ID: 1186504129

View in Genome Browser
Species Human (GRCh38)
Location X:10076511-10076533
Sequence CTGCATAGACAGAGGAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186504126_1186504129 18 Left 1186504126 X:10076470-10076492 CCTGCGTATTTCAAGTCTCTTTG 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG 0: 1
1: 0
2: 0
3: 24
4: 250
1186504124_1186504129 20 Left 1186504124 X:10076468-10076490 CCCCTGCGTATTTCAAGTCTCTT 0: 1
1: 0
2: 0
3: 20
4: 203
Right 1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG 0: 1
1: 0
2: 0
3: 24
4: 250
1186504125_1186504129 19 Left 1186504125 X:10076469-10076491 CCCTGCGTATTTCAAGTCTCTTT 0: 1
1: 0
2: 1
3: 11
4: 192
Right 1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG 0: 1
1: 0
2: 0
3: 24
4: 250
1186504123_1186504129 23 Left 1186504123 X:10076465-10076487 CCTCCCCTGCGTATTTCAAGTCT 0: 1
1: 1
2: 41
3: 171
4: 291
Right 1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG 0: 1
1: 0
2: 0
3: 24
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186504129 Original CRISPR CTGCATAGACAGAGGAAGAT TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
901359047 1:8679896-8679918 CTGCTTATACACAGGAAGAGAGG + Intronic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904999034 1:34653696-34653718 CTGCATAGTAAGATGAAGAAAGG + Intergenic
906646699 1:47480245-47480267 CTGCATTGAGAGAGAAGGATGGG - Intergenic
907714685 1:56916034-56916056 CAGCATAGAGACAGGAAGAAGGG + Intronic
907969039 1:59362616-59362638 AGGCAAAGACTGAGGAAGATGGG - Intronic
908116568 1:60946640-60946662 CTGCATGAACAAAGGAAGAGAGG + Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
908949897 1:69547666-69547688 ATGCATAGACAGACGTAGATAGG + Intergenic
912905898 1:113706936-113706958 CTGTATAGAGGGAGGCAGATGGG - Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916811822 1:168312685-168312707 CTGCAGAGACAGAGAAAGAGGGG - Intronic
917287580 1:173437130-173437152 CTCTGTAGAGAGAGGAAGATGGG + Intergenic
918772194 1:188575483-188575505 ATGGATAGACATTGGAAGATTGG + Intergenic
919345863 1:196377492-196377514 TTGCATACAAAGAGGAAAATGGG - Intronic
920034408 1:203056558-203056580 CTGCAGAGGCAGAGGAAGGGAGG - Intronic
920062415 1:203236607-203236629 ATGCATAGTGCGAGGAAGATGGG - Intronic
921098861 1:211911178-211911200 ATGCTGAGACAGAGGAAGATGGG - Intergenic
921528170 1:216244265-216244287 CTGCAGTGACTGAAGAAGATGGG + Intronic
922747593 1:228053775-228053797 CTGGAAAGAGAGAGGAGGATGGG + Intronic
924301673 1:242645552-242645574 CTTCACAGAAAGGGGAAGATGGG - Intergenic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1063618362 10:7622050-7622072 CTGCATGAAGACAGGAAGATGGG - Intronic
1064221143 10:13441040-13441062 CTTCATAAACACAGGAAGACCGG + Intronic
1064304958 10:14157254-14157276 GTGCAGAGACAGAGAAAGAGAGG - Intronic
1064389408 10:14928717-14928739 GTACAGAGACAGAGGAAGAGAGG + Intronic
1065781747 10:29175289-29175311 TTGTATAGACAAAGGAACATGGG + Intergenic
1066240069 10:33524878-33524900 CTGCAGAGACCCAGGCAGATGGG + Intergenic
1067764371 10:49074031-49074053 CAGCATAGACAGACACAGATGGG - Intronic
1068831847 10:61505166-61505188 CTTCATAGACAAAATAAGATAGG + Intergenic
1070870589 10:79748281-79748303 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071637507 10:87270493-87270515 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1071657738 10:87467458-87467480 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1074563901 10:114559206-114559228 TTGCATAGCAAGAGGAAAATGGG + Intronic
1075225973 10:120629203-120629225 CTTCATAGGGGGAGGAAGATGGG - Intergenic
1077311569 11:1891134-1891156 CTGCATCATCAGAGGTAGATTGG + Intronic
1079085254 11:17440460-17440482 CTCCATAGACAGGGGAAATTTGG - Intronic
1081019012 11:37919829-37919851 TTGCATAGATAGATGAAGAATGG - Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1089288674 11:117424202-117424224 GTGCTGAGAGAGAGGAAGATGGG + Intergenic
1090367194 11:126216464-126216486 CTGTAAAGACAGAGGAAAAGAGG - Intronic
1091909474 12:4217269-4217291 CAGCAGAGAGAGAGGAAGTTAGG + Intergenic
1092579339 12:9821319-9821341 CTGCAGAGGCAGTGGCAGATGGG - Intergenic
1096019143 12:48307647-48307669 CTGCCTGGACAGAGAAAGGTAGG - Intergenic
1096252628 12:50042850-50042872 CTGGATAGGCAGAGGAGGAAGGG - Intergenic
1097481855 12:60137251-60137273 CTTCATAGAGAAAGGGAGATTGG - Intergenic
1097631696 12:62072077-62072099 TTGCATATCCAGAGAAAGATAGG + Intronic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1099719508 12:86342426-86342448 CTGCATAGGCAGTGGCAGAGAGG - Intronic
1100275818 12:93070937-93070959 CAGTAGAGACAGAGGCAGATGGG + Intergenic
1101485898 12:105159362-105159384 CTGCATAGACAGGGGAGAACTGG + Intronic
1103496934 12:121370187-121370209 ATCCATAGAGACAGGAAGATTGG - Intronic
1103612469 12:122132376-122132398 CTGCACAGGTAGAGGAAGCTGGG + Exonic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1107224881 13:38036608-38036630 CTGCATAGACTGAGGGAGAGAGG - Intergenic
1108300823 13:49073957-49073979 CTGCCTTGACAGATGAAAATAGG - Intronic
1109682278 13:65768589-65768611 ATACATAGACAGAGGGAGAGGGG + Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1110934575 13:81271322-81271344 CTGCTTAGACAAAGGAGAATAGG + Intergenic
1111095460 13:83508379-83508401 GTGTATAGACAGAGAAGGATAGG - Intergenic
1111859882 13:93689637-93689659 CTGGATAGACAGAGAAAAATGGG - Intronic
1114069182 14:19094659-19094681 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1116873290 14:50088070-50088092 GTGCATAGAGAGAGAGAGATTGG - Intronic
1117035642 14:51725411-51725433 CTGAATAGAAAGGGGAAGAGGGG + Intronic
1118472066 14:66083422-66083444 ATGCTGAGACAGAGGAATATGGG + Intergenic
1118720385 14:68589765-68589787 CTGCTGGGACAGAGGAAGAGAGG - Intronic
1120159417 14:81129736-81129758 GGGCATAGACACAGGAAGATGGG - Intronic
1120396795 14:83977439-83977461 TTGCATAGAAAGAAGATGATAGG - Intergenic
1121278851 14:92685943-92685965 CTTCATATGCAGAGGATGATAGG - Intronic
1121657573 14:95608591-95608613 ATTCATAGACACAGGAAGAATGG - Intergenic
1128518526 15:68359977-68359999 CTGAGCAGACAGAGGAAGGTGGG + Intronic
1128990853 15:72259134-72259156 CTTGATAGCAAGAGGAAGATAGG + Intronic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1130634154 15:85600282-85600304 CAGCATAGAATGGGGAAGATGGG + Intronic
1130868081 15:87949137-87949159 CTGCAAAGAGGGAGGAAGAAGGG + Intronic
1133559962 16:6941701-6941723 GTGGATAGACAGAGAGAGATTGG + Intronic
1136402667 16:30027065-30027087 CTGCAGAGAGAGAGGAACATGGG - Intronic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1143375372 17:6464035-6464057 CTGCATGGACAGAGGTGGATGGG - Intronic
1143695098 17:8608782-8608804 AATCATAGACAGAGGAAGATGGG - Intronic
1144931101 17:18859317-18859339 CTGCATACAGAGAGCAAAATAGG - Intronic
1145930938 17:28684930-28684952 CTGCATGGAGAGAGGAAGAGCGG + Exonic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149628680 17:58100715-58100737 ATGCAGAGAGAGAGGAAGAAAGG - Intergenic
1150532776 17:66002533-66002555 CTACAGAGACAGGAGAAGATGGG + Intronic
1151114636 17:71721705-71721727 CTGCGTATACAGAGTAAGCTGGG + Intergenic
1151371952 17:73653236-73653258 CAGCAAAGGCAGAGGAAGAGGGG - Intergenic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1152197970 17:78928628-78928650 CTGCAAAGTCAGATGAAGAGGGG + Intergenic
1154082175 18:11268384-11268406 CTGCTTTTACAGGGGAAGATAGG - Intergenic
1154491702 18:14927132-14927154 GTGCATAGGCAGAGGAAATTAGG + Intergenic
1156363019 18:36400811-36400833 CTCCATGGACAGAGGAGGAGAGG + Intronic
1156783314 18:40878619-40878641 CTGCATAAACAGGTGAAGACAGG + Intergenic
1156916364 18:42467637-42467659 CTGTATAGGCACAGGAAGAAAGG - Intergenic
1157057167 18:44244071-44244093 CTGCATGTACAGAATAAGATTGG - Intergenic
1157449538 18:47774788-47774810 CTGCCAATACAGAGGACGATGGG + Intergenic
1157498501 18:48172871-48172893 CTGCAGAGACAGAGGAGCACAGG + Intronic
1157680874 18:49604867-49604889 GTGCATAGAATGAGGAGGATGGG + Intergenic
1159095485 18:63896861-63896883 ATCCATAGACAGAGCAAAATTGG + Intronic
1159534642 18:69700346-69700368 TTCCATAGAAAGAGGAAGATAGG - Intronic
1160251245 18:77205046-77205068 GTGCAGAGGGAGAGGAAGATGGG - Intergenic
1161280796 19:3444484-3444506 CTGAACAGACAGAGGATGCTTGG + Intronic
1162258377 19:9512062-9512084 CTGGAAAGACAGAAAAAGATAGG - Intergenic
1162784707 19:13027357-13027379 CTGTATAGACAGAGAATGAGGGG - Intronic
1163731577 19:18952696-18952718 CGTGAGAGACAGAGGAAGATGGG - Intergenic
1164261390 19:23571041-23571063 CTGCAAAGAATGAGGAAGTTAGG - Intronic
1164891717 19:31829248-31829270 CAGCCAAGATAGAGGAAGATGGG - Intergenic
1165103009 19:33450043-33450065 CTGCGGAGACAGAGGCAGCTTGG - Intronic
1165247122 19:34504229-34504251 CTGCAGAGAGAGAGGGAGAGAGG + Exonic
925823430 2:7822981-7823003 CTGCATTGACAGGTGAAAATAGG - Intergenic
927232857 2:20842552-20842574 ATGCTTAGACAGAAGAAGGTTGG - Intergenic
928340824 2:30441743-30441765 GTGCATGGGCAGAGGAATATTGG + Intergenic
933839358 2:86274151-86274173 CTGCATAAACATAGGAAGAAAGG + Intronic
933949066 2:87312984-87313006 CTGCAAAGTCAGAGGAACAGGGG - Intergenic
934573013 2:95383979-95384001 CTGCATGGAGAGAGGAAGGGAGG - Intronic
936234977 2:110734648-110734670 CTGAAAAGACTGAGGAATATAGG - Intronic
936331131 2:111548613-111548635 CTGCAAAGTCAGAGGAACAGGGG + Intergenic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
936614363 2:114033492-114033514 CTACACAGAAAGAGGCAGATTGG + Intergenic
936908225 2:117562145-117562167 CTCCACAGAGAGAGGAAGAGAGG + Intergenic
937490516 2:122362506-122362528 CTACATAGACAGTAGAAGAAAGG - Intergenic
937852185 2:126645489-126645511 CTGCTGAGAAAGAGGAGGATAGG + Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939714770 2:145570228-145570250 CAGCATAGAGAAAGGGAGATAGG + Intergenic
939819510 2:146938988-146939010 CTGCATAGAGAGGGGGAAATTGG - Intergenic
941629121 2:167865052-167865074 CTGCATAAACATAGGTAGCTGGG - Intergenic
942081561 2:172403892-172403914 CTGGACAAACTGAGGAAGATCGG + Intergenic
942490603 2:176485923-176485945 CAGGATGGAGAGAGGAAGATAGG + Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
946317453 2:218926583-218926605 CTGCATAGAGAAACAAAGATGGG - Intergenic
947973927 2:234347713-234347735 CATCAAAGACAGAGGAAGAATGG + Intergenic
948548393 2:238749463-238749485 CAGCAGAGACAGAGGAAGAGTGG + Intergenic
1169724679 20:8716016-8716038 CTGCATAGACATAGGTGGAGGGG - Intronic
1170158848 20:13292694-13292716 CTTCACAGCCAGAGGCAGATGGG + Intronic
1170458911 20:16558445-16558467 CTGCTTAGCCAGCGGAAGAGGGG - Intronic
1174740362 20:53007270-53007292 GTGCATGGACAGAGGAAGGTTGG + Intronic
1178366856 21:31995572-31995594 CTGCCCAGGCAGAGGGAGATGGG + Intronic
1178749118 21:35283865-35283887 GTGCATGGACAGAGGGAGAGAGG - Intronic
1180487655 22:15817222-15817244 CTGCATCCCCAGAGTAAGATGGG + Intergenic
1180698603 22:17769799-17769821 CTGCCTAGAGACAGGAAGGTGGG - Intronic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
949332501 3:2937830-2937852 CTCCACAGAGAGAGGAAGAGAGG + Intronic
950888900 3:16385787-16385809 GGGCATACACTGAGGAAGATTGG - Intronic
951341179 3:21489357-21489379 GTCCATAGACAGAGAAAGCTGGG + Intronic
952916799 3:38252555-38252577 TGGCATGGACAGAGGAAGAGTGG - Intronic
954463709 3:50642230-50642252 CTGCAGAAACAGAGGAGGAGGGG - Intronic
954673042 3:52300874-52300896 CTCCAGAGACAGAGACAGATAGG - Intergenic
954708992 3:52495705-52495727 CCGCATAGTCAGAGGAGGGTGGG - Intronic
955058127 3:55474161-55474183 CAGGAAAGACAGAGAAAGATAGG + Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956000501 3:64724939-64724961 ATGCAAAGACAGGAGAAGATGGG - Intergenic
956484959 3:69712138-69712160 CTAGATAGAAAGAGTAAGATAGG + Intergenic
956696287 3:71921897-71921919 CTGAATACACATAGGAAGGTGGG - Intergenic
956890081 3:73604732-73604754 CTGGAGAGAAAGAGGGAGATAGG + Intronic
957855703 3:85874409-85874431 ATGCATACACAAAGGTAGATTGG - Intronic
958479424 3:94627891-94627913 CAGCATAGACAGAGAAAAAGAGG - Intergenic
959557255 3:107735256-107735278 ATGCATAGGCAGATGAACATGGG + Intronic
961607574 3:128108228-128108250 ATTCAAAGGCAGAGGAAGATGGG + Intronic
962477991 3:135773719-135773741 CTGCACAGAGAGAGGAAGTCTGG + Intergenic
963625946 3:147672583-147672605 CTGCAAAGACTGAGGATTATAGG - Intergenic
963982069 3:151549451-151549473 CTGGATATAAAGAAGAAGATAGG - Intergenic
968485939 4:861787-861809 CTGCCCATACAGAGGAAGTTCGG + Intronic
970318666 4:14854346-14854368 CTGGATTGAGAGAGGAAGAGAGG - Intergenic
974373732 4:61049645-61049667 ATTCATAGCCACAGGAAGATAGG + Intergenic
974688079 4:65257595-65257617 CTGCATAAACAGGGGAAGAAGGG + Intergenic
974730748 4:65862496-65862518 TTACATAGACAGAGTAAAATTGG - Intergenic
975143385 4:70940297-70940319 CTGGGTAGACAGAGGAAGGTGGG - Intronic
975737627 4:77397132-77397154 CTGGAAAGACAGAAAAAGATTGG - Intronic
976350172 4:84051855-84051877 CTGCAAAGAGTGAGGAAGAGGGG + Intergenic
977442526 4:97087278-97087300 CTGCATAGACTGGGGAATACTGG - Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
978208243 4:106105063-106105085 CTGCAGAGACAGTGGCAGAGAGG - Intronic
978359630 4:107916404-107916426 CTGCTGAGACACAGGAAGACAGG + Intergenic
980642250 4:135596041-135596063 CTGCATACACAGAGAAAGTAAGG - Intergenic
981949183 4:150385583-150385605 ATGAACAGACAGAGGAAGAAGGG + Intronic
982646211 4:158027422-158027444 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
982863146 4:160479613-160479635 CTGCATGCACACTGGAAGATGGG - Intergenic
983030149 4:162790562-162790584 CTGCCTACACAGAGGTAGCTAGG + Intergenic
983510821 4:168607948-168607970 CTGCAGGAACAGAGTAAGATTGG - Intronic
988479482 5:31618169-31618191 CTGCCTAGAGAGAGGAATACTGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
991178742 5:63723539-63723561 CTGCATAAACAGAGAATGGTAGG - Intergenic
991958694 5:72020618-72020640 GTGCTTAGGCAGAGGAAGGTGGG + Intergenic
992884284 5:81142420-81142442 CTGGTTAGTCAGAGGATGATGGG + Intronic
995517294 5:112966856-112966878 TAGCAGAGACAGATGAAGATGGG + Intergenic
996232951 5:121088411-121088433 CTGCATAGGAAGAGGAAGCATGG + Intergenic
997674324 5:135701400-135701422 CTGCTTAGACATAGGCAGTTTGG - Intergenic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
997886836 5:137637746-137637768 CTGCTAAGATAGAGGAAGCTGGG - Intronic
998104145 5:139457605-139457627 CTGCAAGGACAGAGGCAGATAGG + Intronic
998488711 5:142526993-142527015 CAGCATAGACAGTGCAAGGTAGG + Intergenic
999089416 5:148922314-148922336 CTACAGAGACAGAGGAGGAAAGG - Intergenic
1002306376 5:178286275-178286297 CTGCCTACACAGAGGAAGTGGGG + Intronic
1002426550 5:179180202-179180224 CTGTGCAGACAGAGGAAGAGAGG - Intronic
1007400169 6:41598815-41598837 CAGCAGAGGCAGAGGAAGACAGG + Exonic
1007749756 6:44064655-44064677 CTGCACAGGCAGGGGAAGAAAGG + Intergenic
1008312119 6:49989520-49989542 CAGCCCAGACAGAGCAAGATAGG + Intergenic
1008606025 6:53140413-53140435 TTGCAGAGACAAAGGAAGTTTGG + Intronic
1009597139 6:65750107-65750129 GTGCATTGAAATAGGAAGATAGG + Intergenic
1009641048 6:66337287-66337309 CAGCCTAGACAGAGTAACATAGG - Intergenic
1009769553 6:68127247-68127269 CTGCAGAGACAGTGGCAGAGAGG + Intergenic
1012903632 6:105037929-105037951 CTGTAGAGAAAGAGTAAGATTGG + Intronic
1013803537 6:113972009-113972031 CTGGCTAGACACTGGAAGATTGG + Intronic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014820811 6:125986696-125986718 CTGCATAGCCCGAGGAAGCTGGG + Intronic
1015019304 6:128452925-128452947 CTACATAGTCAGAGGAACTTTGG + Intronic
1016250991 6:142042809-142042831 ATGTTTAGGCAGAGGAAGATGGG + Intergenic
1016900292 6:149094138-149094160 ATGCATGGACAAAGGAAGAGAGG - Intergenic
1017078874 6:150647260-150647282 CTGCATATAAAAAGCAAGATTGG + Intronic
1018479580 6:164176553-164176575 GTCCATAGACAGAGGGACATGGG - Intergenic
1019632124 7:2055079-2055101 CAGCAGAGACAGAGGAAGCGGGG + Intronic
1022594948 7:31704463-31704485 CTGTATAGAGAGAGGACGAAGGG + Intronic
1024466598 7:49717808-49717830 CTGAATAGACAGAGTAGCATTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1028318327 7:89432062-89432084 TTTCATAGACACTGGAAGATAGG - Intergenic
1030809396 7:113956214-113956236 CTGCAGAGACAGTGGCAGAGAGG + Intronic
1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG + Intronic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031941834 7:127797595-127797617 CTGCACAGGGAAAGGAAGATGGG + Intronic
1032139467 7:129314127-129314149 CAGCATAGAAATAGGTAGATAGG + Intronic
1032547733 7:132757753-132757775 CTGCATTGACACAGGGAGAAAGG + Intergenic
1032719012 7:134535687-134535709 CGGCATAGACAGAGTCAGAAAGG - Intronic
1032739664 7:134725849-134725871 CTACAAAGACAGAGGCACATTGG + Intergenic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1033654527 7:143363514-143363536 CAGCAAAGAGAGAGAAAGATTGG + Intergenic
1034076536 7:148237050-148237072 CTTGAAAGACAGAGGAAGAATGG - Intronic
1034822234 7:154226786-154226808 CTTCAGAGTCAGAGAAAGATGGG + Intronic
1035749915 8:1989968-1989990 CTCCAGAGACAGAGGAAGAGAGG + Intronic
1036981326 8:13473161-13473183 CTGCATGGAAACAGGAAGACAGG + Intronic
1037704800 8:21310017-21310039 CTGCACAGACAAAGGAATCTTGG - Intergenic
1037730377 8:21518968-21518990 CTGGGGAGGCAGAGGAAGATGGG - Intergenic
1040747657 8:50664735-50664757 CTTCCTAGTGAGAGGAAGATCGG + Intronic
1042440757 8:68823102-68823124 CTGCATAGATAGAGAAATTTAGG + Intergenic
1042689951 8:71486623-71486645 CTGCTTACACAGAGGAGGGTGGG - Intronic
1043045144 8:75313882-75313904 CTGCATAGAGATTGGAAGTTTGG - Intergenic
1043202400 8:77386668-77386690 CTGCATAGAGAGGGTAAGTTAGG + Intergenic
1044755031 8:95452651-95452673 CTGGATGCACAGAGGATGATGGG - Intergenic
1046997924 8:120544984-120545006 TTGCATAAACAGAGGAAATTTGG + Intronic
1047393116 8:124470500-124470522 CTTCATAAAAAGAGGAAGAAAGG + Intergenic
1047928345 8:129702456-129702478 CTGCCTAGACCTAGGAAGGTGGG - Intergenic
1047928362 8:129702613-129702635 CTGCCTAGACCTAGGAAGGTGGG - Intergenic
1047928376 8:129702737-129702759 CTGCCTAGACCTAGGAAGGTGGG - Intergenic
1050596804 9:7212243-7212265 CTGCAGAGAGAGAGAAAGAGAGG + Intergenic
1050619529 9:7438234-7438256 CTACATAGACAGAATTAGATTGG + Intergenic
1051333758 9:16048064-16048086 ATGCACAGGCAGAGGAAGAAGGG + Intronic
1056223983 9:84477484-84477506 CTGCAGAGAAAGAGCCAGATAGG + Intergenic
1057198385 9:93127581-93127603 CTCCAGAGAAAGAGGAAGTTTGG - Intronic
1058175586 9:101732933-101732955 CTGCAACGAAAGAGGCAGATTGG + Intronic
1059364017 9:113771327-113771349 CTGGCAAGACAGAGGAAGATTGG + Intergenic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1061670589 9:132186046-132186068 CAGCATAGCCAGAGAAAAATAGG + Intronic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1062150433 9:135015663-135015685 CTGAGTAGACAGAGGCAGCTGGG + Intergenic
1185518746 X:720717-720739 CTGCAAAGACAGAAAAAGAGAGG - Intergenic
1185754815 X:2644787-2644809 CTACATATAAAGAGAAAGATAGG + Intergenic
1186504129 X:10076511-10076533 CTGCATAGACAGAGGAAGATTGG + Intronic
1188251031 X:27894575-27894597 CTCCTTAGACAGAGGAATTTTGG - Intergenic
1188976614 X:36683267-36683289 CTGCATACACAGGGAAAGGTGGG + Intergenic
1189703793 X:43739266-43739288 CAGGATAGTCAGAGGAAGTTTGG - Intronic
1190148851 X:47923881-47923903 CTGGATATAGAGTGGAAGATAGG - Intronic
1190443521 X:50499509-50499531 GTGCATAGGGAGAGGAAGAGGGG + Intergenic
1193496396 X:82219053-82219075 CTGCAGAGGCAGTGGCAGATGGG + Intergenic
1193667821 X:84345001-84345023 TTGCATAGGAAGAGCAAGATTGG - Intronic
1194917528 X:99723408-99723430 CTGCAGAGACAGTGGCAGAGAGG - Intergenic
1195856505 X:109338199-109338221 CTGCAGAGACAGTGGCAGAGGGG + Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197623914 X:128781659-128781681 CTGCATTGACAGTGGCAGATGGG - Intergenic
1198891733 X:141403863-141403885 CTGAAAAGAGAGAGGAAGCTGGG - Intergenic
1199122844 X:144077368-144077390 CTGGATAGAATGTGGAAGATAGG - Intergenic