ID: 1186501409

View in Genome Browser
Species Human (GRCh38)
Location X:10053611-10053633
Sequence TGGACATGGTTGAGGGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186501404_1186501409 17 Left 1186501404 X:10053571-10053593 CCTGGGAGGCTCATGGCAAGGTA 0: 1
1: 0
2: 1
3: 8
4: 115
Right 1186501409 X:10053611-10053633 TGGACATGGTTGAGGGCTAGAGG 0: 1
1: 0
2: 0
3: 15
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186501409 Original CRISPR TGGACATGGTTGAGGGCTAG AGG Intronic
900739639 1:4322877-4322899 TGGACATGGTTGAGGAATAACGG + Intergenic
902221784 1:14970797-14970819 TGGGCGTGGGTGAGTGCTAGAGG - Intronic
903217005 1:21848851-21848873 TGCAAATGGTGGAGGGCTGGGGG - Intronic
903262908 1:22140991-22141013 TGGACATGGGTGAAGGTGAGTGG + Intronic
903362779 1:22787359-22787381 TGGCCATGGCTAAGGGCTGGAGG + Intronic
905851674 1:41279465-41279487 AGGACATGGTTGGGGGTGAGGGG + Intergenic
906188492 1:43880149-43880171 TGTACTTGGCTGAGAGCTAGGGG + Intronic
906382667 1:45342647-45342669 AGGAAATGGTTGAGGGAAAGGGG + Intronic
908986498 1:70030097-70030119 AGGACAGAGTTGAGGGCTTGAGG - Intronic
914189838 1:145400059-145400081 TGGACATTGTTCAGGGACAGAGG + Intronic
914867300 1:151442328-151442350 TGGAAATGGAGGAAGGCTAGAGG - Intronic
916002866 1:160633478-160633500 TGGTCATGGTTGAGGGACAGGGG - Intronic
916079589 1:161224102-161224124 GGGACAGGGTTGAGGGCTATGGG + Intergenic
916847414 1:168666809-168666831 TGGTCAAGCCTGAGGGCTAGAGG + Intergenic
916894833 1:169151529-169151551 TGGACTTGGTTGAGGGCAGGAGG + Intronic
919274224 1:195391780-195391802 ATGACATGGTGGGGGGCTAGGGG - Intergenic
919793286 1:201305986-201306008 GGGAGATGGCTGAGGGCCAGTGG + Intronic
920503773 1:206501966-206501988 TGGCCAGGGTTGAGGGCTGGTGG - Intergenic
922763808 1:228147553-228147575 TGGGCAGGGTTGGGGGCTGGGGG + Intronic
922998446 1:229985403-229985425 TGAACATGGTGGAGGGGGAGGGG - Intergenic
1070720449 10:78753287-78753309 TAGACATGATTGAGGGTAAGGGG + Intergenic
1071586713 10:86830090-86830112 AGGAGCTGGTTGAGGGCCAGTGG + Intronic
1072225041 10:93361097-93361119 TGGACAGGGTTGTGGGGTAGAGG + Intronic
1072266313 10:93731368-93731390 TGGAGATGTTTGAGGGCCACAGG - Intergenic
1084408818 11:68994312-68994334 TGGACTTGGGAGAGGGCAAGTGG + Intergenic
1084636652 11:70397783-70397805 TCAGCATGGTAGAGGGCTAGTGG - Intergenic
1085041820 11:73331254-73331276 GAGACATGGGTAAGGGCTAGGGG - Intronic
1085463547 11:76709484-76709506 TGGACAGTGCTGAGGGCTGGGGG + Intergenic
1085503202 11:77040727-77040749 TGGACATGGTTGGAGGCCCGGGG - Exonic
1086348038 11:85917775-85917797 TGGAGATGTTTCAGTGCTAGAGG - Intronic
1086498894 11:87432063-87432085 AGAACAAGGTTGAGGCCTAGTGG - Intergenic
1087594323 11:100234649-100234671 TGGGGGTGGTTGGGGGCTAGGGG + Intronic
1087891488 11:103542453-103542475 TGGACATGGTTGGAGACTTGGGG - Intergenic
1090709071 11:129369840-129369862 ATGACATGGTTGAGGACTAGAGG + Intergenic
1091855003 12:3732356-3732378 TGGTCGTGGGTGAGGGCTGGGGG - Intronic
1093079118 12:14789021-14789043 TGGACCTGGGGGAGGGCCAGGGG + Exonic
1096242290 12:49965952-49965974 TTGACATGGCTGAGGGGGAGGGG - Intergenic
1096659938 12:53118187-53118209 AGGACCTGGATGCGGGCTAGGGG - Intronic
1096767094 12:53899993-53900015 TGGGCAGGGGTGAGGGCTGGAGG + Intergenic
1103221829 12:119252747-119252769 TGGGCATGGGTGAGAGCTGGAGG + Intergenic
1103912018 12:124357060-124357082 TGGGCTTGGTTGAGTGCTTGTGG - Intronic
1104192082 12:126491566-126491588 TGGCCCTGGTTGAGGGCTCCTGG + Intergenic
1108880602 13:55109457-55109479 TGGAAAGGGTGGAGGGATAGGGG + Intergenic
1109375215 13:61484444-61484466 TGGAGATGGCTGAGACCTAGAGG - Intergenic
1112624967 13:101093654-101093676 TGGACTAGGTTGAGTGCTATAGG + Intronic
1113834446 13:113319527-113319549 TGGGCACGGGTGAGGGCGAGGGG - Exonic
1115450623 14:33543222-33543244 TGAAAATGGGTGTGGGCTAGAGG - Intronic
1117106656 14:52404394-52404416 TGGACTGGGTTAAGTGCTAGTGG - Intergenic
1117378509 14:55137429-55137451 TCCACATGGTTGAGGGTTGGGGG + Intronic
1117586364 14:57211456-57211478 TGAACATAGTTGAAGGCCAGAGG + Intronic
1119879612 14:78090147-78090169 TGTGCAAGGTTCAGGGCTAGTGG + Intergenic
1119921868 14:78454253-78454275 TGGTGAAGGTTGAGAGCTAGTGG - Intronic
1121091045 14:91182844-91182866 TGTACATGGGAGAGGGCTGGTGG + Intronic
1122135774 14:99632017-99632039 TGGACATGGGGCAGGGCCAGTGG + Intergenic
1122318141 14:100837609-100837631 TGCACATGGCTGAGGACTAGAGG - Intergenic
1123096069 14:105767523-105767545 GGGACATTGTTGAGGACAAGTGG + Intergenic
1124681025 15:31730851-31730873 TGGACATGATGGAGGGATGGAGG + Intronic
1127356463 15:58205365-58205387 TGGGCATGGATGGGGGCTAGGGG + Intronic
1129910422 15:79221736-79221758 TAGACCTGCTTCAGGGCTAGAGG - Intergenic
1131272065 15:90953541-90953563 TGAACATGGTGGAGGCCTCGAGG + Exonic
1137440966 16:48498246-48498268 TGGACAAGCTTGAAGGCTACAGG - Intergenic
1141336794 16:83163521-83163543 TGGACATGGGTGAGTGCCAATGG - Intronic
1143498309 17:7324811-7324833 TGGTCATGGTGGAGGGCAACTGG + Exonic
1144081515 17:11768159-11768181 TGGAGATGGTTGAGGGAGGGAGG - Intronic
1147334030 17:39716203-39716225 TGGGCATGGCTGTGGGCTGGAGG - Intronic
1147615178 17:41823232-41823254 TGGACCAGGTTGAGGGGCAGGGG + Intergenic
1149563361 17:57625222-57625244 AGGGCATGGTTGGGGGCCAGAGG + Intronic
1149794399 17:59506111-59506133 TGTACAGGGTTGAGGGTGAGGGG - Intergenic
1149967673 17:61182404-61182426 TGAAGATGGGTGATGGCTAGTGG - Intronic
1150296350 17:64010045-64010067 AGGACATTGTGGAGGGCAAGAGG - Intronic
1151571170 17:74926210-74926232 TGGTCATGATAGAGGGCTGGGGG - Intronic
1154429886 18:14300379-14300401 TGGAAATGGTTAAGGCCTTGGGG + Intergenic
1156276149 18:35584647-35584669 TGGACCAGGTTGGGGGCCAGGGG + Intronic
1157332402 18:46713439-46713461 TGCACATGGCTGAGGCCCAGTGG + Intronic
1159912412 18:74158908-74158930 TGAAAATGGTTGAGGGCCATAGG + Exonic
1166321645 19:42022590-42022612 GGGACACAGTTGAGGCCTAGGGG - Intronic
1166389118 19:42399201-42399223 TGGACATGTTTGAATGCTGGAGG - Intergenic
1166658222 19:44627577-44627599 TGGACGGGGGTGAGGGATAGAGG - Intronic
1168337584 19:55605305-55605327 TGGGCGTGGTTCAGGGCCAGGGG + Intergenic
926825089 2:16898391-16898413 TAGAAATGGTTGAGGGGTGGGGG + Intergenic
928999577 2:37332866-37332888 CTGACATGGTTGAGTGTTAGAGG + Intergenic
932619309 2:73256453-73256475 TGGGCATGCATGAAGGCTAGGGG + Exonic
932870580 2:75394251-75394273 TGGCCATGGTGGAGGGATGGAGG - Intergenic
933849353 2:86353081-86353103 TGGACCAGGATGAGGGCTAAGGG - Intergenic
936252191 2:110875512-110875534 TGCACATGGGTGTGGGCTTGGGG + Intronic
943561971 2:189474505-189474527 TGGACCTGGTGTAGGGATAGGGG + Intronic
947581008 2:231318554-231318576 TGAACGTGGTAGAGGGCAAGTGG - Intronic
1169602849 20:7281692-7281714 TGACCATGGTTGAGGCCTAAAGG - Intergenic
1170445343 20:16421033-16421055 GGGTCATGGGTGAGGGCTAGGGG + Intronic
1171163863 20:22953499-22953521 TGGGCATGGGTAAGGGCCAGCGG + Intergenic
1175705436 20:61173192-61173214 TGGAGATGGTTGATGGATTGTGG - Intergenic
1175705439 20:61173212-61173234 TGGAGATGGTTGATGGATAGTGG - Intergenic
1175705448 20:61173272-61173294 TGGAGATGGTTGATGGATGGTGG - Intergenic
1178631349 21:34264061-34264083 TGGACATGGGTGAGGCTCAGTGG - Intergenic
1179874883 21:44262471-44262493 TGGAGATGGGTGAGGATTAGTGG + Intergenic
1180858945 22:19066011-19066033 TGGCCATGCTTAGGGGCTAGGGG - Intronic
1182054299 22:27337916-27337938 AGGACTTGGAGGAGGGCTAGTGG - Intergenic
1182086030 22:27561768-27561790 TGGAGATGGAGGAGGGCCAGTGG - Intergenic
1183951333 22:41354729-41354751 GGGACAGGGTTGGGGGCCAGAGG - Intronic
950225448 3:11229961-11229983 TTGACATGGGTGGGGACTAGAGG + Intronic
954229210 3:49203348-49203370 TGGGAATGGTGGAGGGCTATGGG + Intronic
954639354 3:52088872-52088894 TGGAGATGGGGGAGGGCTGGGGG - Intronic
955228705 3:57080658-57080680 GGGAAAAGGTTGAGGACTAGGGG - Intergenic
961981325 3:131082072-131082094 TGGACAGGGTGGAGGGTGAGTGG + Intronic
961994911 3:131232294-131232316 TGGACATGGCTTAGGGCTACAGG + Intronic
962330231 3:134471831-134471853 TGGGCATGGTGGAGGGGAAGAGG + Intergenic
964433059 3:156625209-156625231 TGGACATGGTTGGAGACTTGGGG + Intergenic
968170940 3:196509873-196509895 AGGACAAGGATGATGGCTAGAGG - Intronic
980754618 4:137141363-137141385 TGGATAGGGATGAGGGCTTGTGG + Intergenic
981855083 4:149279760-149279782 TGGACTTGAATGAGGGCAAGTGG - Intergenic
984476554 4:180242593-180242615 TGGATATGGGTGAGAGCCAGAGG + Intergenic
987004164 5:13692367-13692389 TGTCCATGGTTCAGGGCAAGGGG - Intronic
997399755 5:133593219-133593241 TGGACAAGTTTCAGGGCCAGGGG - Intronic
997668507 5:135651295-135651317 AGGACATGGTTGAGAGGGAGGGG - Intergenic
1001037746 5:168309810-168309832 AGGAGGTGGTTGAGGGCTTGGGG - Intronic
1002973155 6:2045851-2045873 TAGACATGGATGAAGGCTACGGG + Intronic
1003076572 6:2988360-2988382 TGGCCACGGTTGAGGGGCAGTGG + Intronic
1003114456 6:3274187-3274209 TGGAGAGGTTTGAGGGATAGGGG - Intronic
1004554259 6:16680327-16680349 AGGACATGTTTGGGGGGTAGGGG - Intronic
1006361149 6:33588090-33588112 TGGACATGCATGCGGGCTTGGGG - Intergenic
1006503798 6:34475221-34475243 TGGGCAGGGGTGAGGGGTAGGGG - Intronic
1006880534 6:37335229-37335251 TGGCCATGGTTGTGGGCCTGTGG - Intergenic
1007177473 6:39906700-39906722 TGGACAAGCTTGAAGGCTACCGG + Exonic
1009306180 6:62092147-62092169 TGGAAATGGTAGAGAGCTGGTGG - Intronic
1013044527 6:106471091-106471113 TTGGCATGTTTGAGGGCTGGAGG + Intergenic
1015438114 6:133214351-133214373 TTGACATGGTTGATGACTAGTGG + Intergenic
1015782187 6:136880242-136880264 TGGACAGGGTTGATGGTTTGAGG + Intronic
1019143712 6:169963442-169963464 TGGACAAGGTCGAGGGGTTGCGG - Intergenic
1020034162 7:4953996-4954018 TGGGCATGGTTGTGTGCTTGCGG - Intronic
1020066136 7:5190076-5190098 TGGGCCTGGCTGAGGGCGAGCGG - Intergenic
1023456682 7:40347071-40347093 TGGAACTGGTTGATGGGTAGAGG + Intronic
1025621192 7:63172809-63172831 TTCACAGGGTGGAGGGCTAGGGG - Intergenic
1027132938 7:75604294-75604316 TGGACATGGTTAAGTTCCAGGGG + Intronic
1027166698 7:75839635-75839657 TGGAGGTGGTTGATGGCTGGGGG + Intergenic
1029502439 7:100940761-100940783 TGGACTTTGTTGGGGGCTGGCGG - Intergenic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1035565216 8:636573-636595 TGGACAGGGCTGAGGGTAAGTGG - Intronic
1036059191 8:5295910-5295932 TGGACATGGTAGGGAGCTAGAGG + Intergenic
1037935249 8:22911215-22911237 TGGCCATGATTGGGGTCTAGTGG + Intronic
1040673130 8:49716260-49716282 TATACTTGGATGAGGGCTAGTGG - Intergenic
1041707878 8:60865598-60865620 AGGAAAGGGTTGAAGGCTAGCGG - Exonic
1041767202 8:61431562-61431584 TGAACAAGGTAGAAGGCTAGAGG - Intronic
1041792134 8:61708880-61708902 TTGACTTGGTTGAGGGGTGGGGG - Intronic
1043958086 8:86385627-86385649 AGGACATGGTTTAGTGATAGTGG + Intronic
1045570649 8:103365939-103365961 TTGTCAGGGTTGGGGGCTAGGGG - Intergenic
1049203017 8:141351006-141351028 GGGACATGGCTGAGGTCTCGGGG + Intergenic
1049831547 8:144704435-144704457 TGGACAGGGCTGTGGGCCAGAGG + Intergenic
1050728634 9:8681646-8681668 TGCACATCGTTCAGGGCTGGCGG - Intronic
1056828363 9:89892127-89892149 GGGACAGGGTTGGGGGCTTGGGG - Intergenic
1060255085 9:122020322-122020344 TGGACAGGGCTGAGGGCAAATGG - Intronic
1186501409 X:10053611-10053633 TGGACATGGTTGAGGGCTAGAGG + Intronic
1187507537 X:19888769-19888791 TGGAGGAGGCTGAGGGCTAGTGG + Intergenic
1193097042 X:77562032-77562054 TTGACAGGGTTTAGGGTTAGGGG - Intronic
1196975595 X:121154542-121154564 TGGGGATGGTTGTGGGCTTGTGG + Intergenic
1197905053 X:131415785-131415807 TGGACAAGGTTGGGGGCAGGGGG - Intergenic
1199466377 X:148142120-148142142 TGGACAGGGTTGGGGGATGGGGG + Intergenic
1200732909 Y:6761580-6761602 TGCACATGTTTGAGGGCTAAGGG + Intergenic