ID: 1186509076

View in Genome Browser
Species Human (GRCh38)
Location X:10117147-10117169
Sequence TGTCCTCGGGGAGCAGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186509067_1186509076 0 Left 1186509067 X:10117124-10117146 CCTGTGTGCCAGCACCCTGACGG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162
1186509069_1186509076 -8 Left 1186509069 X:10117132-10117154 CCAGCACCCTGACGGTGTCCTCG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162
1186509066_1186509076 19 Left 1186509066 X:10117105-10117127 CCATGCTGTCTCATTTCAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 453
Right 1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186509076 Original CRISPR TGTCCTCGGGGAGCAGCCGC GGG Exonic
900083887 1:877601-877623 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
900186755 1:1336478-1336500 GGTCCACCCGGAGCAGCCGCCGG - Exonic
900324330 1:2100621-2100643 GGGCCTCGGGGAGCAGGTGCAGG + Intronic
900361938 1:2293312-2293334 TGTGCTCAGGGAGCAGTCACGGG + Intronic
900485437 1:2920554-2920576 TGGACTGGGGGAGCTGCCGCTGG - Intergenic
900608073 1:3532612-3532634 TGTCCTCTGGGAGGAGACACAGG - Intronic
901017555 1:6240774-6240796 TGTCCTCTGGGATGGGCCGCAGG + Intergenic
902317485 1:15633452-15633474 AGTCCTGGTGGAGCAGCAGCAGG + Exonic
902388382 1:16088818-16088840 TGGCCCCGGGGAGCAGCAGGTGG + Intergenic
902606595 1:17572665-17572687 TGTCCTCAGGCAGCAGCCACAGG - Intronic
903768504 1:25749693-25749715 TGTTCTCTGAGAGCAGCAGCTGG + Intronic
905106307 1:35565540-35565562 TGTCCTGGTGGAGCTGGCGCGGG + Exonic
906529473 1:46515225-46515247 TGTCCTCTGGGATTAGCCCCAGG + Intergenic
910116281 1:83735835-83735857 TGTCCTCAGGGCACAGCAGCTGG + Intergenic
915021760 1:152786313-152786335 TGTCCTCTGGGAACAGAAGCAGG + Intronic
918098018 1:181350341-181350363 TGTTCTTGGGGAGCAGCTGCAGG - Intergenic
920926154 1:210343668-210343690 TATCCCCGGGGACCACCCGCAGG - Intronic
921924363 1:220699292-220699314 GGTCCTTGGGGAGCAGCTGTGGG - Intergenic
924243849 1:242062940-242062962 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1062763354 10:44334-44356 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1067369740 10:45672473-45672495 GGTCCCCGGGCAGCAGCGGCCGG + Intronic
1070111909 10:73495347-73495369 TGTCACCGGGGAGCAGGCGTGGG + Intronic
1070275475 10:75001888-75001910 TGCCCTCTGGGAGAAGCCGGTGG - Intronic
1072718401 10:97766436-97766458 CCTCCTCGGGGAGCTGCTGCAGG + Intergenic
1074955328 10:118383246-118383268 TTTCCTCGGTGAGGAGCCCCAGG - Intergenic
1075638190 10:124044628-124044650 TGACCTCAGGGTGCAGCCGCAGG + Exonic
1076366881 10:129926898-129926920 TGTCCCCCGGGAGCAGGCTCTGG - Intronic
1076615043 10:131749584-131749606 CCTCCTCCGGGAGCAGCCACGGG + Intergenic
1076727688 10:132421180-132421202 TGTCCACGGGGAGATGCCCCTGG - Intergenic
1076850840 10:133091943-133091965 CGGCCTCGGGGAGCAGCTGCAGG - Intronic
1076890924 10:133282956-133282978 TGTGTTCGTGGAGGAGCCGCTGG - Intronic
1077407459 11:2388997-2389019 TGTCCTCCTGGAGCAGCAGGGGG + Intronic
1077554385 11:3218931-3218953 TGCCCTCTGGGTGCAGCCCCTGG + Intergenic
1078638747 11:13076406-13076428 TGTCCTCAGAGATCAGCAGCTGG - Intergenic
1079129064 11:17737115-17737137 CCTCCTCAGGGAGCAGCCTCCGG + Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1080111450 11:28572691-28572713 TGTCCTCATGAAGCAGCAGCTGG + Intergenic
1082810423 11:57476218-57476240 CGTGCTCTGTGAGCAGCCGCAGG - Exonic
1082929006 11:58579551-58579573 CGTCCCCGGGCAGCAGCCCCAGG + Exonic
1083173323 11:60935275-60935297 CATCCTGGGGGAGCAGGCGCTGG + Exonic
1083651815 11:64208557-64208579 TGGCCTCCTGGAGCAGCAGCGGG + Intronic
1083687397 11:64384728-64384750 GGTCCTCTGGGAGGAGCCTCAGG + Intergenic
1083774521 11:64887977-64887999 AGGCCTGGGGGAGCAGCCCCTGG - Intronic
1084107124 11:66987467-66987489 TGGCCTCTGGGAGCAGCTACTGG - Intergenic
1085399142 11:76225196-76225218 GGTCCTCAGGGAGCAGCTGAGGG + Intergenic
1085974114 11:81631295-81631317 TGTCCCCAGGGAACAGCCACAGG + Intergenic
1089350981 11:117821618-117821640 TGCCCTCCGGGAGCTGCCACGGG + Intronic
1091399484 12:173579-173601 TGTCCTCGGGCAGCACCACCTGG - Intronic
1091406950 12:214963-214985 TGTCCTCTGGAAGCAGAGGCTGG + Intergenic
1091842239 12:3629529-3629551 TGTCCTCGGGCAGCACTGGCTGG - Intronic
1093057178 12:14567402-14567424 TGCCCTCGCTGCGCAGCCGCAGG + Intronic
1094813229 12:34162093-34162115 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1096070301 12:48771727-48771749 TGATCTCGTTGAGCAGCCGCAGG + Exonic
1097147357 12:56950962-56950984 TGGCCTTGGGGAGCAGTGGCAGG - Intergenic
1097169061 12:57102382-57102404 AGTGCTCTGGGAGCAGCCCCCGG + Exonic
1101903092 12:108806172-108806194 TGTCCTCTGGTATCAGCCCCCGG - Intronic
1104676544 12:130715383-130715405 TGTCCCCGGGGAGCGCACGCTGG - Intronic
1104834179 12:131776676-131776698 TCTCCCCGGGGAGCAGCTGGGGG + Intronic
1106248413 13:27967076-27967098 TGTCCCGGGAGAGCGGCCGCGGG - Intronic
1110219674 13:73059558-73059580 GGTCCTCTGGAGGCAGCCGCGGG - Exonic
1113556688 13:111241347-111241369 TGACCTCGGGGCGCAGCCGGGGG - Intronic
1113625713 13:111844969-111844991 TGTCATCGGGCAGCAGCATCAGG + Intergenic
1113835492 13:113326026-113326048 GGTCCTCGGGGAGCTGGTGCGGG - Exonic
1113895096 13:113759260-113759282 GGGCCTCGGGATGCAGCCGCCGG + Exonic
1119767877 14:77201837-77201859 TGTCCTGGGGGCCCAGCCCCAGG - Intronic
1122876286 14:104667106-104667128 TGGCCTCGGGCAGCGGCCGTTGG - Intergenic
1124240752 15:28025708-28025730 TGCCCTCACGGAGCAGCCGGTGG - Intronic
1125200467 15:37097679-37097701 TGTCCTCGGGGAGAAGGCCCCGG + Intronic
1127763496 15:62164165-62164187 TCTCCGCGCGGAGCAGCCGGAGG + Exonic
1132115135 15:99130625-99130647 TGTCAGCGGGGAGAAGCCGGAGG + Exonic
1132516510 16:368536-368558 GGTCCTCGGGGTGCAGCTGGGGG + Exonic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132837164 16:1959862-1959884 TGTCCCCGGGGTGCAGCGGGGGG - Intronic
1136882741 16:33913005-33913027 TGTGCTCCTGGAGCAGCCCCTGG - Intergenic
1138511064 16:57508625-57508647 TGTCCTCCAGGAGCAGCCAGGGG + Intergenic
1139941771 16:70610762-70610784 AGTCCTCAGGGAGTAGCCGTCGG + Intronic
1140795700 16:78435441-78435463 TGTCCTCTGGGAGCAGCCTTGGG + Intronic
1142210506 16:88806264-88806286 TGTGCTCAGGGTGCAGCCGCAGG + Intronic
1142425842 16:90001860-90001882 TGTCCTGGGTGAGCGGCCGGAGG + Intergenic
1142756463 17:2019191-2019213 TTTCCTCGGGGTGCAGTGGCCGG - Intronic
1144380556 17:14693288-14693310 TGGCCTCGGTGAGCAGCCTTAGG + Intergenic
1144520958 17:15951900-15951922 TGCCCTCTGGGAGCAGCTCCAGG - Intronic
1150283326 17:63941886-63941908 TGGCCCCGCGGATCAGCCGCAGG + Exonic
1152484880 17:80583962-80583984 TGTCCTCGGGCAGCTGCCTGTGG + Intronic
1152571582 17:81123477-81123499 TGTCCTCAGGGAGGGGCGGCTGG - Intronic
1152956264 18:44665-44687 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1153689050 18:7573414-7573436 TGTCCACGGGGAGCATCTGGAGG + Intronic
1159608491 18:70499484-70499506 GGTCTCCGGGGAGCTGCCGCTGG + Intergenic
1160810474 19:1010943-1010965 TGCCCTCTGGGAGCAGCGGCTGG - Intronic
1161052754 19:2173489-2173511 CGTCCTCGGGGAGCAGGCAGAGG + Intronic
1161054916 19:2185946-2185968 TGTCCTCGGAGCGGAGCGGCTGG - Intronic
1162389434 19:10380449-10380471 GGTCCTCAGGAAGAAGCCGCGGG - Exonic
1162421570 19:10568703-10568725 TGTCAGCGCGGAGCAGCCGGCGG + Exonic
1162811112 19:13164697-13164719 TTTCCTCGGGGTGCAGCTGCAGG + Intergenic
1163400366 19:17088493-17088515 ACTCCTCGGGGAGCAGCTGGGGG - Intronic
1164498745 19:28793836-28793858 TGTCCTCGGCCAGCCGCCGTGGG + Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
925178834 2:1803651-1803673 TGTCCTGGGGGACCACCCTCAGG + Intronic
927858496 2:26542744-26542766 TGCCCTCAGGGAGCAGCCTGTGG + Intronic
928200888 2:29246934-29246956 TGGCCTCGGGGAGCCGAGGCTGG - Intronic
931694279 2:64860026-64860048 TGGCCCCGGGAGGCAGCCGCGGG + Intergenic
933656843 2:84895478-84895500 TGTCTTTGGGGATCAGCTGCTGG + Intronic
934661313 2:96145093-96145115 GGTCCGCGGGGAGCTGGCGCGGG - Exonic
935375157 2:102388180-102388202 TGTGCTGGGGGAGCTGCCCCTGG - Intronic
937132560 2:119524325-119524347 GCTCCTCGGGGCGCAGCGGCCGG - Exonic
937888081 2:126914143-126914165 TGTCCCCAGGGAGCAGACCCAGG - Intergenic
938012698 2:127841557-127841579 TGTCCCCAGGCAGCAGCCCCAGG - Intergenic
938450197 2:131411640-131411662 TGGCCTGGGGGAGCAGCTGGGGG - Intergenic
943847631 2:192672638-192672660 TGAACTTGGGGAGAAGCCGCAGG - Intergenic
948374030 2:237509247-237509269 TGTCCTGGGGCAGCAGCTGGAGG - Intronic
1172385155 20:34529039-34529061 TGGCCTGTGGGAGCAGCCCCTGG - Intronic
1172846122 20:37930879-37930901 TGTCCTCCTGGAGCTGCCGCAGG + Intronic
1175248302 20:57594340-57594362 GGACCTCGGGGACCAGCCCCTGG + Intergenic
1176034720 20:63030623-63030645 GGTCCTTGAGGAGCAGCAGCTGG - Intergenic
1178992497 21:37367280-37367302 CCTCCTCGGGAAGAAGCCGCCGG + Intronic
1180083128 21:45495508-45495530 TGGCCTCTGGGAGGAGCTGCAGG - Intronic
1180180849 21:46118133-46118155 AGGCCTCGGTGAGCAGCGGCGGG - Intronic
1181007963 22:20023165-20023187 TGCACCAGGGGAGCAGCCGCTGG - Intronic
952827777 3:37538339-37538361 GCTCCTCGGGAAGCAGCCGGGGG + Intronic
959938583 3:112056818-112056840 TGTATTCAGGGAGCAGCTGCTGG - Intronic
961537693 3:127580035-127580057 TGTCTTCGTAGAGCAGCAGCAGG + Exonic
968358073 3:198123576-198123598 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
969210563 4:5683972-5683994 TGTCCTCAGGCAGGAGCCTCAGG - Intronic
969557730 4:7924707-7924729 TGTCCTGGGCGGGCAGCTGCAGG - Intronic
971076079 4:23151504-23151526 TGGCCTAGGGGAGAAGCAGCTGG + Intergenic
971237630 4:24856898-24856920 TGTCCCTGGGGAGCAGCGGGAGG + Intronic
971422018 4:26482049-26482071 TGTCCACCGGCAGCAGCAGCAGG - Exonic
973110405 4:46390379-46390401 CGGCCTCGGGGAGCAGCCCGAGG - Intronic
985528226 5:418589-418611 TGCCCTCCCTGAGCAGCCGCAGG - Intronic
985769002 5:1797434-1797456 TCTCCAGGGGGAGCAGACGCCGG - Intergenic
985930797 5:3056145-3056167 TCTCCTCTGTGAGCAGCCTCTGG - Intergenic
992494966 5:77282922-77282944 TGACCTCGGGGAGCACTCCCTGG + Intronic
999192172 5:149756578-149756600 TGGCCTCGGGGACCAGCGTCAGG + Intronic
1002468896 5:179422929-179422951 TGTCCTCGGGGAAGACCCTCTGG - Intergenic
1002818640 6:701782-701804 AGTCTTAGGGCAGCAGCCGCTGG + Intergenic
1007221157 6:40279988-40280010 TGTCCTCGGGGAGCTTACGCTGG - Intergenic
1007250161 6:40489927-40489949 TGAACTTGGGGAGCAGCAGCTGG - Intronic
1007810241 6:44480533-44480555 TCTCCTTGGTGAGCATCCGCAGG - Intergenic
1012624972 6:101393776-101393798 GGTCCTCGGGGAGGAGCAGCCGG - Intergenic
1015492122 6:133838100-133838122 AGCCCCCGGGGAGCAGGCGCGGG - Intergenic
1018229707 6:161663846-161663868 GGACCACGAGGAGCAGCCGCCGG + Intronic
1019110140 6:169702627-169702649 TGCCCTCGTGGTTCAGCCGCAGG - Exonic
1019415564 7:925219-925241 GGTCTTCGGGGAGCAGGGGCTGG - Intronic
1019606708 7:1913689-1913711 TGTCCTGGGGGAGAGGCCACTGG - Intronic
1019688161 7:2394034-2394056 TGACCTAGGGGTGCAGCAGCAGG + Intergenic
1020910588 7:14125709-14125731 TGTCCCCCAGGAGAAGCCGCAGG + Intergenic
1023157576 7:37266080-37266102 TGTCCTTGGGCAGCAGCCTGGGG + Intronic
1023219075 7:37899828-37899850 TGGCCTGGGGGAGCAGCTGGGGG - Intronic
1023601633 7:41886627-41886649 TGTCCTCTGGAAGCAGCCCAGGG - Intergenic
1023616852 7:42028894-42028916 TGTCCTCGGGGAGCAGGGGTAGG + Intronic
1023981723 7:45074365-45074387 TGTCCCCGTAGAGCTGCCGCAGG - Exonic
1024356288 7:48416674-48416696 TGTCCTCTGGGAGCGCCTGCAGG - Intronic
1024531863 7:50400183-50400205 TGGCCTTGGAGAGCAGCAGCAGG - Exonic
1024970657 7:55066756-55066778 TGACCTCAGGGAGCAGCCAGAGG - Intronic
1026902408 7:74044484-74044506 TGTCCTCGGGGGCCCGCCTCGGG - Intronic
1032525695 7:132577077-132577099 CCTCCCCGGGGAGCAGCCGGCGG - Exonic
1034546953 7:151795320-151795342 TCTCCTCGAGGACCAGCAGCAGG + Intronic
1035168513 7:157005453-157005475 GGGCCTCCGGGAGAAGCCGCCGG + Exonic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1038692164 8:29773630-29773652 TCTCCACGGCGGGCAGCCGCAGG + Intergenic
1052374684 9:27705786-27705808 TGTCCTTGGGGAACAGCAGCAGG - Intergenic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1058884632 9:109314077-109314099 TGCCCTCAGGCAGCAGCCACGGG + Intronic
1060263044 9:122092752-122092774 TGTCCACGGTGACCGGCCGCTGG + Exonic
1060736788 9:126071220-126071242 TGGGCCCGGGGAACAGCCGCAGG - Intergenic
1061132163 9:128714272-128714294 TGTGCTCGGGGAGCTGCAGGGGG - Exonic
1061873848 9:133534435-133534457 TGTCCAGACGGAGCAGCCGCTGG - Intronic
1062503081 9:136859518-136859540 TGTCCCTGGGGTGCAGCCTCTGG + Intronic
1062741940 9:138180111-138180133 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG + Exonic
1187446975 X:19369014-19369036 CCTCCTCTGGGAGCAGGCGCTGG - Intronic
1187698077 X:21940781-21940803 ATGCCTGGGGGAGCAGCCGCGGG - Exonic
1188445986 X:30253640-30253662 TTTCCTCTGGGAGCAGGTGCAGG - Intergenic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1197569224 X:128128484-128128506 TGTCCTCGGTGAGCATCAGAGGG + Intergenic