ID: 1186500351

View in Genome Browser
Species Human (GRCh38)
Location X:10045809-10045831
Sequence GATGCACGTGACCATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186500351_1186500356 -1 Left 1186500351 X:10045809-10045831 CCTGCCTCATGGTCACGTGCATC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1186500356 X:10045831-10045853 CGGCTAAGAGAAGGAGCTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 162
1186500351_1186500357 11 Left 1186500351 X:10045809-10045831 CCTGCCTCATGGTCACGTGCATC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1186500357 X:10045843-10045865 GGAGCTCAGGGCACAGCCACAGG 0: 1
1: 0
2: 1
3: 44
4: 407
1186500351_1186500359 28 Left 1186500351 X:10045809-10045831 CCTGCCTCATGGTCACGTGCATC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1186500359 X:10045860-10045882 CACAGGCCTCCGAGTTTGTGTGG 0: 1
1: 0
2: 0
3: 7
4: 102
1186500351_1186500355 -2 Left 1186500351 X:10045809-10045831 CCTGCCTCATGGTCACGTGCATC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1186500355 X:10045830-10045852 TCGGCTAAGAGAAGGAGCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 179
1186500351_1186500354 -10 Left 1186500351 X:10045809-10045831 CCTGCCTCATGGTCACGTGCATC 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1186500354 X:10045822-10045844 CACGTGCATCGGCTAAGAGAAGG 0: 1
1: 0
2: 0
3: 0
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186500351 Original CRISPR GATGCACGTGACCATGAGGC AGG (reversed) Intronic
901511982 1:9722061-9722083 GATGCACTTGTGCATGCGGCAGG + Exonic
901914820 1:12490533-12490555 GATGCATGTGGCCAAGAGGAGGG + Intronic
905822890 1:41007481-41007503 GATGGGCGGAACCATGAGGCTGG + Exonic
913236120 1:116784818-116784840 GATGCCCTTGACCTTGAGACAGG - Intergenic
923499855 1:234555556-234555578 GAATCACGTCACCATGAAGCTGG - Intergenic
924542743 1:244996436-244996458 TATGGACGTTACCAGGAGGCAGG + Intronic
1062969084 10:1632509-1632531 CATGCACCTGCCCATGTGGCTGG + Intronic
1063344366 10:5297555-5297577 GATGTAAGTGTGCATGAGGCAGG + Intergenic
1065367928 10:24952884-24952906 GCTGCACGCGACCATCCGGCAGG - Intergenic
1078223796 11:9373893-9373915 GCTGCACGGGAGAATGAGGCAGG + Intergenic
1080234244 11:30050641-30050663 GAGGCATGTGACCTTTAGGCAGG + Intergenic
1080676814 11:34435618-34435640 GCTGCACGTGAGGCTGAGGCAGG - Intergenic
1084036631 11:66515356-66515378 GATGTACATGGCCATGAGACTGG + Intronic
1085708975 11:78812159-78812181 GATGCAGGTGCCCGTGATGCAGG + Exonic
1088250239 11:107856204-107856226 GATGCCAGTGGCCTTGAGGCTGG - Intronic
1089336364 11:117726548-117726570 GGTGTATGTGACCATGAGGGAGG + Intronic
1091194611 11:133720278-133720300 GATGCAGGTGACCACCTGGCTGG - Intergenic
1091581985 12:1795884-1795906 GAAGCCCGGAACCATGAGGCAGG + Intronic
1092216642 12:6688605-6688627 GATGCACAAGACCTTGTGGCAGG + Intronic
1097615345 12:61878893-61878915 GGTTCACATGATCATGAGGCTGG + Intronic
1101077032 12:101141101-101141123 AATGCACATGACCGTGAGGTGGG + Intergenic
1101611938 12:106300903-106300925 GGAGCAGGTGACCATGAGTCAGG - Intronic
1101858689 12:108465040-108465062 GATGCTCTTGACCATGACACTGG + Intergenic
1102648105 12:114416799-114416821 GTTGAACGTGACCATGAGAGTGG - Intergenic
1106905719 13:34407114-34407136 GACTCACATGATCATGAGGCGGG - Intergenic
1106978579 13:35251547-35251569 GATGCATGTGACCTTCAGGAAGG + Intronic
1121938027 14:98038451-98038473 GCTGCAACTGTCCATGAGGCTGG + Intergenic
1123967978 15:25477945-25477967 GCTGCACGTGACCAGGGGGCAGG - Intergenic
1132145427 15:99426372-99426394 AATGCAGGTGACCGTGAGGAAGG - Intergenic
1132731698 16:1366095-1366117 GTTACACGTTATCATGAGGCTGG - Intronic
1140394493 16:74615110-74615132 GAGCCATGTGACCATGATGCTGG + Intergenic
1140523358 16:75601391-75601413 GTTGCATGTGACCAAGAGCCTGG - Intronic
1146001069 17:29130858-29130880 GGTGCAGGTGACCTGGAGGCAGG - Intronic
1148966906 17:51443340-51443362 GATGAACCTCACCATGAGGGTGG - Intergenic
1152594588 17:81232167-81232189 GAAGCACATGCCCATGGGGCTGG - Intronic
1160382654 18:78472358-78472380 GAGGCAGGTGACGATGGGGCGGG - Intergenic
1163833611 19:19560101-19560123 GCTGCAGGGGGCCATGAGGCAGG + Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1166086626 19:40480137-40480159 GCTGCACGTGAGGCTGAGGCAGG + Intronic
928308806 2:30193286-30193308 CACACACGTGTCCATGAGGCTGG - Intergenic
932619760 2:73258587-73258609 GATGCTCCTGACCAGGAGGCTGG + Exonic
936573851 2:113637413-113637435 GATGCACGTGTGCAGGATGCTGG + Intronic
944548645 2:200824590-200824612 AATGCATGTGACCAAGAGGTTGG + Intergenic
945275519 2:207983862-207983884 GATGAAGGTGGCCATGAGGATGG - Intronic
948161645 2:235829726-235829748 GATGGACGATACCATCAGGCTGG - Intronic
1178589445 21:33896690-33896712 GAGGCAGCTGACCATGAAGCTGG + Exonic
1179996423 21:44976488-44976510 GATGCACGTGGCCACGAGGAGGG + Intronic
1180189597 21:46156126-46156148 GATACACGTGAGCACAAGGCAGG + Intergenic
1180189616 21:46156263-46156285 GGTACACGTGAGCATGGGGCAGG + Intergenic
1181407387 22:22694585-22694607 GATGCTCGTGACCCTGCTGCAGG + Intergenic
1181415385 22:22755352-22755374 GATGCTCGTGACCCTGCTGCAGG + Intronic
1181813401 22:25419600-25419622 GATCCACGTGACACTCAGGCTGG - Intergenic
1183615021 22:38938765-38938787 GATGAAAGTGAACAGGAGGCAGG + Intergenic
1183778944 22:39986100-39986122 GATGCACCTGACCAAGAGCATGG - Intergenic
1185426326 22:50773480-50773502 GATGCACGTGTGCAGGATGCTGG - Intronic
949940430 3:9150304-9150326 GAGGCAAGTGACCATCTGGCTGG + Intronic
950010250 3:9717987-9718009 GATCCAGATGATCATGAGGCTGG + Intronic
963851833 3:150217252-150217274 GAAGCACATGCCCATGAGGGAGG + Intergenic
970223400 4:13833079-13833101 GAGTCATGTGACCAGGAGGCTGG - Intergenic
974061303 4:57038424-57038446 GATGCAGGGGCCCTTGAGGCTGG + Intronic
974802603 4:66837807-66837829 GATCCATGTGGCCAGGAGGCAGG + Intergenic
975126555 4:70788826-70788848 GATGCAGATCAGCATGAGGCAGG + Exonic
977681169 4:99800295-99800317 GATGCATGTATCCATGAGGCAGG + Intergenic
981122018 4:141062869-141062891 GGTGCACATGACCATGAGGATGG - Intronic
982934436 4:161453704-161453726 GCTGCTCGTGAGGATGAGGCGGG - Intronic
984220898 4:176973226-176973248 TATGCACGTGTGCAGGAGGCTGG + Intergenic
985304918 4:188528952-188528974 GAAGCATGTGACCAGGAAGCAGG - Intergenic
994947640 5:106416312-106416334 GATGCAGATCAGCATGAGGCAGG - Intergenic
997423153 5:133785223-133785245 GCTGCACATGACCATCAGGAAGG - Intergenic
998527006 5:142851761-142851783 GGTGCACAAGACCATGTGGCTGG - Intronic
1002323590 5:178390349-178390371 GAGGCACATGGCCATGAGGCAGG + Intronic
1002571479 5:180142065-180142087 GATGCACGTGACAAAGGGGCTGG + Intronic
1006442967 6:34063415-34063437 GATGCAAGTGGCCAGGCGGCAGG + Intronic
1007004271 6:38345740-38345762 GATTCACGTGGCCAGGAGGGAGG - Intronic
1007736440 6:43985137-43985159 GTTGCAGGTGGCCATGAGGCAGG - Intergenic
1010554509 6:77262352-77262374 CATGCAGGTGACTATGATGCAGG + Intergenic
1016663713 6:146610854-146610876 CATGCACGTGCCCATGCTGCTGG + Intronic
1018415801 6:163601167-163601189 GAAGCCCATGAACATGAGGCGGG - Intergenic
1023515011 7:40993128-40993150 GATCCATATGACCAGGAGGCAGG - Intergenic
1025634891 7:63313498-63313520 GATGTGGGTGAGCATGAGGCAGG + Intergenic
1025647804 7:63434672-63434694 GATGTGGGTGAGCATGAGGCAGG - Intergenic
1034977592 7:155457488-155457510 GAGGCACGTGTCCAGGAGACCGG + Intergenic
1035426719 7:158783026-158783048 GAGGCACGTGTCCATGGGGAAGG - Intronic
1042835685 8:73077420-73077442 GACACAGGTGACCATGAAGCAGG + Intronic
1043266796 8:78276904-78276926 CATGCAAGTGACCATGATGATGG - Intergenic
1049659911 8:143815358-143815380 GATGCACTTGAGCATGGTGCGGG + Exonic
1055516510 9:77039207-77039229 GATGCCGGTGACGATGAGGAGGG + Intergenic
1056803267 9:89708702-89708724 AATGCAGGTGACCAGGAGCCGGG - Intergenic
1060709673 9:125846623-125846645 GATGGAGGTGACAATGGGGCAGG - Intronic
1062209572 9:135356439-135356461 GATTCACGTTGCCTTGAGGCTGG - Intergenic
1186361082 X:8842421-8842443 GATGGAAGGGACCATGAGCCAGG + Intergenic
1186500351 X:10045809-10045831 GATGCACGTGACCATGAGGCAGG - Intronic
1187382624 X:18818765-18818787 GATTCACGTTACTGTGAGGCTGG - Intronic
1188434780 X:30148142-30148164 GATGCCCGGGTCCATGAGGCTGG - Intergenic