ID: 1186500207

View in Genome Browser
Species Human (GRCh38)
Location X:10044888-10044910
Sequence CTGACTGGACAAAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186500207 Original CRISPR CTGACTGGACAAAGGGATGG GGG (reversed) Intronic
900860194 1:5223394-5223416 CTGGCAGGACACAGGGAGGGAGG + Intergenic
901110643 1:6791299-6791321 GCTACAGGACAAAGGGATGGTGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901875200 1:12163565-12163587 CTGCATGGACAAAAGCATGGAGG + Intergenic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
902560294 1:17273159-17273181 CTGACTGGAGGAGGGGCTGGAGG - Intronic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905471091 1:38192476-38192498 ATGACTGGACCCAGGGATGATGG + Intergenic
905503070 1:38454646-38454668 CTTACTGGACATAGAGAAGGGGG + Intergenic
905559617 1:38916157-38916179 CTGCCTTAACCAAGGGATGGAGG + Intronic
906692500 1:47801822-47801844 CTGTGTGGGCAAAGGGCTGGAGG - Intronic
908133179 1:61097715-61097737 CTGACAGGACAAAAGGAGAGAGG - Intronic
908951944 1:69570436-69570458 CTGGCTGGAGCAAGGGGTGGGGG - Intronic
909824469 1:80109907-80109929 CAGACTGGATAAAGGAATTGTGG - Intergenic
912467112 1:109881893-109881915 CTGTCTGTTCAAAAGGATGGGGG - Intergenic
914241340 1:145854999-145855021 CTCACTGACCAAGGGGATGGAGG + Intronic
914258874 1:145982348-145982370 CTGACTGAAGAAGGGGCTGGTGG + Intergenic
915100196 1:153493639-153493661 AAGACTGGATAAAGTGATGGAGG - Intergenic
916076701 1:161204346-161204368 CTTACTGGACATAGACATGGAGG - Intronic
916484883 1:165249847-165249869 CTGACTGGATAAAGGAAATGTGG + Intronic
917156231 1:172001931-172001953 CTGTCTGGTCATAGAGATGGTGG + Intronic
919847235 1:201649676-201649698 GAGGCTGGACAATGGGATGGGGG + Intronic
920092946 1:203467073-203467095 CAGACTGGGCAAAGGCATAGAGG + Intergenic
921857676 1:220004562-220004584 CTGAGTGAAAAAAGGGATGAAGG + Intronic
922061286 1:222094898-222094920 CTGCCTGCACAAAGGGTTAGTGG + Intergenic
922162617 1:223089525-223089547 CTGACTGAGCACAGGGATGGGGG - Intergenic
922742658 1:228022895-228022917 CGTGCTGGACAAAGGTATGGGGG + Exonic
924309103 1:242721376-242721398 CTGGCTGGACAAGGGCAAGGAGG + Intergenic
1062876868 10:949517-949539 CTGCCTGGAAAACGGGTTGGAGG - Intergenic
1066461834 10:35619186-35619208 CTGGCTGGATCAGGGGATGGGGG + Intergenic
1067942430 10:50668088-50668110 TTGACTGCACAAAGAGGTGGAGG - Intergenic
1069813773 10:71180651-71180673 CTGGCTGGACAGATGGATGTAGG - Intergenic
1069842111 10:71346376-71346398 GTGACTGGCCCAAGGGAAGGTGG + Intronic
1070863674 10:79693046-79693068 TTGACTGCACAAAGAGGTGGAGG - Intergenic
1071508992 10:86249650-86249672 CTGCCTGGGCAAAGGCATAGAGG - Intronic
1073293561 10:102425137-102425159 GTGTCTGGACAAAGGCAAGGAGG + Exonic
1073747530 10:106486468-106486490 TTGACTGGGCTAAGGGATGCCGG - Intergenic
1074652543 10:115540420-115540442 TTGACTTTACAAAGGGATTGAGG - Intronic
1075008861 10:118851354-118851376 CTCACAGGACAGAGGGATGGAGG - Intergenic
1075008904 10:118851617-118851639 CTTACAGGACAGAGGGATGGAGG - Intergenic
1075008910 10:118851641-118851663 CTTACAGGACACAGGCATGGAGG - Intergenic
1075008915 10:118851665-118851687 CTTATAGGACAGAGGGATGGAGG - Intergenic
1075904762 10:126071581-126071603 CAGCCTGGAGAAAGGAATGGGGG - Exonic
1076209554 10:128629485-128629507 CAGACTGGACAAAGTGGTGTGGG - Intergenic
1076490826 10:130860183-130860205 CAGACTGGAGGAAGGGAAGGTGG - Intergenic
1076598104 10:131638216-131638238 CTGACTGGAGACCGGGATGGGGG - Intergenic
1076709060 10:132321103-132321125 CTGACTGGTCAAAGGGATGTTGG + Intronic
1076872096 10:133199232-133199254 CTACCTGGACAATGGGCTGGAGG + Exonic
1079085304 11:17440746-17440768 CTAGCTGGACAAAGGGAGGTTGG + Intronic
1079304459 11:19310013-19310035 CTGGCTGGACCAGGGGTTGGGGG + Intergenic
1080242563 11:30143403-30143425 CTCACTGAACAAAGGCATGCTGG - Intergenic
1082662415 11:55928304-55928326 CTTCCTGGAGAAAGGGATGAAGG + Intergenic
1083455159 11:62773858-62773880 TTCACTAGACAAAGGGATTGGGG + Intronic
1084148979 11:67279301-67279323 CTGCCTGGAGAAAGGGGAGGAGG + Intronic
1084576751 11:69993587-69993609 GTGACTTGAATAAGGGATGGAGG - Intergenic
1085498619 11:76996304-76996326 CTGAGTGGAGAAAGAGAGGGAGG - Intronic
1086953534 11:92914024-92914046 GTGATTGGATAAAGGGAGGGTGG + Intergenic
1088096301 11:106104805-106104827 ATGACTGCACTAAGAGATGGTGG - Intergenic
1088432966 11:109778733-109778755 CTGACTTCAGAAGGGGATGGTGG - Intergenic
1089248062 11:117137076-117137098 CTGACTGGAGGATGGGAGGGTGG - Intergenic
1089258651 11:117207485-117207507 CTGACTGGAGGATGGGAGGGTGG + Intronic
1089971039 11:122693503-122693525 CAGAATGGACAAAGTCATGGAGG + Intronic
1091000209 11:131904674-131904696 CTCACTTTACAATGGGATGGAGG + Intronic
1091103238 11:132895320-132895342 GTCAGTGGACAAAGGGATGAAGG + Intronic
1091255881 11:134184997-134185019 CTGACTAGAGAAAGGGCAGGAGG + Exonic
1092050691 12:5467838-5467860 CTGATGGCACAAAGGGAAGGAGG - Intronic
1092867771 12:12779068-12779090 CAGAATGGACAAAGGAATGGAGG - Intronic
1094615655 12:32034105-32034127 AGGACTGGACAAAGGGATCCAGG + Intergenic
1097023621 12:56037572-56037594 TTGACTGGGGAAGGGGATGGGGG - Exonic
1097180182 12:57167332-57167354 CTGACTGGGCTAAGGGCTGCTGG + Intronic
1098031540 12:66259774-66259796 CTGACTGGTCAAGGGGAAAGTGG - Intergenic
1098072556 12:66691584-66691606 ATGAGTGGACAAGGGCATGGTGG - Intronic
1098975385 12:76896561-76896583 CTGACTGGAAAAAGAGAGGGAGG + Intergenic
1099401494 12:82207654-82207676 TTCACTGGACAAAGTGATGAAGG - Intergenic
1100121619 12:91375263-91375285 TTGGCTGGGCAAAGGGAAGGCGG + Intergenic
1101051502 12:100868610-100868632 CAGCCTGGAAAATGGGATGGGGG - Intronic
1101347581 12:103900814-103900836 CTGCATGGGCAAAGGCATGGAGG + Intergenic
1102108877 12:110349086-110349108 CTGTCTGGACCAAGGGAAGTGGG - Intronic
1102222969 12:111207042-111207064 ATGAATGGATAAATGGATGGTGG + Intronic
1102646477 12:114407060-114407082 AGGTCTGGAGAAAGGGATGGAGG + Intronic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1104177652 12:126348520-126348542 CTGGCTGGAGGAAGGGCTGGTGG + Intergenic
1104424454 12:128663545-128663567 CTCACTGGCCACAGAGATGGGGG - Intronic
1105012127 12:132762564-132762586 CTGTCTCGAAAAAGGGAAGGAGG + Intergenic
1106384464 13:29270504-29270526 CTCTCTGGGAAAAGGGATGGAGG + Intronic
1107822586 13:44299766-44299788 CTGGCTGTACCCAGGGATGGAGG - Intergenic
1108382112 13:49864212-49864234 GTGACTGGAAAACAGGATGGAGG + Intergenic
1109154253 13:58885490-58885512 CTGGATGGACAAAGGCATGTGGG - Intergenic
1110356250 13:74571308-74571330 CTAACTGGCCAAAGGGGTGAGGG - Intergenic
1111233643 13:85378811-85378833 CTGGATGGAGAAAGGAATGGAGG - Intergenic
1111877080 13:93910738-93910760 TTGACTGGATTAAGGGTTGGGGG - Intronic
1112760452 13:102688870-102688892 CTAACAGGACAAGGGGCTGGCGG - Intronic
1113938083 13:114005726-114005748 CGGAGGGGAGAAAGGGATGGGGG - Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114366915 14:22037767-22037789 CTGAATGGAAGAAGGGTTGGAGG + Intergenic
1114559466 14:23579668-23579690 CAGACAGGACAGAGGGGTGGTGG - Intergenic
1116434906 14:44886091-44886113 GTGACTGGTCAAAGGGGTGATGG + Intergenic
1118503444 14:66385895-66385917 CTGCCTATACAAAGGGATGCGGG - Intergenic
1119193568 14:72701203-72701225 CTGACTGGTCCCAGGGGTGGTGG - Intronic
1119214133 14:72855691-72855713 CCCACTGGCCAAGGGGATGGTGG + Intronic
1119399088 14:74349641-74349663 CTGGGTGGGCCAAGGGATGGAGG - Intronic
1119993290 14:79224493-79224515 TTGACTGGCCAAAGTAATGGTGG + Intronic
1121488731 14:94342702-94342724 CTGAAAGGACATAGAGATGGAGG - Intergenic
1122233714 14:100320401-100320423 ATGGATGGACAGAGGGATGGAGG - Intergenic
1125266433 15:37886714-37886736 CTGTCTAGATAAAGGGATGCTGG - Intergenic
1128578322 15:68791187-68791209 GGGACTGGACAAAGGGGTGTAGG - Intronic
1128793618 15:70449879-70449901 ATGAATGGAGAGAGGGATGGAGG + Intergenic
1128793715 15:70450250-70450272 GTAAGTGGACAGAGGGATGGAGG + Intergenic
1130621880 15:85471681-85471703 TTGCCTGGACCCAGGGATGGGGG - Intronic
1133040248 16:3056858-3056880 GTGACTGGAGACAGGGATGATGG + Intronic
1133044119 16:3076679-3076701 GTGACTGGAGAAAGGGATCGTGG + Intronic
1133081101 16:3320874-3320896 CTTCCTGGACTAAGGGATGACGG + Intergenic
1134870900 16:17651597-17651619 CTGGCTTGCAAAAGGGATGGAGG + Intergenic
1135110845 16:19689721-19689743 TAAACTGGACAAAGGGATGATGG - Intronic
1135241218 16:20808152-20808174 CTGACTGGGAGAAGGGCTGGGGG - Intronic
1135846973 16:25927764-25927786 ATGAATGGAGAAAGGAATGGAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137634774 16:49976281-49976303 CTGCCTGGAGACAGGGACGGGGG + Intergenic
1138597859 16:58038658-58038680 CAGACTGCAGCAAGGGATGGGGG + Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1140412984 16:74752704-74752726 CTGAATGGAGGAAGGGATGGTGG + Intronic
1140801459 16:78492015-78492037 CTCAATGGACAAAGGGAGTGGGG + Intronic
1141854780 16:86673618-86673640 ATGAATGGACAAAATGATGGAGG - Intergenic
1142108419 16:88318503-88318525 CTGACTTGCTAAAGGGCTGGGGG - Intergenic
1143008539 17:3852859-3852881 CTCACTAGACCAAGGGAAGGAGG - Intergenic
1143042625 17:4050344-4050366 CTGACTCGACTAAGGAGTGGTGG - Intronic
1143320602 17:6066334-6066356 CTGACTAGTCATAGGCATGGGGG - Intronic
1143981499 17:10874034-10874056 CAGACTGGACAACAGGATGGTGG + Intergenic
1144142219 17:12360713-12360735 GAGACTGGACAGATGGATGGAGG + Intergenic
1145251240 17:21298069-21298091 CTGACTAGTCAATGGGATGTGGG - Intronic
1145782429 17:27571847-27571869 CTGACTGGCCACAGGGAGTGTGG + Intronic
1145974900 17:28978299-28978321 ATGATCGGACAAAGGGATGGAGG - Intronic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146679027 17:34793689-34793711 CAGACTGGGCAAAGGCATGGAGG - Intergenic
1147607820 17:41784403-41784425 CTGACTGGACTGGGGGATGCGGG - Intronic
1148405198 17:47407082-47407104 CTGACAGGAACAAGGGATGCAGG + Intronic
1148844207 17:50519153-50519175 GTGTCTGGACACAGGGATGCTGG + Intronic
1151447003 17:74173380-74173402 CTGAGTAGCCAAAGGGGTGGAGG + Intergenic
1152371784 17:79892868-79892890 CTGTTTGGACAAAGTGCTGGGGG - Intergenic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1155041834 18:22071268-22071290 CTGACTAGAGAAAAGGATGTAGG - Intergenic
1155793345 18:30001697-30001719 CTGAATTTACAAATGGATGGTGG - Intergenic
1155864344 18:30945797-30945819 CTGAATCCACAAAGGGATAGTGG + Intergenic
1158106486 18:53890475-53890497 CTGTCTGGAGAACAGGATGGGGG + Intergenic
1159023298 18:63160747-63160769 GTGACCTGTCAAAGGGATGGGGG + Intronic
1160429582 18:78802220-78802242 TTTACAGGAGAAAGGGATGGGGG + Intergenic
1161090418 19:2357377-2357399 ATGGATGGACAAATGGATGGTGG - Intergenic
1161422772 19:4184876-4184898 GTGATTGGGCAAATGGATGGAGG + Intronic
1165051147 19:33142373-33142395 CTGCCTGGAGAAAGTGGTGGAGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166287173 19:41838376-41838398 CTGAGTGGACACAGGGGTTGGGG - Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
1168722062 19:58559593-58559615 CTATCTGGAAAAGGGGATGGAGG + Intergenic
928308254 2:30189204-30189226 CTGACTTGAGAAAGGTCTGGAGG + Intergenic
928849666 2:35729919-35729941 GTGACTGGATCATGGGATGGGGG - Intergenic
929288189 2:40159858-40159880 CAGACTGGAAAAAGGGATTTGGG + Intronic
930105714 2:47637781-47637803 CTGACTTGACAACTGGGTGGAGG - Intergenic
930211279 2:48640308-48640330 CTGACTGGATAAAGGAAATGTGG + Intronic
931569667 2:63655289-63655311 ATGGCTGGAGAAAGGGAAGGGGG - Intronic
931853890 2:66281524-66281546 ATGAATGGACAGAGAGATGGAGG - Intergenic
932620270 2:73260855-73260877 CTGGCTGGAGAATGGGAAGGGGG + Exonic
934574919 2:95393949-95393971 CTGTCTGGAGTAAGAGATGGCGG + Intergenic
934712734 2:96526585-96526607 CAGACTGGACACAGGGGTTGCGG + Intergenic
936517961 2:113193901-113193923 CTGAATGGGCTGAGGGATGGCGG + Exonic
937915230 2:127095627-127095649 CTCCCTGGACTCAGGGATGGGGG + Intronic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
938748162 2:134301002-134301024 CTGAATGGAAAGAGGCATGGGGG - Intronic
939680912 2:145130732-145130754 CTGTTTGGACAAAGGCATGCAGG + Intergenic
940596315 2:155796952-155796974 CTATCAGGACAAAGGTATGGGGG + Intergenic
941747176 2:169099129-169099151 CTAACTGGATAAAGAGGTGGTGG - Intergenic
942562002 2:177229719-177229741 GTGGCTGAAGAAAGGGATGGGGG - Intronic
942685930 2:178531936-178531958 CTCACTAGACACAGGGCTGGGGG + Exonic
945143760 2:206715061-206715083 CAGACTGGGCAAAGGCATGGAGG + Intronic
945327609 2:208501033-208501055 CTGACTGGAGTCAGGGGTGGGGG + Intronic
1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG + Intergenic
1170392633 20:15891925-15891947 CTGAAGGGACAATGGGAAGGAGG + Intronic
1171184275 20:23113699-23113721 CTCACGGGACAAATGGCTGGTGG - Intergenic
1171367228 20:24633586-24633608 CGAACTGGAAAAAAGGATGGAGG - Intronic
1172521462 20:35569289-35569311 ATGTCAGGATAAAGGGATGGGGG - Intergenic
1172776036 20:37407596-37407618 CAGCCTGGGCAAAGGCATGGAGG - Intergenic
1173128278 20:40360996-40361018 CTGACTGGATAAAGAAATTGTGG - Intergenic
1173496779 20:43525164-43525186 GTGACTGGATGAATGGATGGTGG + Intronic
1175369777 20:58480462-58480484 CAGTCTGGACCACGGGATGGAGG + Intronic
1175458271 20:59131449-59131471 CTGACTTGACAGAGGGGAGGTGG + Intergenic
1178892834 21:36534356-36534378 TTGACAGGAAAAAGGGATGATGG + Intronic
1181476096 22:23168698-23168720 GTGCCTGGACAAAGGGGAGGAGG - Intergenic
1181646310 22:24233264-24233286 CAGGCTGGACAAAGGCCTGGAGG - Intronic
1182149349 22:28017509-28017531 CTGCCTGGACAAAGTGGAGGAGG + Intronic
1182303136 22:29349975-29349997 CTGCCTGGGGACAGGGATGGCGG - Intronic
1182547247 22:31083387-31083409 CTGACAGGAAGAAGTGATGGGGG + Intronic
1183024287 22:35052430-35052452 CTGACTGGGGATGGGGATGGTGG - Intergenic
1183413742 22:37671115-37671137 CTGTCTGGACAAAGGCTGGGAGG + Intergenic
1184643622 22:45884849-45884871 CTGACTGGACCGAGGGCTCGGGG - Intergenic
1184766239 22:46573954-46573976 AGAACTGGACACAGGGATGGCGG - Intergenic
1185164316 22:49251421-49251443 CTGACCGGACACAGGCATGAGGG + Intergenic
950121958 3:10488002-10488024 ATGGGTGGACAAAAGGATGGAGG - Intronic
950570926 3:13799483-13799505 CTGCCTGGAGGAAGGGAGGGTGG + Intergenic
954425867 3:50442863-50442885 CTGAGTAGACAAAGGCCTGGAGG - Intronic
954618945 3:51984981-51985003 ATGTCTGGACACAGGGTTGGAGG - Intronic
954648935 3:52148322-52148344 CTCCCAGGACAAAGGAATGGGGG + Intronic
955563655 3:60221436-60221458 CTGACTGGAGAATGGGCTGTAGG - Intronic
961671468 3:128534797-128534819 CTGAGTGGACAAATAGATTGAGG - Intergenic
962473831 3:135738686-135738708 GTGACTGGGAAAAGGGCTGGAGG - Intergenic
962929343 3:140022671-140022693 CTGTGTGGAGAATGGGATGGAGG + Intronic
963129767 3:141847424-141847446 CTGACTGTACAAAGTGATCTAGG - Intergenic
964008438 3:151860051-151860073 CTGTCTGGAAAAAGGAATGGAGG + Intergenic
966504502 3:180684523-180684545 CTGACTGGAAAGAGGCATGAGGG - Intronic
966730275 3:183145048-183145070 CTGCCCGGCCAAAGGGGTGGAGG + Intronic
967363834 3:188663304-188663326 CAGACTCAAGAAAGGGATGGGGG + Intronic
970501444 4:16681238-16681260 CTGACTGGATAAAGGGGATGTGG + Intronic
971155878 4:24082414-24082436 ATGACTGGCCAAAGGGACTGAGG - Intergenic
976085991 4:81407678-81407700 TTTACTGAAGAAAGGGATGGAGG + Intergenic
976823454 4:89233426-89233448 CTGACAAGTCAAAGGGAAGGAGG + Intergenic
977879385 4:102186836-102186858 CTGTGAGTACAAAGGGATGGTGG + Intergenic
978454590 4:108874373-108874395 CTGAGTAGACAAAGTGACGGAGG + Intronic
978856918 4:113404129-113404151 CCTACTGGACAAAGTGATGGTGG - Intergenic
982304296 4:153913754-153913776 ATGGCTGGAGAAAGGGAGGGAGG - Intergenic
984190220 4:176596618-176596640 CTGCCTGGAGAGAGGGATAGGGG - Intergenic
989441178 5:41474065-41474087 GAGACTGAACAAAGGGATGAAGG + Intronic
989996552 5:50839872-50839894 CTGACTGAAAAGAGTGATGGGGG + Intronic
991001968 5:61791931-61791953 CTATCTGGACAGAGGGATAGGGG + Intergenic
994477816 5:100292227-100292249 TTGATTGGAGAAAGGGATAGGGG - Intergenic
995849602 5:116531542-116531564 CTAACAGGAGCAAGGGATGGAGG - Intronic
996491857 5:124107123-124107145 CTGATTGGATATAGGAATGGAGG + Intergenic
996837391 5:127808609-127808631 CTCACTCTGCAAAGGGATGGAGG - Intergenic
998733279 5:145106037-145106059 CTAAATGGACAAAGAGGTGGAGG - Intergenic
999721785 5:154404019-154404041 CTGAGTGCACTAAGGGATGCTGG + Intronic
1001304140 5:170559467-170559489 CTTAGAGGACAAAGGGAGGGTGG - Intronic
1001661953 5:173400327-173400349 CTGATAGGACAAAGTGATGTAGG + Intergenic
1003978298 6:11365018-11365040 CTGACTGGAGCAAGAGTTGGAGG + Intronic
1004446859 6:15708348-15708370 CTGACTGAATTAATGGATGGGGG - Intergenic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1007116185 6:39344989-39345011 CTGGATGGAAAAGGGGATGGGGG - Intronic
1007746983 6:44049156-44049178 CAGCATGGACAAAGGCATGGAGG - Intergenic
1008893765 6:56527561-56527583 CTGGCTGGACAAAGTGGAGGTGG - Exonic
1009733820 6:67648126-67648148 CTGACTGATCAGAGAGATGGTGG - Intergenic
1010641098 6:78328859-78328881 CTTTCTTGACAAAGGGATGATGG - Intergenic
1011076971 6:83448022-83448044 ATGCCTGGCCAAAGAGATGGGGG - Intergenic
1011564974 6:88664568-88664590 CTGAAAGGACAAGGGAATGGGGG + Intronic
1011823692 6:91281639-91281661 CTGAGTGCACAATGAGATGGAGG - Intergenic
1014651917 6:124050317-124050339 CTGACTGGTCAAAGCGTTGGAGG + Intronic
1015658232 6:135544085-135544107 CTGACTGGATAAAGGAAATGTGG + Intergenic
1016286344 6:142477468-142477490 CTGTCTGCACAAAAGTATGGCGG + Intergenic
1017416892 6:154230069-154230091 CTGACTGTAAATGGGGATGGGGG + Intronic
1017767247 6:157616633-157616655 CTGAAGGGACAGAGGGATTGTGG + Intronic
1017947781 6:159109700-159109722 CTGGCTGGAAGAAGGAATGGAGG + Intergenic
1018893117 6:167996517-167996539 CTGAAAGGACAAAGGGACGGAGG - Intronic
1019921491 7:4166199-4166221 CTGCCTGGGCAAAGGCAGGGAGG + Intronic
1020396323 7:7722570-7722592 TTCACTGGACAAAGTGATGAAGG + Intronic
1020577219 7:9948273-9948295 ATGACTGGATAAAGGGAATGCGG + Intergenic
1021981474 7:26059578-26059600 TTGAATGGACACAGGGATGAGGG - Intergenic
1022924238 7:35044007-35044029 CTGCCTGGATAAAGGAATAGGGG - Intergenic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1029282620 7:99446134-99446156 CTGACTGGACAGTGTGAAGGTGG - Intronic
1029793893 7:102873809-102873831 CAGCCTGCACAAAGGCATGGAGG - Intronic
1029822548 7:103159773-103159795 CTGCCTGGATAAAGGAATAGGGG - Intergenic
1029897184 7:103995463-103995485 CTGACTGGGCATAGGGATAAAGG + Intergenic
1030444648 7:109634129-109634151 CTGACTGGAAAAGGGCATAGGGG - Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032399124 7:131611426-131611448 CTCCCTGGACACAGGGATGGGGG + Intergenic
1032446267 7:131986362-131986384 CTGACTAGGCAAAGGGAATGGGG - Intergenic
1033229438 7:139584770-139584792 CTGCCTGGGCCAAGGGATCGGGG + Intronic
1033678985 7:143573900-143573922 CTGACTGGAGCAAGAGGTGGAGG - Exonic
1033692853 7:143755554-143755576 CTGACTGGAGCAAGAGGTGGAGG + Exonic
1033740107 7:144267146-144267168 CTGACTGGAGCAAGAGGTGGAGG + Exonic
1035082930 7:156232933-156232955 CTGACTGGAGAATGGGACTGGGG - Intergenic
1035692255 8:1568005-1568027 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692275 8:1568104-1568126 CTGAATGGACAGTGGCATGGGGG - Intronic
1035692285 8:1568153-1568175 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692293 8:1568203-1568225 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692312 8:1568302-1568324 CTGAGTGGACAGTGGCATGGAGG - Intronic
1035692320 8:1568351-1568373 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692330 8:1568400-1568422 CTGAGTGGACAATGGCATCGGGG - Intronic
1035692349 8:1568499-1568521 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692377 8:1568648-1568670 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692398 8:1568747-1568769 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692408 8:1568797-1568819 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692417 8:1568847-1568869 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692437 8:1568946-1568968 CTGAGTGGACAGTGGCATGGAGG - Intronic
1035692444 8:1568996-1569018 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692485 8:1569193-1569215 CTAAGTGGACAATGGCATGGGGG - Intronic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1037272754 8:17147385-17147407 CTGGAAGGACAAAGGGAAGGTGG - Intergenic
1037338608 8:17816748-17816770 CAGACTGGATAAAGGGAATGTGG + Intergenic
1037666751 8:20976345-20976367 TTGACTGGAGAAAAGGAGGGAGG + Intergenic
1037717573 8:21412883-21412905 CTTACTTGAGAAAGGGAAGGGGG - Intergenic
1038680685 8:29664299-29664321 CAGACCTGACAAAGGGAAGGAGG - Intergenic
1038980550 8:32754706-32754728 CTGAGTGGATAAAGGCCTGGAGG + Intronic
1039039979 8:33398115-33398137 CTGACTGGTCAAAGAGTTTGGGG + Intronic
1039273515 8:35909073-35909095 CTGACTGGACTAAGGAGTGGGGG + Intergenic
1039912102 8:41833971-41833993 CTGCGTGGATAAAGGCATGGAGG + Intronic
1040740677 8:50571073-50571095 CTCATTGGACAAAAGGGTGGTGG - Intronic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1042609103 8:70577834-70577856 ATGACTGGACAAGGGGAGTGTGG - Intronic
1043932961 8:86111460-86111482 ATGAATGGACAAAGGAAAGGTGG - Intronic
1044190665 8:89313069-89313091 ATGAGTGGAGAAAGGGATGTAGG - Intergenic
1050690415 9:8221295-8221317 CTGGCTGGACAAAGGGATGTGGG + Intergenic
1055303981 9:74910021-74910043 CTGGCTGGAGAATGGGGTGGTGG - Intergenic
1055453025 9:76447836-76447858 CGTACTGGACACAGGGATTGTGG - Intronic
1055509138 9:76977697-76977719 CTGACTGCTCAAAGAGATGGTGG - Intergenic
1057122181 9:92586379-92586401 CTGCCTGGGGCAAGGGATGGTGG + Intronic
1058372150 9:104281696-104281718 CTACCAGGACAAATGGATGGAGG - Intergenic
1058428772 9:104899794-104899816 CAAACTGGACAAAGTGAGGGTGG - Intronic
1058435672 9:104960949-104960971 CTGGCTGCATAAAAGGATGGAGG + Intergenic
1060815991 9:126635436-126635458 CTGCCTGGGCAAAGGCATGGAGG + Intronic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062151568 9:135021870-135021892 GTGAGTGTACGAAGGGATGGGGG + Intergenic
1062643866 9:137536395-137536417 CCGACTGGGCAAGAGGATGGGGG + Intronic
1062649828 9:137569762-137569784 GTGACTGGATAGATGGATGGTGG - Intronic
1186338257 X:8615604-8615626 AGGACCAGACAAAGGGATGGAGG - Intronic
1186500207 X:10044888-10044910 CTGACTGGACAAAGGGATGGGGG - Intronic
1187436278 X:19272982-19273004 GTGAATGGACAAAGGGATAGGGG + Intergenic
1188092393 X:25978988-25979010 CAGACAAAACAAAGGGATGGAGG + Intergenic
1188607403 X:32048964-32048986 CTGAAAGGACAAACGAATGGAGG + Intronic
1189092355 X:38099011-38099033 CTGACTGCAAACAGGCATGGGGG + Intronic
1189508767 X:41639743-41639765 CTGACTGGGGATGGGGATGGGGG - Intronic
1189724748 X:43956948-43956970 AAGACTGGACAAAATGATGGAGG - Intronic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1191858633 X:65647941-65647963 CTTTGTGGACAAATGGATGGAGG + Intronic
1192496164 X:71617852-71617874 GTGACTGGAAAAGGGGATTGTGG - Intronic
1192790062 X:74372755-74372777 CTGCCTGGAAACAGGGATGAAGG - Intergenic
1192845895 X:74906941-74906963 AGGACTGGACAAAGGTATGATGG - Intronic
1195381190 X:104272575-104272597 TTGTCTGGAGAAAGGGATTGAGG + Intergenic
1195499273 X:105575547-105575569 CTGACTGGACAAAGAAAATGTGG - Intronic
1196513353 X:116540896-116540918 TAGACTGGACAAAGGAAAGGTGG - Intergenic
1197329730 X:125138885-125138907 ATCCCTGGAGAAAGGGATGGGGG - Intergenic
1197537240 X:127706295-127706317 TTCACTGGACAAAGTGATGAAGG + Intergenic
1197800590 X:130343674-130343696 CAGACTGGGCAATGGGAGGGAGG + Intronic
1197954619 X:131932392-131932414 ATGACTGGCCAAATAGATGGGGG + Intergenic
1198122451 X:133607594-133607616 CAGACTGGTCAAAGGGACAGAGG - Intronic
1198513418 X:137377899-137377921 CTGGATGGACAAATGAATGGAGG - Intergenic
1199341273 X:146680065-146680087 CTCACTGGATACAGGGAGGGAGG - Intergenic