ID: 1186505763

View in Genome Browser
Species Human (GRCh38)
Location X:10090792-10090814
Sequence TACTCACACCAGCTACAAAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186505763 Original CRISPR TACTCACACCAGCTACAAAC TGG Exonic
904249772 1:29214858-29214880 TCCTCACAGCAGCTACAAGAGGG - Intronic
904413966 1:30343524-30343546 TATTCACAATAGCTTCAAACTGG - Intergenic
909808571 1:79903199-79903221 TCCTCACACCAGCCCCATACTGG - Intergenic
910802659 1:91161288-91161310 TGCACAAACCCGCTACAAACTGG - Intergenic
911508233 1:98780548-98780570 AACACACACCAGCAAGAAACTGG - Intergenic
917047162 1:170873853-170873875 TACTCACAATAACTAAAAACTGG - Intergenic
917951166 1:180038316-180038338 TATTCACAATAGCTAAAAACTGG - Intronic
920575736 1:207059076-207059098 TAAGCACACCTGCTACAACCAGG - Intronic
921797352 1:219361986-219362008 TTCTCAAACCAGCAACATACTGG + Intergenic
922746926 1:228049461-228049483 TGTTCACACAAGCCACAAACTGG - Intronic
924366300 1:243297351-243297373 TGCTCACAATAGCTGCAAACTGG - Intronic
1065705804 10:28470657-28470679 GACTCACCCCAGCTACATTCAGG - Intergenic
1066491234 10:35897384-35897406 CACCCACACCAGCTGCAAAAGGG + Intergenic
1070822447 10:79368339-79368361 TACTGATACCTGCTACAACCTGG + Intergenic
1071188627 10:83075048-83075070 TACTCACACCAAATGAAAACAGG + Intergenic
1077209918 11:1365439-1365461 TTCTCACACAGGCTACAAAATGG + Intergenic
1077595842 11:3530748-3530770 TACTCACACGTGCTACAACACGG - Intergenic
1078721330 11:13886577-13886599 TATTCATAACAGCTTCAAACTGG - Intergenic
1080311371 11:30897063-30897085 TAATCTCACCAGCTAGAAAAAGG + Intronic
1082799629 11:57405118-57405140 TACTGACACCTGCTACAACACGG - Intronic
1084342613 11:68516617-68516639 TACTCACAACAGCTAAAACATGG - Intronic
1087903467 11:103669034-103669056 TACTCACACAATCTGCATACAGG - Intergenic
1088178138 11:107077436-107077458 TATTCACAACAACCACAAACTGG + Intergenic
1088805092 11:113345233-113345255 TTCTCACACAATCTAAAAACAGG + Intronic
1091594909 12:1871284-1871306 CACACACACCAGCAACATACAGG - Intronic
1091594916 12:1871438-1871460 CACACACACCAGCAACATACAGG - Intronic
1091674632 12:2480117-2480139 TTCACACACAAGCAACAAACTGG + Intronic
1092383813 12:8019917-8019939 TATTCATAACAGCTCCAAACTGG + Intergenic
1092841096 12:12541982-12542004 TACTGATACCAGCTACAATATGG + Intronic
1092886665 12:12930253-12930275 TACTCAGAACAGCCACACACAGG - Intergenic
1093769202 12:22999626-22999648 TACTGATACCTGCTACAACCTGG - Intergenic
1096449863 12:51729590-51729612 TATTCACACTAGTTGCAAACTGG - Intronic
1099903562 12:88743786-88743808 CACTCAAACCATCTTCAAACTGG + Intergenic
1100915518 12:99416277-99416299 TATTCATAACAGCTAAAAACTGG - Intronic
1101893569 12:108736812-108736834 TACTCACACATGCAACAACCTGG - Intergenic
1102319040 12:111914969-111914991 TACTAACACCTGCTACAATGTGG + Intergenic
1105741162 13:23324484-23324506 TGCTCACACCGGCCACAGACAGG - Exonic
1105972448 13:25442165-25442187 TATTCACAGCAGCTACAACGTGG - Intronic
1107134994 13:36934056-36934078 TACTCATAATAGCCACAAACTGG - Intergenic
1107247464 13:38313826-38313848 TATTTACAACAGCAACAAACCGG - Intergenic
1107811454 13:44204287-44204309 TACTGACACGTGCAACAAACCGG - Intergenic
1109022918 13:57120713-57120735 TACTCGAACCTGCTACTAACCGG - Intergenic
1109388170 13:61660212-61660234 CACTCACACTAGCTCCAAAAAGG - Intergenic
1111577464 13:90175034-90175056 TACTCTCACCTGCTCCAAAAGGG - Intergenic
1117906440 14:60593565-60593587 TACTCACAATAGCCAAAAACTGG + Intergenic
1117972150 14:61262251-61262273 TACTCATAATAGCTCCAAACTGG + Intronic
1118230676 14:63945851-63945873 TACTCATAGCAGCTAAAAACTGG - Intronic
1118769133 14:68929846-68929868 TCCTCAAACCACCTTCAAACTGG - Intronic
1118911355 14:70064626-70064648 TACTGACACTATCTCCAAACAGG + Intronic
1119011978 14:71002780-71002802 TATTCACAACAGCCAAAAACGGG - Intronic
1119172913 14:72548033-72548055 TACTCACTTCACCTACAAAGGGG - Intronic
1121247543 14:92473062-92473084 TACTCACAAAAACTAGAAACAGG - Intronic
1121806369 14:96828177-96828199 TATTCACAACAGCCACAAACTGG - Intronic
1122122070 14:99560089-99560111 TACTCACACCAGCTGCCCCCTGG + Intronic
1122259491 14:100504649-100504671 TACTCATAACAGCCAAAAACTGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126751369 15:51880749-51880771 TATTCACAACAGCTAAAAAGTGG - Intronic
1126962831 15:54017013-54017035 TACTCACATCAACCACAAAATGG - Intronic
1127636766 15:60878460-60878482 GAGTCACACCAGCCACCAACTGG - Intronic
1127899512 15:63330602-63330624 TACCCCCACCAGCCACAGACTGG - Intronic
1129062985 15:72875318-72875340 TATTCAAACTAGCTAAAAACTGG - Intergenic
1129308057 15:74683073-74683095 TACTCAAAAAAGCCACAAACTGG + Intronic
1131159707 15:90097500-90097522 TTCTGACACCTGCTACAAAGTGG + Intronic
1131600923 15:93848080-93848102 TAATCACACCAGCTGAAAGCTGG + Intergenic
1135428234 16:22358436-22358458 TATGCACAAAAGCTACAAACAGG + Intronic
1136469530 16:30470249-30470271 GACTCACACTAGCCCCAAACTGG - Intergenic
1143327075 17:6106323-6106345 TATTCACAATAGCTAAAAACCGG + Intronic
1148212361 17:45816339-45816361 CACTCACACCAGCTAGGGACAGG - Intronic
1150063261 17:62086997-62087019 TACTCATAATAGCTAAAAACTGG + Intergenic
1152361114 17:79833594-79833616 TAATAACACCACGTACAAACGGG + Exonic
1152851766 17:82640771-82640793 TACTCACATAAGCTGGAAACGGG + Intronic
1154282011 18:13011866-13011888 TACTCACAACAGCCAAAAAGTGG + Intronic
1155215422 18:23639316-23639338 TACTCACAACAGCTAAAATGTGG + Intronic
1155765583 18:29628272-29628294 TACTCTCATTAGCTAAAAACTGG + Intergenic
1156595866 18:38546927-38546949 TTCAGACACCAGCTACAAGCAGG + Intergenic
1158149099 18:54346735-54346757 TACTGACACAAGCTACAACATGG + Intronic
1163422326 19:17220778-17220800 CTCTCACACCAGCTCCAGACAGG + Intergenic
1164470826 19:28530310-28530332 TACTCTCTCCAGATACACACTGG + Intergenic
1166430970 19:42727838-42727860 TACTCACACTAGCCAAAAAATGG + Intronic
1166443975 19:42843081-42843103 TACTCACACTAGCCAAAAAATGG + Intronic
1166463664 19:43013837-43013859 TACTCACACTAGCCAAAAAATGG + Intronic
1166469811 19:43070414-43070436 TACTCACACTAGCGAAAAAATGG + Intronic
1166480947 19:43173932-43173954 TACTCACACTAGCGAAAAAATGG + Intronic
1166490524 19:43256918-43256940 TACTCACACTAGCGAAAAAATGG + Intronic
928269020 2:29838490-29838512 TATTCATAATAGCTACAAACTGG + Intronic
932034424 2:68227897-68227919 TAGTCATACCATCTGCAAACGGG + Intronic
933016932 2:77139687-77139709 TAATCATATCATCTACAAACAGG - Intronic
933771777 2:85749208-85749230 TACTCACAGCAGCTCCAGAAAGG - Intergenic
935563447 2:104582105-104582127 TAGAGACACCAGCTACAAACTGG + Intergenic
935613653 2:105053545-105053567 TATTTACAACAGATACAAACTGG + Intronic
936293403 2:111246676-111246698 TCCTCACACCAGCTGCAGGCAGG - Intergenic
938321029 2:130364048-130364070 TCCTCACAGCACCTATAAACTGG - Intronic
940481820 2:154241866-154241888 TACTCACAGCAGTTATAAAAGGG + Intronic
940920379 2:159299029-159299051 TATTCATAACAGCTAAAAACTGG - Intergenic
941660226 2:168188940-168188962 TTCTCAAGGCAGCTACAAACTGG + Intronic
945462686 2:210128326-210128348 TACTCACAATAGCTAAAAACTGG + Intronic
945466471 2:210175396-210175418 TATTCACAACAGCCTCAAACTGG + Intergenic
945832825 2:214807331-214807353 TACTCACTTCAGTTAGAAACTGG + Intronic
1172961274 20:38801841-38801863 TATTCACAACAGCTAAAAAGTGG - Intergenic
1173853506 20:46233962-46233984 CACTCTCTCCAGCTACAGACGGG + Intronic
1174926047 20:54761157-54761179 TATTCATAACAGCTCCAAACTGG + Intergenic
1176261000 20:64180074-64180096 TACACACACATGCTACACACAGG + Intronic
1176669189 21:9716435-9716457 TATTCACACTAGCCAAAAACTGG - Intergenic
1178800030 21:35785603-35785625 TACTCAAAACAGCCAAAAACTGG + Intronic
1182385957 22:29941330-29941352 TACTCATAACAGCCCCAAACTGG - Intronic
1184392491 22:44212498-44212520 GACTCACACCAGCTCCACTCTGG + Intronic
951138118 3:19128182-19128204 TAATCACAGTAGCTCCAAACTGG - Intergenic
951470885 3:23054746-23054768 TAAAGACACCAGGTACAAACTGG + Intergenic
952033935 3:29177396-29177418 TATTCACAGCAGCCCCAAACTGG - Intergenic
952741154 3:36736331-36736353 CACTCACAGCAGCCACAAAGGGG + Intronic
953933672 3:47021138-47021160 TACTCATACCATCTACAACTGGG - Intronic
954729542 3:52647661-52647683 TACTGACACATGCTACAAAATGG + Intronic
954828316 3:53395348-53395370 TAATCACATCATCTGCAAACAGG - Intergenic
955497613 3:59551586-59551608 CACTCCCACCAGCTGCATACAGG + Intergenic
956545331 3:70395054-70395076 TTCTCAAACCAGAAACAAACAGG - Intergenic
956837669 3:73108805-73108827 TACTCATACATGCTACAAAATGG - Intergenic
956939981 3:74147178-74147200 TGATCACACTTGCTACAAACTGG - Intergenic
960337181 3:116433028-116433050 AACAAACACCAGCTACAAATTGG + Intronic
961489431 3:127243816-127243838 TACTACCACCATCTACAAAGTGG - Intergenic
961789792 3:129367193-129367215 TACTCACAACAGCTACAGTGTGG - Intergenic
963165515 3:142198123-142198145 TATTCATAACAGCTAAAAACAGG + Intronic
965874924 3:173305281-173305303 TATTCAAAACAGCTTCAAACTGG - Intergenic
966361996 3:179139944-179139966 TATTCACAACAGCAACAAAAAGG + Intergenic
968208730 3:196828090-196828112 TACACACAACAGCAATAAACAGG - Intronic
970340934 4:15106236-15106258 TTCAGACACCAGCTAAAAACGGG + Intergenic
976800438 4:88985122-88985144 TACTGACACATGCTACAAAATGG + Intronic
977286209 4:95110061-95110083 TATTAACTCCAGCAACAAACTGG - Intronic
978085923 4:104654170-104654192 TACTAACATCAGAAACAAACAGG + Intergenic
984895789 4:184538233-184538255 AACCCACACGATCTACAAACGGG + Intergenic
987482755 5:18479153-18479175 TACTCTCACCACATACACACAGG + Intergenic
991270967 5:64780211-64780233 TACTCATACATGCTACAAAATGG - Intronic
992167124 5:74065093-74065115 TACTCACAATAGCAAAAAACTGG + Intergenic
995853209 5:116568644-116568666 GACTCCCTCCAGCTACAACCAGG + Intronic
995951281 5:117716892-117716914 TATTCACAACAGCTAAAATCTGG - Intergenic
996274376 5:121646603-121646625 CACTCATATCATCTACAAACAGG + Intergenic
996959338 5:129226733-129226755 ACCTCACACCATCTACAAAATGG - Intergenic
998326575 5:141286067-141286089 TATTCATAACAGCTAAAAACTGG - Intergenic
999449946 5:151670441-151670463 TTCTTACCCCAGCTACAAAGAGG - Intronic
1001049973 5:168406219-168406241 TGCTCAGGGCAGCTACAAACTGG + Exonic
1001114403 5:168927086-168927108 TATTCACAACAGCTAAAAAGTGG + Intronic
1004281885 6:14287001-14287023 CTCACATACCAGCTACAAACAGG + Intergenic
1005552784 6:26940678-26940700 CAATCACATCATCTACAAACAGG + Intergenic
1007690691 6:43699320-43699342 TACTCACACTAGCTCCAGAGAGG + Intergenic
1012978700 6:105807623-105807645 TATTCACACTAGCCCCAAACTGG - Intergenic
1014094890 6:117449026-117449048 TACTGACACACGCTACAACCTGG - Intronic
1017852403 6:158316213-158316235 TAGTCACAACAGCCAAAAACTGG - Intronic
1018905879 6:168075593-168075615 TCCTCACACCAGAGACAGACAGG - Intronic
1019303301 7:320321-320343 CACTCACAACAGCCACAAAGTGG + Intergenic
1019967556 7:4512397-4512419 TTCTCACACTAGGTAAAAACAGG + Intergenic
1026436813 7:70406333-70406355 TTGTCACACCAGCTCCAACCGGG - Intronic
1027687126 7:81292530-81292552 TAATCACATCAGCTAAAATCAGG + Intergenic
1027711536 7:81608909-81608931 TCTTCTCACCAGGTACAAACGGG - Intergenic
1028444638 7:90907153-90907175 TATTATCACCATCTACAAACTGG - Intronic
1030611436 7:111693823-111693845 CATTCACATCAGCTACCAACTGG + Intergenic
1034591375 7:152142441-152142463 TAGTAACACCAGCTACAAATGGG + Intronic
1037306908 8:17514576-17514598 TACTCAGAACAGCTATAAAAGGG - Intronic
1038200177 8:25404828-25404850 CACTCCCACCAGCAACACACAGG + Intronic
1038667929 8:29557349-29557371 TATAAACACCAGCTACACACAGG + Intergenic
1040017140 8:42708853-42708875 TACTCACCACATCTACAAGCTGG - Exonic
1040930308 8:52727412-52727434 TACTCATAACAGCTAAAAAGTGG + Intronic
1041126459 8:54645160-54645182 TACTCACAATAGCCAGAAACTGG - Intergenic
1042328716 8:67555672-67555694 TTCAGACACCAGCTACAAATGGG - Intronic
1042810015 8:72814267-72814289 TATTCACAATAGCTCCAAACTGG - Intronic
1044861628 8:96529655-96529677 TACTCACTCACTCTACAAACAGG - Intronic
1046641365 8:116735477-116735499 TATTCATAACAGCTAAAAACCGG + Intronic
1046882382 8:119323497-119323519 TACACAAATCAGCTACAAATGGG - Intergenic
1052519004 9:29519551-29519573 TACACAAACAAGCTACAAAATGG - Intergenic
1052961350 9:34300060-34300082 TACACACAACAGATTCAAACTGG - Intronic
1055952043 9:81738436-81738458 CCCTCACTCCAGCTACAAACAGG + Intergenic
1057885153 9:98824191-98824213 GACTCACACAAGATAGAAACAGG + Intronic
1058105634 9:100968064-100968086 TACTCCCACCACCTACATATGGG - Intergenic
1061004871 9:127923085-127923107 TAGACACACCATCTGCAAACTGG - Intronic
1203656677 Un_KI270753v1:4501-4523 TATTCACACTAGCCAAAAACTGG + Intergenic
1186505763 X:10090792-10090814 TACTCACACCAGCTACAAACTGG + Exonic
1186908887 X:14140322-14140344 ACATCACCCCAGCTACAAACTGG - Intergenic
1189296169 X:39919552-39919574 TATTCACAGCAGCCAAAAACTGG + Intergenic
1189586063 X:42463247-42463269 TAATCACACCAAGTACCAACTGG - Intergenic
1189823172 X:44890322-44890344 TATTCACAACAGCCAAAAACCGG - Intronic
1190064024 X:47228406-47228428 TACACAAACCAGCTACAACCAGG - Intronic
1194426277 X:93742388-93742410 TATTCATAACAGCTACAAACTGG + Intergenic
1195721368 X:107872107-107872129 TACTCACACCCCCTGTAAACAGG - Intronic
1195938798 X:110149856-110149878 CAATCACCCCAGCTAAAAACTGG + Intronic
1199718048 X:150520708-150520730 TACTGATACCAGCTACAACATGG + Intergenic