ID: 1186509076

View in Genome Browser
Species Human (GRCh38)
Location X:10117147-10117169
Sequence TGTCCTCGGGGAGCAGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186509066_1186509076 19 Left 1186509066 X:10117105-10117127 CCATGCTGTCTCATTTCAGCCTG 0: 1
1: 0
2: 0
3: 26
4: 453
Right 1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162
1186509069_1186509076 -8 Left 1186509069 X:10117132-10117154 CCAGCACCCTGACGGTGTCCTCG 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162
1186509067_1186509076 0 Left 1186509067 X:10117124-10117146 CCTGTGTGCCAGCACCCTGACGG 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1186509076 X:10117147-10117169 TGTCCTCGGGGAGCAGCCGCGGG 0: 1
1: 0
2: 0
3: 15
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186509076 Original CRISPR TGTCCTCGGGGAGCAGCCGC GGG Exonic