ID: 1186503219

View in Genome Browser
Species Human (GRCh38)
Location X:10068703-10068725
Sequence CTGCAGAGATGGAGATAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 443}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186503219_1186503223 -1 Left 1186503219 X:10068703-10068725 CCATCTTATCTCCATCTCTGCAG 0: 1
1: 0
2: 5
3: 28
4: 443
Right 1186503223 X:10068725-10068747 GATAGTGGCACATACCTGGTTGG 0: 1
1: 1
2: 1
3: 10
4: 124
1186503219_1186503225 11 Left 1186503219 X:10068703-10068725 CCATCTTATCTCCATCTCTGCAG 0: 1
1: 0
2: 5
3: 28
4: 443
Right 1186503225 X:10068737-10068759 TACCTGGTTGGTTTTTTTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 288
1186503219_1186503224 10 Left 1186503219 X:10068703-10068725 CCATCTTATCTCCATCTCTGCAG 0: 1
1: 0
2: 5
3: 28
4: 443
Right 1186503224 X:10068736-10068758 ATACCTGGTTGGTTTTTTTGAGG 0: 1
1: 0
2: 5
3: 13
4: 262
1186503219_1186503222 -5 Left 1186503219 X:10068703-10068725 CCATCTTATCTCCATCTCTGCAG 0: 1
1: 0
2: 5
3: 28
4: 443
Right 1186503222 X:10068721-10068743 TGCAGATAGTGGCACATACCTGG 0: 1
1: 0
2: 1
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186503219 Original CRISPR CTGCAGAGATGGAGATAAGA TGG (reversed) Intronic
900638218 1:3675960-3675982 CTGGAGAGATAGGGATGAGATGG + Intronic
901096415 1:6683852-6683874 ATGCAGAGATGGAAATATGGAGG - Intronic
902908104 1:19574214-19574236 CTGCAGACAGGGAGAGATGAAGG - Intergenic
903578929 1:24356765-24356787 CTGCAGTGATGGAGTTAGGGAGG - Intronic
903670243 1:25031156-25031178 CTGGAGAGATGGAGACTGGAGGG + Intergenic
903670272 1:25031262-25031284 CTGGAGGGATGGAGACTAGAGGG + Intergenic
904310737 1:29628001-29628023 GTGCAGAGATGCAGATGGGAAGG + Intergenic
904437711 1:30509528-30509550 CTGCAGGGAGGGAGACCAGATGG + Intergenic
905061725 1:35145491-35145513 CAGCAGACATGGAGTTAAAAAGG - Intergenic
905218305 1:36426000-36426022 CTTCAGAGATGGAGATGAGCAGG + Intronic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
905541683 1:38765088-38765110 ATGGAAGGATGGAGATAAGAGGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
907445658 1:54506246-54506268 CTGCAGAGAGGCAAATAAAAGGG - Intergenic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
908170122 1:61496021-61496043 ATGCAGAGATGGAGAAATGGAGG + Intergenic
909359770 1:74746686-74746708 GTGCTGTGAAGGAGATAAGAAGG + Intronic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
909867899 1:80697255-80697277 CTGCAGAGAGGGACGCAAGAAGG + Intergenic
910711808 1:90189892-90189914 CTGCAGAGAGGGAAAGAGGAGGG - Intergenic
910830441 1:91455785-91455807 CAGCAGTGGTGGAGAAAAGAGGG - Intergenic
911119003 1:94276343-94276365 CTGCAGAGATATTAATAAGATGG + Intergenic
911397904 1:97335190-97335212 CTGCAGCCATGGAAAGAAGAGGG - Intronic
912095735 1:106140700-106140722 CTGGAGAGATAGATATCAGAAGG + Intergenic
912856349 1:113171566-113171588 CTGCAGACCTGGAGACTAGATGG + Intergenic
913204894 1:116529317-116529339 CCGCAGATAAGGAGATAAGGAGG + Intronic
913239535 1:116817935-116817957 CTGCAGAGATGGAGCCCAGCTGG + Intergenic
913253926 1:116937421-116937443 CTGCAGTAATGCAGATGAGACGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
915148546 1:153810385-153810407 CTGCAGAGTTGGAGATGGAAAGG + Intronic
915236531 1:154487481-154487503 CTGGAGAGAAGGAGATGAAATGG + Intronic
915245022 1:154550621-154550643 CTGCATACCTGGAGATGAGAAGG + Intronic
915669060 1:157472123-157472145 CTGCAGAGAGGCAGAGAGGAAGG + Intergenic
916016000 1:160750402-160750424 CTGAAGAGAGAGAGACAAGAAGG + Exonic
916179043 1:162068907-162068929 CTGCCAAGATGGAGATAATTAGG + Intergenic
916794584 1:168154008-168154030 CATCAGACATGGAGAAAAGAGGG - Intergenic
916849611 1:168690206-168690228 CTGCAGAGGAGGAGAAAAAACGG - Intergenic
917980260 1:180264866-180264888 CTTCTGAGATGGGTATAAGAAGG - Intronic
918208978 1:182334114-182334136 CTGTAGTGATGGAAACAAGAAGG - Intergenic
918302535 1:183217002-183217024 CAGTAGAGAGGGAGCTAAGAAGG + Intronic
919614273 1:199785734-199785756 CTGTAGAGATGGGGATTGGAGGG + Intergenic
919899789 1:202035205-202035227 GAGCAGTGATGCAGATAAGAGGG - Intergenic
919910341 1:202107106-202107128 TTGTACAGATGGGGATAAGAGGG - Intergenic
920052870 1:203174095-203174117 CTGGAGAGATTGAGATTAGATGG + Intronic
921902259 1:220463305-220463327 CTGCAGGGATGGGGATGAGGGGG - Intergenic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923808406 1:237286169-237286191 CTGCAAAGGTGGTGCTAAGAGGG - Intronic
1063138698 10:3238375-3238397 CTGCAGAGAAGGAGATGTGGGGG + Intergenic
1063991914 10:11575470-11575492 CTGCAAGGAAGGAGATAAGCAGG + Intronic
1064680461 10:17806512-17806534 CAGCAGAGAAAGAGAGAAGAAGG - Intergenic
1064841047 10:19592384-19592406 CTGGTGAGTTGGAGATAAGATGG - Intronic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1066244956 10:33573781-33573803 CTGCAGAGGTGGAAACAGGACGG + Intergenic
1067178572 10:43968169-43968191 CTGAAGAGATGCAGGTAAGGAGG - Intergenic
1067224256 10:44365081-44365103 TTGCAGAAATGGGGATAAGCAGG + Intergenic
1070153153 10:73817712-73817734 CTGCAGAGAGGGAGACGGGAGGG - Intronic
1070278366 10:75029728-75029750 CTGCAGAGATGGCACTGAGATGG - Exonic
1070473455 10:76808697-76808719 ATGCAGACATGGAGAAAACAGGG - Intergenic
1070515173 10:77198419-77198441 ATGCTGAGATGAAGAAAAGATGG - Intronic
1071098660 10:82009996-82010018 CTGGAGAAGTGGAGATAACAAGG + Intronic
1071242022 10:83717722-83717744 CTGAAGAGAAGGAGACATGAGGG - Intergenic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1074176365 10:111008208-111008230 CTGAAGAGGTGAAAATAAGATGG - Intronic
1075710182 10:124526646-124526668 CTGCTGAGCTGGACATAAGCAGG + Intronic
1076549636 10:131270096-131270118 GTGCAGAGAAGGACATAGGAAGG - Intronic
1076943690 10:133627828-133627850 CAGCAGAGGGGGAGACAAGAAGG - Intergenic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1079154338 11:17930504-17930526 CTGCAGCCATGGGGAGAAGATGG + Intronic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081199879 11:40202861-40202883 CTGCAGAGCAGGACAGAAGAGGG + Intronic
1081931850 11:46876991-46877013 TGGCAGAGACGGAGAGAAGAGGG + Intronic
1082800818 11:57413724-57413746 CTGGAGAGAGAGAGGTAAGAAGG - Intronic
1083090606 11:60195722-60195744 CTTCAGAGCTGGAGGTAAGGTGG + Intergenic
1083207397 11:61161096-61161118 CTGCAGAGACGCAGAAAGGAGGG + Intronic
1085406468 11:76266046-76266068 CTGCAGAGAGGAGGAGAAGAGGG + Intergenic
1086092575 11:83019619-83019641 GTTCAGAGATGGAGAGATGAGGG - Intronic
1086418540 11:86614460-86614482 CTGCTCAGATGGAGCAAAGAGGG - Intronic
1087015616 11:93551845-93551867 GTGCAGAGATGGAAAGAAAATGG + Intergenic
1087114799 11:94513490-94513512 CTCCAGAGATGCAGTCAAGAAGG - Intergenic
1087220634 11:95542965-95542987 ATGCAGGGGTGGAGATATGAGGG - Intergenic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088428455 11:109730757-109730779 CTGCAGAGTTTTGGATAAGAAGG + Intergenic
1089754724 11:120678226-120678248 CAGCAGAGGTGGGGACAAGAAGG - Intronic
1090025248 11:123162030-123162052 ATGCAGAGATGCAGAGAACATGG + Intronic
1090366215 11:126208494-126208516 CTGCACAGATGGGGAATAGAGGG + Intronic
1090441762 11:126730298-126730320 GTGCAGAGATGATGAGAAGAGGG - Intronic
1092094656 12:5831672-5831694 CAGCAGAGATGGATAGGAGATGG + Intronic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1093030414 12:14283515-14283537 CTGGAGAAATGAAGGTAAGAGGG + Intergenic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1095053723 12:37576864-37576886 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1096185384 12:49577058-49577080 CTGCAGGGTTGGGGATGAGAAGG + Intronic
1096609494 12:52791542-52791564 CTCCACAAATGGAGACAAGATGG - Intronic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097481849 12:60137194-60137216 GTGAAGAGATGGGGAAAAGATGG - Intergenic
1098237513 12:68431718-68431740 CTGCAGAGAAGGAGAGAGGGAGG - Intergenic
1098797052 12:74902918-74902940 GTGCAGGGATGCAGATGAGAGGG - Intergenic
1101306638 12:103534987-103535009 CTCCATAGATTGAGATAATAAGG - Intergenic
1102716814 12:114980927-114980949 AAGCAGAGATGGAGATGAAATGG + Intergenic
1102767168 12:115443500-115443522 CTGCAGATCTGTAGATAACATGG - Intergenic
1102792023 12:115654742-115654764 CTAAAGAGATGGAGAGAATAAGG + Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103056471 12:117825238-117825260 GTACACAGATGGACATAAGATGG + Intronic
1103185918 12:118957176-118957198 CTGCAGAGATGGAAAAAACTAGG + Intergenic
1104379777 12:128297209-128297231 CTGCAGTGAAGGGGATAATATGG + Intronic
1105494942 13:20922136-20922158 ATGGAGAGATGGAGATAATTGGG + Intergenic
1108752368 13:53461338-53461360 CCCCAGAGATGGAGTTTAGAAGG + Intergenic
1108821013 13:54349736-54349758 CTGCAGAGAATTTGATAAGAAGG - Intergenic
1112015501 13:95328062-95328084 CAGCAGAGATGGAAACAATACGG + Intergenic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112191798 13:97185536-97185558 CTGATAAGAGGGAGATAAGAGGG + Intergenic
1112379458 13:98874933-98874955 CTGGATAGATTGAGATTAGAGGG - Intronic
1112397989 13:99050966-99050988 CTGCACAGGTGGACGTAAGAAGG + Intronic
1112578850 13:100660972-100660994 CTGCAGGGTAGGAGATAACAGGG + Intronic
1113079944 13:106508463-106508485 ATGCAAAGATGGAGATATTATGG - Intronic
1113239660 13:108322725-108322747 CTGTAGAGAGGGAGGTTAGAGGG + Intergenic
1113849300 13:113408948-113408970 TTGCAGAGAGGGAGGAAAGAGGG + Intergenic
1114402067 14:22419227-22419249 CTGGAGAGATGGAGATTATGGGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115632354 14:35257810-35257832 CTGCAGAGGAGGAGGTAAAAAGG + Intronic
1115803601 14:37024843-37024865 CTTCAGAAATGGAGAAAAAAAGG + Intronic
1117081540 14:52157114-52157136 CTGCAGAGATGGTGATGAGATGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117538915 14:56727714-56727736 CTGCAGATATGGAAATAAGAAGG + Intronic
1118508717 14:66445847-66445869 CTGCAGAGAGGGAGAGAGAAAGG - Intergenic
1119195193 14:72712503-72712525 CTGCAGAGATAGAGCAAAAAGGG + Intronic
1121149228 14:91615454-91615476 TTACAGAGCTGGAGGTAAGAAGG - Intronic
1122306142 14:100768046-100768068 TTGCAGAGATGCAGGCAAGAAGG + Intergenic
1125279078 15:38025440-38025462 CTTGAAAGATGGAGAGAAGAAGG - Intergenic
1125817232 15:42596611-42596633 CTACAGAAATGGGGTTAAGAGGG - Intronic
1126132275 15:45353289-45353311 TTGCGGAGATGGGGAGAAGAGGG + Intergenic
1127698392 15:61473726-61473748 CTTCAGAGAGGGAGGTAAGGGGG + Intergenic
1128131067 15:65227530-65227552 GTGCAGTGAAGGAGATAAAAAGG - Intergenic
1128904533 15:71455150-71455172 CTGCAGAGCAGGAGAAATGAGGG + Intronic
1128949969 15:71868507-71868529 CTTCACAGATGGAATTAAGATGG - Intronic
1128953545 15:71914146-71914168 TTGAAGAGATGGAGATAGAAAGG - Intronic
1129652179 15:77498831-77498853 GTGGAGAGATGGAGATCCGAAGG - Intergenic
1129744266 15:78007347-78007369 CTGCAGTGATGGAGACAGGCCGG + Intronic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130368172 15:83259540-83259562 GGGCAGAGTTGGAGTTAAGAAGG - Intronic
1130675970 15:85952278-85952300 CTTCAGAGATGAAGAAAACAGGG - Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1131662993 15:94538677-94538699 ATGCAGAGAATGAGATAAGGAGG + Intergenic
1133637358 16:7680871-7680893 GTGCAGAGAGGAAGATAATATGG - Intronic
1133693531 16:8238646-8238668 ATGCAGAGTTGGATATACGATGG + Intergenic
1135503672 16:23018209-23018231 CTGCTGACAAGGAGATGAGAGGG + Intergenic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1138131269 16:54482106-54482128 CTGCACAGCTGGACATATGACGG + Intergenic
1138149028 16:54637907-54637929 AGGCAGAGCTGGAGATAGGAGGG + Intergenic
1138521568 16:57574375-57574397 CTGCAGAGATGGTGATGAGGTGG + Intronic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1140161336 16:72497697-72497719 CTACAGAGATACAGATAATAGGG + Intergenic
1140259288 16:73363441-73363463 GTGAGGAGATGGAGATAAAATGG - Intergenic
1140962268 16:79927696-79927718 CTGCAGAGGTGTAGGCAAGAGGG - Intergenic
1141660163 16:85437175-85437197 CCGCAGGGAGGGAGATCAGATGG - Intergenic
1141848385 16:86626811-86626833 CTGCAGATGTGGGGAGAAGAGGG - Intergenic
1142027879 16:87824177-87824199 CTGCAGAGATGGTGAGATGGTGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143627391 17:8118323-8118345 ATGCTGAGATGGAGAAAAGGAGG + Intronic
1144850595 17:18242143-18242165 CTGCAGAGATGGGGCCATGATGG - Intronic
1144867314 17:18344967-18344989 CTGCAGAGTTGGAGGTTAGGGGG - Intronic
1145374255 17:22332896-22332918 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1145916330 17:28576174-28576196 CTGCAGTGATGTAGGAAAGAGGG + Intronic
1146300266 17:31683315-31683337 TTGCAGAGAGGGAGAAAAGGGGG + Intergenic
1146529624 17:33597260-33597282 CTGCAGGGAAGGAGACATGATGG + Intronic
1147516719 17:41124840-41124862 CTTCAGAGATGGGGATCATAAGG + Intergenic
1148806478 17:50266557-50266579 CAGCAGGGATGGGGATGAGATGG - Intergenic
1149507962 17:57211629-57211651 CTCCAGAGACGGAGACAAAAAGG - Intergenic
1149827059 17:59838303-59838325 CTGCAGAGATGGACCTATGCCGG - Exonic
1150213454 17:63454116-63454138 GTGCAGAGAAGGAGAGAAGTGGG - Intergenic
1151162407 17:72176462-72176484 CTGCACAGTTGGAGAGAAGCAGG - Intergenic
1151260364 17:72911472-72911494 CTACAGAGATGCAGATGTGAGGG - Intronic
1151967826 17:77440861-77440883 CTGCAGGCATGGAGATCAGCAGG - Intronic
1152756189 17:82088043-82088065 CGGGAGAGTTGGAGATCAGAGGG + Intronic
1153460071 18:5323308-5323330 CTACAGAAAAGGAGTTAAGAGGG - Intergenic
1155049709 18:22135925-22135947 CAGCAGAGATAGAGATGGGATGG + Intergenic
1156196887 18:34784467-34784489 GTGCATAGATGGGGATAAGGAGG - Intronic
1156635504 18:39023597-39023619 TTGCACAGATGGAGAGGAGAAGG + Intergenic
1157131144 18:45008524-45008546 TTGCAGAGATGGAAAGAAAAAGG + Intronic
1157268308 18:46248402-46248424 CAACAGAGTTGGGGATAAGATGG + Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1158300434 18:56046284-56046306 GTGCAGAGGTGGTGAGAAGAAGG - Intergenic
1159296759 18:66500387-66500409 TTGCACAGATGGAGGTGAGAGGG - Intergenic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159697051 18:71573579-71573601 GTACAGAGATTCAGATAAGATGG + Intergenic
1159828031 18:73239021-73239043 AGGCAGAGAAGGAGATAAAATGG - Intronic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1160702741 19:516139-516161 CTGCAGGGAGGGAGACCAGAGGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161443060 19:4303442-4303464 CTGGGGAGATGGAGATTACAGGG + Intergenic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1162184860 19:8897022-8897044 CTTCAGCAAAGGAGATAAGAGGG - Intronic
1162188158 19:8923062-8923084 CTGCAAGGAAGGAGAAAAGAAGG + Intronic
1162948770 19:14058462-14058484 GTGCAGAGATGGGGATCAAAAGG + Intronic
1164321866 19:24155796-24155818 CTGCAAAGATGGATATAATATGG - Intergenic
1164906832 19:31974690-31974712 CTACAGAGATGGACATAGCATGG + Intergenic
1165759500 19:38312492-38312514 CTACTGAGATGGAGAAAATAGGG + Intronic
1165863303 19:38920372-38920394 AGGCAGAGAGGGAAATAAGAGGG + Intronic
1166230156 19:41421849-41421871 GTGCAGAGGAGGAGGTAAGAGGG + Intronic
1167232901 19:48296692-48296714 GGGCAGATATGGAGACAAGACGG + Exonic
1167250840 19:48397703-48397725 CAGCAGAGACGGGGAGAAGACGG - Intronic
1167294865 19:48644224-48644246 CTGCAGAGATGGGGAGACTAGGG + Intronic
1168463155 19:56578661-56578683 CTGCAGAAATCCAGATGAGATGG - Exonic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
925487081 2:4347432-4347454 CTGCAAAGATGGAGATGCCATGG - Intergenic
925744851 2:7035055-7035077 TTGCAGAGATGAAGATGACAAGG - Intronic
925885045 2:8388177-8388199 GTGCAGAAATGGAGAAAACAAGG + Intergenic
926138578 2:10354963-10354985 CTGCAGAGATGAAGATGAGGAGG + Intronic
928450557 2:31374711-31374733 CTGCAGAGATGGAGTGTGGAGGG - Intronic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930996430 2:57724383-57724405 TTGCAGAGCTTGAGAGAAGAGGG - Intergenic
931061005 2:58529933-58529955 ATGAAGAGATGAAGAGAAGAAGG + Intergenic
931197843 2:60069738-60069760 ATGCAGACCTGGAGATGAGATGG + Intergenic
932120096 2:69090761-69090783 CTACTGAGATAGAGATAGGAAGG - Intronic
932809768 2:74815044-74815066 CTGTAGAGAGGGAGAAAAGCGGG - Intergenic
932833007 2:75008687-75008709 CTGAAGAGATGGAGAGAAACAGG - Intergenic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933548553 2:83744434-83744456 CAGCAGACATGGAGATATGGTGG - Intergenic
934027141 2:88010583-88010605 CTGCAGAGGGTGAGATATGAGGG + Intergenic
935718009 2:105955402-105955424 CTGCAGAGAGGGAGCTGAGCAGG - Intergenic
935875551 2:107502975-107502997 CTGGAGAGCAGGAGATAATAGGG + Intergenic
936712007 2:115142445-115142467 CCCCAGGGATGGAGATCAGATGG + Intronic
939468712 2:142591818-142591840 CTTCACATATGGACATAAGAGGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939991059 2:148876628-148876650 CTGCAGAGAGGGAGCTAAGTAGG - Intronic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940910317 2:159204490-159204512 CTGCAGAGAGGGAGATGTTATGG - Intronic
941295648 2:163736141-163736163 CTGCCGTGAGGGAGAGAAGACGG + Intergenic
941563384 2:167077551-167077573 CTGCAGAGATGGGTGGAAGATGG + Intronic
941884817 2:170516963-170516985 TTGGAGAAATGGAGATATGAAGG - Intronic
942033071 2:171982420-171982442 CAGCAGAGATGGAGAGGACAGGG - Intronic
946127165 2:217572977-217572999 CTGATGAGATGGAATTAAGAAGG + Intronic
946243308 2:218370210-218370232 CTGCAGTGATGGAGAGTTGAGGG + Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
1168948400 20:1780195-1780217 CTGCATAGATGGAGAATACAGGG + Intergenic
1169146397 20:3255285-3255307 CTGCAGAGATGGGGAGTGGAGGG + Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1169863267 20:10173489-10173511 CTGCAAATATGGGGATGAGATGG - Intergenic
1170066096 20:12312190-12312212 CTGAAGAGATGGACATAGAAAGG - Intergenic
1170124745 20:12950391-12950413 CTGGACAGATGGAGGTGAGATGG - Intergenic
1170166597 20:13365976-13365998 TTGCAGAGATGAGGAAAAGACGG + Intergenic
1170248337 20:14249432-14249454 TGGCAGGGATGGAGAAAAGAGGG + Intronic
1170641962 20:18162369-18162391 CTGCACAGATGACGATGAGATGG + Exonic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170694365 20:18645303-18645325 CTGCAGAAATGGAAACAAGGAGG + Intronic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1171082717 20:22204329-22204351 AGGCAGAGATGGAGGTAAGCTGG - Intergenic
1172261287 20:33568043-33568065 TTGGACAGATGGAGAGAAGACGG + Intronic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1173200454 20:40950975-40950997 GGGCAGAGTTGGAGATGAGAGGG - Intergenic
1173614550 20:44394324-44394346 ATGGGGAGATGGAGATCAGAGGG - Intronic
1174797693 20:53536157-53536179 CTGCAGAGAAGGACGGAAGAAGG - Intergenic
1174921011 20:54702100-54702122 CTGCAGAGTCTGTGATAAGATGG - Intergenic
1176192071 20:63816282-63816304 GAGCAGAGATGGAGCCAAGAGGG - Intronic
1176222534 20:63976821-63976843 CTGCGGAGATGAAGAACAGAGGG + Intronic
1177865013 21:26501769-26501791 CTTCAGAGAGGTAGATAAGTGGG - Intronic
1178127505 21:29530896-29530918 CTGGAGAGATGGAGGTGGGAAGG + Intronic
1178384599 21:32138875-32138897 CTGCTGAGATGGGGAGAAGTGGG + Intergenic
1178404489 21:32313028-32313050 CTCCAGAGATGCAGAAAAGAAGG + Exonic
1178867000 21:36336549-36336571 CTGCAGAGATGATTAAAAGATGG - Intronic
1179838955 21:44057947-44057969 GTGCAGTAATGGAGATCAGAAGG + Intronic
1180247191 21:46555856-46555878 CTGCAGAGAGTGAGCTCAGACGG - Intronic
1180616779 22:17133606-17133628 CTGCAGAACTGGAGGTCAGAAGG + Intergenic
1181570468 22:23765514-23765536 ATGCAGAGGTAGAGACAAGAAGG + Intronic
1182079479 22:27518804-27518826 CACAAGAGATGGAGATAAGGAGG - Intergenic
1184241550 22:43213528-43213550 CTTCACAGATGGAGTTAAGTGGG + Intronic
1184282402 22:43445524-43445546 CAGCAAAGATATAGATAAGATGG - Intronic
949940459 3:9150470-9150492 ATGCACAGATGGAGAAAGGAAGG + Intronic
950507840 3:13406765-13406787 CTGCTGAGGTGCAGAGAAGAAGG - Intronic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
950936109 3:16841178-16841200 ATGCAGATAAGCAGATAAGAGGG - Intronic
951468496 3:23029567-23029589 CTGCTCAGAAGGAGATAAGCAGG - Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952844225 3:37673516-37673538 CTGCCAAGAGGGAGCTAAGACGG - Intronic
954225305 3:49177338-49177360 CTGTAGAGAGGAAGATTAGAGGG - Intergenic
954372018 3:50174029-50174051 CTGCAGAGAGGGGGGTCAGAAGG - Intronic
954938949 3:54353423-54353445 CAGCAGATATGGGTATAAGAAGG + Intronic
955073171 3:55588753-55588775 ATCCAGAGATGCTGATAAGATGG + Intronic
955362008 3:58283701-58283723 ATGCAGAGATGGAGGTTGGATGG + Intronic
955474315 3:59320168-59320190 GTGCAGAGATTGAGAGAATAGGG - Intergenic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
957001928 3:74897158-74897180 CTGCATAGATTAAGACAAGAGGG + Intergenic
957083948 3:75663298-75663320 CAGCAGAGGGGGAGAGAAGAAGG + Intergenic
958177589 3:90016235-90016257 CTGCAGAGCTGGGGAGAAGCGGG + Intergenic
958600866 3:96295025-96295047 CTGGAGATTTGAAGATAAGATGG + Intergenic
958634126 3:96721004-96721026 CTTCAGAGATGGAGAAAGGTAGG + Intergenic
958985705 3:100777283-100777305 CTGGAGAGAGGGAGGAAAGATGG + Intronic
960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG + Intergenic
961682419 3:128608111-128608133 CTGCAGAGACCGAGATACGCGGG + Intergenic
962241719 3:133755831-133755853 CTGCTGAGATTGAGGGAAGAGGG - Intronic
962454410 3:135551989-135552011 CTGTAGAGATGGACATAAACAGG - Intergenic
962732826 3:138299256-138299278 CTGCAGAGATAGAGAAAAGGTGG - Intronic
962940605 3:140121535-140121557 TTGCAGAGATGCAGAGAAAAGGG + Intronic
963888198 3:150603838-150603860 CTGCGGAGATGGGGATGAGTAGG + Intronic
963913243 3:150833127-150833149 CTACAGAGATGAACATAAGGAGG + Intergenic
964191470 3:154006694-154006716 AAGCAGAGAAGGAGATAAAAGGG + Intergenic
964682518 3:159358158-159358180 CTAAAGAGAGGGAGGTAAGAAGG + Intronic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
966024774 3:175263739-175263761 ATGGAGAGATGAAGAAAAGAAGG + Intronic
967143374 3:186583512-186583534 CTGTAGAAATGCAGATAAAATGG - Intronic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
973727621 4:53791876-53791898 CTGCAGAAATGGCGACAACAGGG - Intronic
974883066 4:67783382-67783404 CTGAAAAGAGGGAGATAAGAAGG - Intergenic
975910513 4:79260587-79260609 CAGCAGAGATGGAAATCAGCTGG - Intronic
976085557 4:81403850-81403872 CTGCAGAGATGGAATTGAGTGGG + Intergenic
977529868 4:98188361-98188383 CTGCAAAGATGAAGGTAAAATGG - Intergenic
977660406 4:99579011-99579033 CAGAAGACATAGAGATAAGAGGG + Intronic
978563262 4:110055548-110055570 CTGCAAAGGTGTAGTTAAGAAGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
978957652 4:114634059-114634081 CTGCAGAGATGGTGAGAAGTGGG + Intronic
979627099 4:122857349-122857371 CTTCAGAGATAGAGAGAAAAGGG - Intronic
980463395 4:133146983-133147005 TTCCAGAGGTGGAGATGAGATGG - Intergenic
982435812 4:155383025-155383047 CTGCAGAGAGGGAGAGGAGGAGG - Intergenic
984227099 4:177048220-177048242 ATGAAGAGATGGACACAAGAGGG - Intergenic
984868547 4:184306907-184306929 CTGTAAAAATGGAGATAATATGG + Intergenic
985124799 4:186682777-186682799 CTGATGACATGGAGAAAAGAAGG - Intronic
985164418 4:187077731-187077753 CTGCATAGGTGGAGAGAAGCTGG + Intergenic
985447045 4:190028290-190028312 CAGCAGAGGGGGAGACAAGAAGG - Intergenic
985857886 5:2444641-2444663 ATGAAAAGATGGAGACAAGAGGG - Intergenic
985868161 5:2532801-2532823 CTGCAGAGAGGGTGATGGGAAGG - Intergenic
986238735 5:5937710-5937732 CTGCTGAGGTGGAGAATAGAGGG + Intergenic
986801003 5:11260126-11260148 GTGAAGTGATGGAGATAGGAAGG + Intronic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
989478506 5:41901841-41901863 CTGGAGAGATTGAGCAAAGATGG + Intergenic
990630963 5:57668283-57668305 CTGCAGAAATGGAGAAAACTGGG + Intergenic
990819661 5:59823693-59823715 TTGCAGACTTGGAGGTAAGATGG - Intronic
991044285 5:62206714-62206736 GTGGAGAGAGAGAGATAAGAAGG + Intergenic
991288990 5:65012756-65012778 CTTCAGAGATGGAGAACAGCTGG - Intronic
992027168 5:72681613-72681635 CTGCTGAGATGAAGACCAGAAGG - Intergenic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993801091 5:92338499-92338521 TGGCAGAGATGGAGAATAGAGGG + Intergenic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
994696772 5:103081238-103081260 CTGCAGATATGGAGAAACAATGG + Intergenic
994767271 5:103934632-103934654 TTGCAGAGCTCGAGAAAAGATGG + Intergenic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995223850 5:109682153-109682175 CTGCTGAGAGAGACATAAGAAGG - Intergenic
995430643 5:112071704-112071726 CTGGAAAGATGAAGATAAGAAGG - Intergenic
996789531 5:127277858-127277880 TTGCTGAGATGGAGATGACAAGG + Intergenic
996929060 5:128864305-128864327 CTGCTGATATGGAAATTAGAAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999894699 5:156018593-156018615 ATGCAGAGATGGATAAATGATGG - Intronic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000984186 5:167849247-167849269 CTTGAGATAAGGAGATAAGAGGG - Intronic
1001132018 5:169072143-169072165 CTGCAGTGATGGAGGTATGGGGG + Intronic
1001756299 5:174172911-174172933 CTGCACAGATGCAGATGTGAAGG + Intronic
1001881279 5:175246394-175246416 TTGCAGAGTTTGAGAAAAGAAGG + Intergenic
1002026078 5:176397132-176397154 CGGAGGAGATGGAGATAAGGAGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1003361530 6:5431035-5431057 TTGCAGAGCTGGAGATAAGATGG + Exonic
1004013612 6:11712147-11712169 TTGCAGAGCTGGACAAAAGAAGG - Intronic
1004054326 6:12120222-12120244 CTGCGTAGATGGAGATCCGAAGG + Exonic
1004834280 6:19513650-19513672 ATGAACAGATGGAAATAAGAAGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1006180700 6:32151922-32151944 GCGCAGAGATGGAGAGATGAAGG + Exonic
1006703260 6:35994537-35994559 TGGCAGAGATGGAAAAAAGAGGG - Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1007706754 6:43795769-43795791 CTTCAGAGAGGGAGAGAGGATGG - Intergenic
1007715940 6:43856229-43856251 GAGCAGGGATGGAGATGAGAGGG + Intergenic
1007769498 6:44181211-44181233 CAGCAGAGAAGGAGTGAAGAAGG - Intronic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010652858 6:78475678-78475700 ATGCAGAGATGGAGAAAAATAGG + Intergenic
1011092413 6:83620260-83620282 AAGAAGAGATGGAGATCAGAAGG - Intronic
1011281693 6:85684655-85684677 TTGAAGAGATTGAGGTAAGAAGG + Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012823870 6:104123755-104123777 CTGCAGGGATGGAGATTTCATGG + Intergenic
1014668719 6:124272531-124272553 CTGCAGAGATGGAGCCATCATGG + Intronic
1015349171 6:132196362-132196384 CTGAAGAGATGGAGCTATGCTGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016781811 6:147967410-147967432 CTGCAGAGGTGGAAATAACTGGG - Intergenic
1018067708 6:160135111-160135133 CAGCAGAGAGGAAGAGAAGAGGG - Intronic
1018536204 6:164822741-164822763 CCACAGAGATGGAGAGTAGAAGG + Intergenic
1019327600 7:445986-446008 ATGGAGAGATGGAGAAAAGAAGG + Intergenic
1019775872 7:2911998-2912020 GTGCAGAGAGGGAGTTAACACGG + Intronic
1020855810 7:13421283-13421305 CTGCAGTGATGGTGATAAGGTGG + Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022354987 7:29606180-29606202 CTCCACATATGCAGATAAGAAGG - Intergenic
1023218845 7:37897347-37897369 CTGGAGGGATGGAGACAACAGGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023861089 7:44218060-44218082 ATGCAGCTATGGAGATAAGGCGG - Exonic
1025154524 7:56592241-56592263 CTGCAAAGATGGATAAAATATGG - Intergenic
1026280328 7:68916508-68916530 CTGCAGAGTTTGACATATGATGG + Intergenic
1026561451 7:71453803-71453825 GTGCAGAGAAGGAGAGAAGGTGG - Intronic
1027123856 7:75541981-75542003 CTGCAAGGATGGAAACAAGAAGG + Intronic
1028072553 7:86469682-86469704 CTGCAGAGCTGGAGTTCAGGTGG + Intergenic
1029169231 7:98618624-98618646 TTTCAGAGATAGAGATGAGACGG - Intronic
1029972006 7:104799220-104799242 TTGCAGAGATGAAAATATGAAGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030535034 7:110756143-110756165 TAGCAGATGTGGAGATAAGAAGG + Intronic
1030645873 7:112061124-112061146 CTCCATAGATGGAGAGAAGAGGG - Intronic
1031362535 7:120864273-120864295 CTGCCGAAATGGAGATGAGCTGG + Intergenic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1034380097 7:150684456-150684478 CTGTTGAGATGAAGATAAAATGG - Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036110423 8:5894062-5894084 CTGCAGATATTGACAAAAGAAGG + Intergenic
1036957320 8:13202501-13202523 CTGCAGAGATGGTAGAAAGACGG - Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1040732407 8:50464483-50464505 CTGCAGAGAGGGAGAGAAATGGG + Intronic
1041581365 8:59462960-59462982 TTCCAGAGATGGAGCTAAGATGG - Intergenic
1041913380 8:63113844-63113866 CTTCAGAGATGAAGGAAAGAAGG + Intergenic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042289061 8:67148485-67148507 CTTCACAGATGAAGATAAGTAGG - Intronic
1042804032 8:72752473-72752495 CAGCAGTGAGGGAGAAAAGAAGG - Intronic
1043175354 8:77018059-77018081 CTGCAGAGAAGGTGCTATGAGGG + Intergenic
1044780245 8:95736026-95736048 GTGCAGGGATGGAAATAAGCGGG - Intergenic
1045204345 8:100022214-100022236 CTGCAGAGATCAACACAAGATGG + Intronic
1045636372 8:104195808-104195830 CTAAAAAGATGGAGATAAGGTGG - Intronic
1045718257 8:105074375-105074397 ATCCAGTGATGCAGATAAGATGG + Intronic
1045851185 8:106699756-106699778 CTGCACAAAAGGAGATAAGCAGG + Intronic
1048087865 8:131203393-131203415 CTGCAGACATGGAGATATGGAGG + Intergenic
1048265176 8:132979269-132979291 ATGCACAGCTGCAGATAAGATGG - Intronic
1048496665 8:134941361-134941383 CTACAGACATGGAGTTAAAATGG + Intergenic
1049032021 8:140045115-140045137 CAGCAGAGATGGAGAGGAAAAGG + Intronic
1049272879 8:141705415-141705437 ATGGAGAGATGGAGAGATGATGG + Intergenic
1049749420 8:144276305-144276327 CTGCAGAGAGAGAGAGAAAATGG + Intronic
1050553279 9:6766905-6766927 ATGCAAAGATGGAGGTAAAAAGG - Intronic
1050820226 9:9869866-9869888 CAGCAGAGATTGAGACAAGTGGG + Intronic
1051915270 9:22200181-22200203 CTGCTGAAATGCAGACAAGAAGG - Intergenic
1052258648 9:26490107-26490129 CTGGAGAGACGGAGATATAACGG - Intergenic
1053796504 9:41731655-41731677 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054148675 9:61583165-61583187 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054184910 9:61943714-61943736 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054468436 9:65514322-65514344 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054653597 9:67644785-67644807 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1056099216 9:83284772-83284794 CTACAGAAAGGGAGAAAAGAGGG + Intronic
1056766597 9:89447942-89447964 AAGCAGAGAAGGAGATGAGACGG - Intronic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058906471 9:109486252-109486274 TTGCAGGGTTGGAGAAAAGATGG + Intronic
1059468255 9:114483382-114483404 TTGTAGAAATGGAGACAAGAAGG - Intronic
1059729645 9:117044253-117044275 GTGTAGAGAAGGACATAAGAAGG + Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1061144015 9:128786826-128786848 CTGCAGAGACCAAGATAAGCTGG + Intergenic
1061278251 9:129581842-129581864 CTGGAGAGAAGGGGATGAGAAGG + Intergenic
1061532133 9:131222755-131222777 CTGAAGAGATGAAGATGTGAGGG - Intronic
1061600415 9:131666115-131666137 TATCAGAGATGTAGATAAGATGG + Intronic
1061644250 9:131987336-131987358 CTGTAGATGTGGAGATGAGAAGG + Intronic
1185758587 X:2672272-2672294 AGGCAGAGACTGAGATAAGATGG + Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1189377833 X:40479640-40479662 CTGCAGAGAGGGAGGAAAGGAGG - Intergenic
1190310094 X:49111099-49111121 CTGCAGACATGGAGATGAAGAGG + Intergenic
1191856662 X:65632778-65632800 CTACATAGATGGAGATGACATGG + Intronic
1193102660 X:77633314-77633336 CTGCAGAGGTGGCAAGAAGATGG - Exonic
1193118966 X:77803431-77803453 TTGCAGAAAAGGAAATAAGAAGG - Intergenic
1194743149 X:97599423-97599445 CTGCAAAGATCAAGATAAGCTGG + Exonic
1194756034 X:97741193-97741215 CTCCAGAGAGGGAGGGAAGAGGG - Intergenic
1195253860 X:103074951-103074973 CTGCAGTCGTTGAGATAAGATGG - Intergenic
1195791134 X:108587753-108587775 CTGCAAGGATGCAGAGAAGAGGG - Intronic
1195852562 X:109298786-109298808 CAGCAGGGAAGGAGATAAGGTGG + Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196731215 X:118943310-118943332 CTGCAGCAATTCAGATAAGATGG + Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198410457 X:136362135-136362157 CAGCAGAGAGTGAGAAAAGAGGG - Intronic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1199540120 X:148949183-148949205 ATGAATAGATGCAGATAAGATGG - Intronic
1199540249 X:148950542-148950564 ATACAGATATGGGGATAAGAAGG - Intronic