGAATTCTCTTAGGG + Intergenic
943877621 2:193092171-193092193 CAAAAGTTTGCATTTTTTTAAGG - Intergenic
946077618 2:217088060-217088082 TCTCAGTCTGCATTTTCTCAGGG - Intergenic
946677400 2:222176008-222176030 TCAAATTCTTCATTTTCTCAGGG + Intergenic
947041626 2:225928501-225928523 CATAAGTCTTCATTTTTTTATGG + Intergenic
948284016 2:236769991-236770013 CCAAAGGCTGCATTCTCTCAGGG + Intergenic
1171376031 20:24694602-24694624 CTAAGTTCTGCATTTTCTAATGG - Intergenic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1173233063 20:41217525-41217547 CCAAGGTCAGCATTTTCCAAAGG - Intronic
1173300146 20:41795059-41795081 CCACAATCTGTTTTTTCTTAAGG + Intergenic
1173916796 20:46714063-46714085 CCAATTTCTGGATTTTCTGAAGG - Intronic
1173960024 20:47063717-47063739 GCCAAGTCTTCATTTACTTAAGG + Intronic
1174887452 20:54351519-54351541 CCAAAGTTTTCTTTTGCTTAAGG + Intergenic
1176381171 21:6112920-6112942 CATAAGTCTGCAATTTCTGAAGG + Intronic
1178094794 21:29202996-29203018 CCAAAGTCTGGACTTTGTCAAGG + Intronic
1179568909 21:42266460-42266482 CCCAAGTATGCATCATCTTAGGG + Intronic
1179742301 21:43425320-43425342 CATAAGTCTGCAATTTCTGAAGG - Intronic
949334955 3:2964530-2964552 TCAGATTCTGCATTTTATTAAGG - Intronic
951090061 3:18561990-18562012 CAAAACTCGGCATTTTCTTCTGG + Intergenic
951175034 3:19589161-19589183 CCCTAGTCTGCATCTGCTTATGG + Intergenic
951453743 3:22867804-22867826 CAAAAATCTGCATTTTCAAAAGG + Intergenic
951777437 3:26325147-26325169 TCAGAGTCTGCATTTGCTTCTGG - Intergenic
953346926 3:42183836-42183858 GCTAAGTCTGCATTTGCTGATGG + Intronic
953890720 3:46750147-46750169 CCAAAGCCTGTGTTTTCTGAGGG + Intronic
954257857 3:49418803-49418825 CCAACATCTGCAGTTTCTAATGG + Intronic
955339596 3:58115263-58115285 CCAAATTCTCCATATTCTTTAGG + Intronic
955785145 3:62529712-62529734 CAAAAGTTTGCATTTTCATTTGG + Intronic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
956413736 3:69005365-69005387 CCAAAGACTGCATCTGCTGAAGG + Intronic
957367840 3:79249820-79249842 CCAAAGTCTGTATGTTCCTGAGG - Intronic
957753259 3:84451625-84451647 CCAAAGACTGGCTTTTCATATGG + Intergenic
957927281 3:86830495-86830517 CCACAGTCTTCATTTTATTGAGG + Intergenic
957975200 3:87434163-87434185 CCAAAGTATGCATTTTCATGGGG - Intergenic
963001225 3:140683532-140683554 TCAAAGTCTTCATTTTCCAAAGG - Intronic
965656130 3:170987237-170987259 CCAAAATATACAATTTCTTATGG - Intergenic
965966950 3:174503435-174503457 TCAAAATTAGCATTTTCTTAAGG + Intronic
967688327 3:192443713-192443735 GCAAAATCTGCATTTTCATTTGG + Intronic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
969432895 4:7166364-7166386 GCAAAGTCTGCCTTTTTATAAGG - Intergenic
969479404 4:7440022-7440044 CCATTCTCTGCATTTTCTGAAGG - Intronic
969505795 4:7586854-7586876 CCAGAGTTTGCATTTTCTCGAGG + Intronic
970627586 4:17906320-17906342 CCAAATTTTGACTTTTCTTAGGG - Intronic
970872355 4:20830477-20830499 CTAGATTCTGCATGTTCTTATGG + Intronic
973377346 4:49296401-49296423 CCACATTCTGCGTTTTCTTGGGG - Intergenic
973378268 4:49302537-49302559 CCACATTCTGCGTTTTCTTGGGG - Intergenic
973380797 4:49318970-49318992 CCACATTCTGCGTTTTCTTGGGG + Intergenic
974522659 4:63004457-63004479 CCAAAGTATTCATTATATTATGG + Intergenic
975018474 4:69455893-69455915 CCAGCGACTGCATTTTCTTTGGG - Intergenic
975185008 4:71391634-71391656 CCAAAGCTTTCTTTTTCTTATGG + Intronic
975218207 4:71781737-71781759 CAAAAGTGGACATTTTCTTATGG + Intronic
978058871 4:104311216-104311238 CCAATGTCTACAATTTCTCAGGG - Intergenic
979178812 4:117699910-117699932 GCAAAGTCTGCATCTTTCTACGG - Intergenic
979287970 4:118948288-118948310 CTAAAATGTCCATTTTCTTAAGG + Intronic
979464409 4:121020005-121020027 TCAAAGTCTGCATTCTATTCTGG + Intergenic
980017100 4:127662362-127662384 CCAAAGAGTACATTTTCTTCTGG + Intronic
980428579 4:132659012-132659034 CAAAGGTCTGCATTTTGTTCTGG - Intergenic
980784803 4:137538233-137538255 ACAAATTCTGCATTTTAATAAGG + Intergenic
981154308 4:141415774-141415796 CCAAATTTTGCATTTGCTTAAGG - Intergenic
982304064 4:153911084-153911106 CCAAGGTACGTATTTTCTTATGG + Intergenic
983772340 4:171567161-171567183 TCAAAGTATGCACTATCTTAGGG - Intergenic
984090423 4:175367610-175367632 CCAAAGTCTTTATATTCTTCTGG + Intergenic
987569511 5:19638317-19638339 TTAAAATCTGCACTTTCTTAAGG + Intronic
988601436 5:32643027-32643049 CACAAGACTGCTTTTTCTTATGG + Intergenic
988909238 5:35823199-35823221 CTAAAGACTGCATTTTCCTAAGG + Intergenic
990747264 5:58971764-58971786 CCAGATATTGCATTTTCTTATGG + Exonic
990904446 5:60788817-60788839 GGAAAGTCTGAATTTTCTTGTGG - Intronic
991388906 5:66121501-66121523 CCAAAGTTTCCCTTTTCATAAGG - Intergenic
992226278 5:74622147-74622169 CCAAAGTCTGCAATTTAATTAGG + Intergenic
993467023 5:88261178-88261200 CCAAAGTATTCATTTTTTTCTGG - Intronic
994242313 5:97438815-97438837 CCAAACTCTGCTTTATTTTAAGG - Intergenic
995105386 5:108371563-108371585 CCAATGTCTGGGTTTTCTCATGG - Intronic
995277498 5:110293763-110293785 GAAAAGTCTGAATCTTCTTAAGG + Intronic
995605118 5:113845841-113845863 CAAATGTCTGTATTTTCTCAAGG - Intergenic
995894127 5:116991946-116991968 TCCTAGTCTACATTTTCTTAGGG + Intergenic
997085887 5:130797983-130798005 CCAAAGTCTGCATGGTATTCTGG + Intergenic
997904962 5:137807419-137807441 CCAACTTCTGTATTTTTTTAGGG - Intergenic
998140089 5:139694865-139694887 CCAGAGTCTGGATTTTCTGAGGG + Intergenic
998437408 5:142123858-142123880 GCTAAGCCTGAATTTTCTTATGG + Intronic
998596401 5:143535105-143535127 CCAATGTCTCCTTTCTCTTACGG + Intergenic
999305236 5:150515395-150515417 GCACAGTCTGCATTTTGTTTGGG + Intronic
999807370 5:155095147-155095169 CCAAATACTGCATGTTCTCATGG + Intergenic
1000451321 5:161391544-161391566 ACAAATTCTGAATTCTCTTATGG + Intronic
1000558851 5:162760537-162760559 CCAGAGTCTATATTTTCATATGG - Intergenic
1000622751 5:163504542-163504564 CCACTGTCTGGATTTTCCTAGGG - Intronic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1004454089 6:15775193-15775215 TCAGAGCCTGCATTTTATTAAGG - Intergenic
1004582878 6:16971504-16971526 ACAAACACTGCATTTGCTTAGGG - Intergenic
1007140212 6:39564957-39564979 CCAAAGTTTTCATTTTGTTAAGG - Intronic
1007372750 6:41437437-41437459 CCAGAGTCTGCATTTTCAATAGG - Intergenic
1008327539 6:50202332-50202354 CCCAAGTACACATTTTCTTAGGG + Intergenic
1008944745 6:57085739-57085761 CAACAGGCTGCTTTTTCTTATGG + Intergenic
1012556454 6:100518743-100518765 CAAAAGGCTGCATTTGCTTAAGG + Intronic
1013982795 6:116152617-116152639 TCAAAGTCTTCATTATGTTAAGG - Intronic
1014192564 6:118514618-118514640 CCAATGTCTGCCTTTTGTTTGGG - Intronic
1015229518 6:130898446-130898468 CCAGAGTCAACATTTCCTTATGG - Intronic
1015332900 6:132002266-132002288 CAAATGTCTGCATTTTCATGTGG - Intergenic
1015360256 6:132331780-132331802 CCAAAGTCTGTACTTTCCTACGG + Intronic
1017234163 6:152102093-152102115 TCAAAGACTGCACTTCCTTAGGG - Exonic
1017300134 6:152847431-152847453 CAATAGTCTGCTTTTTCTTTAGG - Intergenic
1017815606 6:158014439-158014461 CCTAACTCTGCATTTCCTTTAGG + Intronic
1018004582 6:159609887-159609909 GTAAAATATGCATTTTCTTAAGG - Intergenic
1018225769 6:161627110-161627132 CCACAATATGCATTTTCTCAAGG + Intronic
1018486192 6:164243290-164243312 CCAAAGTCTGCAGTTTTCAAAGG + Intergenic
1020215237 7:6185283-6185305 GCCATGTCTGGATTTTCTTAAGG - Intronic
1020703030 7:11507204-11507226 TCAAAGACTGCATTGTATTAGGG + Intronic
1021467114 7:20956857-20956879 CCAAAGTCTTTCTCTTCTTAGGG - Intergenic
1022197945 7:28087572-28087594 CCAACCTCTCCATTTTCTGAGGG + Intronic
1024097567 7:45995729-45995751 CCAATGTCTGTGTTTTCTTAGGG - Intergenic
1025265718 7:57455218-57455240 CTGAAGTCAGCATGTTCTTAAGG + Intronic
1026381494 7:69804105-69804127 TCACAATCTACATTTTCTTAGGG - Intronic
1027953714 7:84853732-84853754 GCCAACTCTGCATTCTCTTAGGG - Intergenic
1029033721 7:97495674-97495696 CCTAGGGCTGCATTTCCTTATGG - Intergenic
1029234062 7:99098300-99098322 CCAAAATGAGCATTTTCCTATGG + Intronic
1030398716 7:109020782-109020804 CCTTAGTCTGCATTATCTTGGGG + Intergenic
1030771573 7:113482069-113482091 GCAAATTCAGCATTTTCTGAGGG - Intergenic
1031755814 7:125640551-125640573 TCAAAGTAACCATTTTCTTATGG + Intergenic
1031784874 7:126016851-126016873 CCAAAGAATGCATTTTATTGAGG - Intergenic
1032404246 7:131644293-131644315 CAACAGTCTGAATTTTCTAAGGG - Intergenic
1032676901 7:134138487-134138509 CCAAAGTCATAAGTTTCTTAAGG + Intronic
1032806743 7:135362848-135362870 ACAAATCCTGCATTTTCTAATGG + Exonic
1033604974 7:142920238-142920260 CCAGTCTCTGCATTTTCTCAGGG + Intronic
1036539160 8:9686866-9686888 CCAAATTCTTCATTTTTTTTAGG - Intronic
1036737690 8:11332360-11332382 CCAAAGTCTGGGATTCCTTAAGG - Intergenic
1037022072 8:13985694-13985716 ACAAATGGTGCATTTTCTTAAGG + Intergenic
1039129502 8:34247365-34247387 CCAGAGTCTGAGTTTTCTTTGGG - Intergenic
1039408428 8:37331997-37332019 CCAACTTCTGCGTTTTCATAAGG + Intergenic
1039714843 8:40096757-40096779 CCAATATCTGCACTTTCTTTTGG + Intergenic
1039744442 8:40411486-40411508 CTAAAATCTGCATTTTATCAAGG + Intergenic
1040010393 8:42656745-42656767 CCCAAGACTTCATTTTCTTCTGG + Intergenic
1040839239 8:51767154-51767176 CCAACATCTGAGTTTTCTTATGG + Intronic
1042509363 8:69595170-69595192 CCAAAGTCTATATTTTTTAAAGG + Intronic
1043143701 8:76624355-76624377 CCAAAGTTTACATCTTCTAAGGG - Intergenic
1043745789 8:83871749-83871771 CCAAAGTCTTCTTTTCATTAAGG - Intergenic
1044496686 8:92895523-92895545 GGAAAGTCTGAATCTTCTTAGGG + Intronic
1045546155 8:103130561-103130583 ACAAAGTGTGCAATTTCCTAAGG - Intergenic
1045625294 8:104039709-104039731 CGAAAGTCGGCATTTGCCTAGGG + Intronic
1046839213 8:118838865-118838887 CCAAATTCTCCCTTTTCATAAGG + Intergenic
1047024939 8:120814010-120814032 CCAGAGCCTACAATTTCTTATGG - Intergenic
1048576274 8:135692653-135692675 CCAAAGCCAGCATTTTCATATGG - Intergenic
1049938998 9:526738-526760 CAAATATCAGCATTTTCTTATGG - Intronic
1050415816 9:5416285-5416307 CTAAATTCTTCATTATCTTAAGG + Intronic
1052802680 9:32984710-32984732 CCACAGTGTGCATATGCTTAAGG + Exonic
1053141212 9:35683966-35683988 CCAAAGTCAGCAATCTCTTTGGG + Intronic
1053364653 9:37514065-37514087 ACTAAGTCTCCATTTGCTTAAGG + Intronic
1055602877 9:77938036-77938058 CCAAAATCTGCAGATGCTTAGGG + Intronic
1055815066 9:80195385-80195407 CTAAAGTCTGCAAATTTTTAGGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058116449 9:101090475-101090497 TGAAATTGTGCATTTTCTTATGG + Intronic
1061180927 9:129024708-129024730 CCAAAGTCTTTCTTTTTTTAAGG - Intronic
1062347354 9:136121157-136121179 CCTAATTTTGTATTTTCTTAAGG - Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1187379978 X:18792899-18792921 TCAAACTCTGCATTTACATAGGG - Intronic
1187807913 X:23141384-23141406 ACACAGACTGTATTTTCTTAAGG + Intergenic
1190710617 X:53066188-53066210 GCAATGTCTGCATTCACTTAGGG - Intronic
1192076906 X:68008233-68008255 CCACAGTCTGAATTTTGTTTTGG + Intergenic
1193116161 X:77777503-77777525 ACAAAATTTGCATTTGCTTATGG - Intronic
1194012675 X:88582478-88582500 CCAAAGGCTTCAATTTCTAAAGG - Intergenic
1195693764 X:107651304-107651326 CCAAATTAGGTATTTTCTTATGG + Intergenic
1196140004 X:112250741-112250763 ACGATGTCTGGATTTTCTTAGGG + Intergenic
1196209293 X:112977140-112977162 CCAACATCTGCATTTTTTCAAGG - Intergenic
1199607872 X:149591139-149591161 CCCATGTCTGCATTCTCTTATGG + Intergenic
1199631251 X:149778229-149778251 CCCATGTCTGCATTCTCTTATGG - Intergenic