ID: 1186509090

View in Genome Browser
Species Human (GRCh38)
Location X:10117198-10117220
Sequence GCTCAGGGAGCCCCGGCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 1, 2: 3, 3: 43, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186509090_1186509096 -7 Left 1186509090 X:10117198-10117220 CCTCCAGCCGGGGCTCCCTGAGC 0: 1
1: 1
2: 3
3: 43
4: 367
Right 1186509096 X:10117214-10117236 CCTGAGCTCGGTCAGCTTCACGG 0: 1
1: 0
2: 1
3: 9
4: 114
1186509090_1186509097 3 Left 1186509090 X:10117198-10117220 CCTCCAGCCGGGGCTCCCTGAGC 0: 1
1: 1
2: 3
3: 43
4: 367
Right 1186509097 X:10117224-10117246 GTCAGCTTCACGGACATCTACGG 0: 1
1: 0
2: 1
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186509090 Original CRISPR GCTCAGGGAGCCCCGGCTGG AGG (reversed) Exonic
900137626 1:1125078-1125100 GCGGTGGGAGCCCCGGCTGCTGG + Intergenic
900197037 1:1381709-1381731 GCTCAGGGGGCTCAGGCTAGGGG - Intergenic
900360100 1:2284216-2284238 CCTGAGGGAGCCCCGGCCAGTGG - Intronic
900616839 1:3569285-3569307 CCTTTGGGAGCCCCGGCTGAGGG - Intronic
900663216 1:3796380-3796402 GCTGACGGGGCCCGGGCTGGAGG - Exonic
900671592 1:3857865-3857887 GCTCAGGAACCCCAGGCTGCGGG - Intronic
900880505 1:5377969-5377991 TCTCAGGGGGCTCTGGCTGGTGG + Intergenic
901022315 1:6261466-6261488 GCTCAGGGAGACCTTCCTGGAGG + Intergenic
901450370 1:9333008-9333030 GCTCAGTGAGCACTTGCTGGTGG - Intronic
901451629 1:9339697-9339719 GGTCAGGGCGACCCTGCTGGAGG - Intronic
901773035 1:11540459-11540481 GCTCAGGGAACCTTGGCAGGGGG - Intergenic
901811320 1:11768203-11768225 GCTCCGGGAGGCTCAGCTGGAGG + Exonic
902332726 1:15738440-15738462 GCTCAGGGTGGCAGGGCTGGGGG + Intronic
902549425 1:17210566-17210588 GCCCAGAGAGCCCAGGCTGAGGG - Intronic
902554617 1:17239655-17239677 GCTCAGGGAGCACTGCCTGGAGG - Intronic
902730730 1:18367039-18367061 GCTCAGGGAGGAGCTGCTGGGGG - Intronic
903292854 1:22325760-22325782 GCTCAGGGTGACCAGGGTGGAGG - Intergenic
904480202 1:30788557-30788579 GCTCATGCATCCCCAGCTGGTGG + Intergenic
904857989 1:33514517-33514539 GCTCGAGGAGCACCTGCTGGTGG - Exonic
906046521 1:42835165-42835187 GGTAAGGGAGCTCAGGCTGGTGG + Intronic
907327631 1:53650927-53650949 GCCCAGGGAGCCCTGGATGTTGG + Intronic
915068783 1:153248264-153248286 GCTCAGGCATCCCCTGCTGAAGG + Intergenic
918043682 1:180928267-180928289 GCACAGGGAACCCAGCCTGGGGG - Intronic
920197157 1:204236347-204236369 GCTCAGGGAGACTGGGATGGTGG + Intronic
920312805 1:205058439-205058461 GGTCAGGAAGGCCCGGCTTGAGG - Intronic
920377647 1:205517810-205517832 GAGCAGGGAGCCCGGGCAGGAGG - Intronic
922648803 1:227318743-227318765 GCTGAGGGAGGCCCGGGCGGCGG + Intergenic
923104493 1:230843741-230843763 GCCCAGGGCGTCCAGGCTGGAGG + Exonic
923403109 1:233634553-233634575 GCTCAGACAGTCCCGGATGGAGG + Intronic
924474865 1:244374183-244374205 GCTGAGGGAGGCCAGGCTGGAGG - Intronic
1063443036 10:6089029-6089051 GGTCAGGGAGCGCGGGCTGCCGG - Intronic
1065010586 10:21417308-21417330 GCTCAGGGAGTCCTTACTGGGGG - Intergenic
1065957397 10:30705699-30705721 GCTCAGTGAGACCCGCCTGCTGG - Intergenic
1066221396 10:33337836-33337858 ACTCAGGGAGCCCCAGCTGAAGG - Intergenic
1067043502 10:42970898-42970920 GCTCTGGGAGCTCCTGGTGGTGG - Intergenic
1068068447 10:52164316-52164338 GCTCTGGTCGCCCAGGCTGGAGG - Intronic
1068767419 10:60778772-60778794 GCTATGGGAGCCCAGCCTGGCGG + Intronic
1071858007 10:89645159-89645181 GCGGCGGGAGCCCCGGCTGGGGG - Exonic
1072520952 10:96229738-96229760 TCTCAGGGAGCTGCGGCTGCTGG + Intronic
1073447985 10:103592408-103592430 CCTCTGGGATCCCTGGCTGGGGG - Exonic
1075892195 10:125961833-125961855 ACTCAGGGAGCTCAGGCAGGTGG + Intronic
1076180374 10:128402355-128402377 GCTCAGGCAGCAAGGGCTGGGGG + Intergenic
1076378960 10:130012041-130012063 GCTCCAGGAGCCCAGGCTGGCGG - Intergenic
1077142127 11:1029351-1029373 GCCCAGGGTGCACCGGCTGTGGG + Exonic
1077247523 11:1546812-1546834 GTTCGGGGAGCGCCGGGTGGGGG + Intergenic
1077529065 11:3086700-3086722 GCTCAGGGTGCCCCTGAAGGCGG - Intergenic
1078011594 11:7576696-7576718 CCCCAGGGTGCCCTGGCTGGTGG + Intronic
1078180200 11:9004451-9004473 GACCCTGGAGCCCCGGCTGGCGG - Intergenic
1080508832 11:32946504-32946526 TGTCAGGGTGCCCCTGCTGGAGG + Intronic
1080645825 11:34186796-34186818 GCTCTGGGAGGCCAGCCTGGGGG - Intronic
1081488260 11:43547904-43547926 GCCCAGGGAGCCCGAGCTGGGGG - Intergenic
1083920342 11:65778929-65778951 GCTGAGGGAGCCCCTGAAGGTGG - Exonic
1084008468 11:66335200-66335222 GCTCAGCGGGGCCCGGCTGGAGG - Exonic
1084008825 11:66336605-66336627 GCTCTGAGGGCCCCAGCTGGGGG + Intronic
1084296221 11:68214429-68214451 CCTCGGGGATCCCGGGCTGGCGG + Intergenic
1084669107 11:70594990-70595012 GCTCAGAGAGACCCGGCTCCCGG - Intronic
1084971424 11:72774319-72774341 CTTCAGGGAGCCCAGGCTGAGGG + Intronic
1085261135 11:75205302-75205324 CCTCAGGGAGCCACGGTTGAGGG + Exonic
1085353494 11:75815603-75815625 GCTCTGGGTGTCCCGGCTCGCGG - Intronic
1086134817 11:83434983-83435005 GCTTAGGAATCCCAGGCTGGGGG + Intergenic
1089135546 11:116246242-116246264 GCTAAGGGAGCAAGGGCTGGTGG - Intergenic
1089521321 11:119066223-119066245 TCTCAGGGAACTCTGGCTGGTGG + Intergenic
1089595043 11:119573222-119573244 ACTCAGGCCGCCCCTGCTGGTGG - Intergenic
1089739129 11:120570057-120570079 GCTCCGGGAGCCCCTCCTGTTGG + Intronic
1091356261 11:134940143-134940165 GCTCAGGGAGCACCCCCTGGTGG + Intergenic
1091614283 12:2037125-2037147 GCTCAGAGAGCTTTGGCTGGTGG - Intronic
1092123077 12:6057936-6057958 GCTGGCGGAGCCCCGGGTGGAGG - Exonic
1092125480 12:6072287-6072309 GCTCTGGGAGACCTGCCTGGGGG - Intronic
1092226690 12:6752751-6752773 GCTTAGTGAGGCCCGCCTGGGGG - Intronic
1092899263 12:13043596-13043618 GCTCAGGGAGCCAAGGAAGGAGG + Intergenic
1096669067 12:53187591-53187613 GCGCAAGGGGCCCCGGGTGGTGG + Exonic
1096688923 12:53307607-53307629 GCCCAGGAACCCCCTGCTGGGGG - Exonic
1097225978 12:57477004-57477026 ACTCAGGGATCCCTGGCTGAAGG + Intronic
1099445239 12:82744027-82744049 GCTCTGGGAGGCCAGGCGGGAGG + Intronic
1099989628 12:89708804-89708826 GAGTAGGGAGCCCCGGCTGGTGG - Exonic
1101899030 12:108777362-108777384 GTTCATGGAGCCCCTGCTGTGGG - Intergenic
1104731081 12:131105683-131105705 GGCCAGGGAGCCCAGCCTGGGGG + Intronic
1104843055 12:131833816-131833838 GCCCAGGGCACCCTGGCTGGCGG - Intronic
1104923454 12:132303255-132303277 GCTCAAGGTGCCCGGGGTGGGGG - Intronic
1104985373 12:132593636-132593658 GCTCTGGGACCCCTGGCTGCGGG - Intergenic
1105535194 13:21259360-21259382 GGTTAGGGAGCAGCGGCTGGGGG + Intergenic
1105606527 13:21930702-21930724 CCTCAGGAAGCCCCAGCTGCTGG + Intergenic
1105780612 13:23702476-23702498 GCTCAGGGAGGCCCGGCTTATGG + Intergenic
1105975156 13:25467023-25467045 AGTCCGGGAGCCCCAGCTGGTGG + Intronic
1107735660 13:43396410-43396432 GCTCTTGTAGCCCAGGCTGGAGG + Intronic
1108570402 13:51743997-51744019 ACTCAGGGACCCCCGTCTGGGGG - Intronic
1110364558 13:74667397-74667419 GCTCAGGTGGCCCAGGCAGGAGG - Intergenic
1113379356 13:109787519-109787541 GCTCAGGGACCGCTGGCTCGCGG - Intergenic
1113773597 13:112929140-112929162 GCACAGGGAGCTCCAGCTGTTGG + Intronic
1113799878 13:113080778-113080800 GCTCAGGGAGGCCGGGCAGCAGG + Intronic
1114499018 14:23154376-23154398 GGTCTGGGTGCCCAGGCTGGAGG + Intronic
1114634986 14:24182333-24182355 GCCCTGGCAGCCGCGGCTGGGGG - Exonic
1115761032 14:36579854-36579876 GCTGAGGGAGGGCCGCCTGGGGG - Intergenic
1116959148 14:50952259-50952281 GCACAGGGAACCCCTGCTGAGGG + Intergenic
1118259732 14:64235730-64235752 GCTCAGAGAGCTCCAGATGGTGG - Intronic
1118903056 14:70002533-70002555 GCTCTGGGAGCCCCTGATGAGGG - Intronic
1119321903 14:73737110-73737132 ACTGAGGCAGCCCAGGCTGGAGG - Exonic
1120942735 14:89964294-89964316 CCTCAGGGAGCACCTGCAGGAGG + Intronic
1121509506 14:94501770-94501792 ACTCAGGGAGCCAGGGCAGGAGG - Intronic
1121684041 14:95818809-95818831 TCTCAGGGAGTGCTGGCTGGGGG + Intergenic
1121822623 14:96983758-96983780 GCTCAGGGAGGCAGGTCTGGGGG - Intergenic
1122104301 14:99440569-99440591 GGTCAGTGAGCCCTGGCTGGAGG + Intronic
1122256252 14:100479261-100479283 GCTCAGGGAGCACAGGCAGAGGG - Intronic
1122421430 14:101579855-101579877 GCTCAGGCAGGGCCAGCTGGGGG - Intergenic
1122471975 14:101974818-101974840 GCTTACGGAGGCCGGGCTGGTGG - Intronic
1122794510 14:104199352-104199374 GCTCGGGGTCCCACGGCTGGTGG + Intergenic
1122923003 14:104887614-104887636 GCTGAGGCGGGCCCGGCTGGGGG + Exonic
1123063792 14:105606224-105606246 GCTCAGGGAACGCAGGCTGGGGG + Intergenic
1123699984 15:22907252-22907274 AGTCAAGGAGCCCAGGCTGGTGG - Intronic
1124249461 15:28097388-28097410 GCTGAGGGAGCTCCGGCTTGTGG + Intronic
1124342346 15:28898048-28898070 GCTCAGGGAGCACCGGCAGCTGG + Intronic
1124999284 15:34754376-34754398 GGTCAGGGGGCCCCGTCGGGCGG - Intronic
1125200965 15:37100550-37100572 GATCGGACAGCCCCGGCTGGGGG + Intronic
1125833240 15:42730680-42730702 GCTCACCGTGCCCTGGCTGGTGG - Exonic
1126392767 15:48177855-48177877 GGTCTGGGAGCCGGGGCTGGGGG - Intronic
1126407128 15:48332361-48332383 GCGCGCGGAGCCCCGGGTGGGGG - Exonic
1129108733 15:73325297-73325319 GCTAAGCGAGCCCCTGCGGGAGG - Exonic
1129604736 15:77019347-77019369 GCTCAGGGCCCCTCGGCAGGAGG - Intronic
1131832640 15:96363506-96363528 GTTCAGGGAGCGCGGGGTGGGGG - Intergenic
1132050821 15:98606425-98606447 GCTCAGGGAGGTCAGGCGGGAGG - Intergenic
1132507993 16:322111-322133 GCACAGAGAGCCCCGTCTTGTGG + Intronic
1132659570 16:1055336-1055358 GCTCAGGGAGCCGAGGCCCGGGG + Intergenic
1132685403 16:1159956-1159978 GCTCCAGGAGCCCGGCCTGGTGG - Intronic
1132738571 16:1399333-1399355 GCTCAGAGGACTCCGGCTGGTGG - Intronic
1132853043 16:2033376-2033398 GCTCCCGGAGCCCGGGCAGGTGG - Intronic
1132926070 16:2429647-2429669 GCGCAGGGAGCCCCGGCGGCCGG + Intronic
1133021278 16:2967977-2967999 GCGCAGGGAGCTCTGGCTGGAGG - Exonic
1133036191 16:3035623-3035645 GCCCAGGAAGCCCTGGCTGCAGG - Intronic
1133045675 16:3087147-3087169 GCTCAGGGAGCCTCCCCTGTGGG - Intergenic
1133175315 16:4010123-4010145 GCTCAGGGTGCCCCTGCCTGAGG + Intronic
1134144883 16:11752891-11752913 TTCCAGGGAGCCCAGGCTGGTGG + Intronic
1134550344 16:15135957-15135979 GCGCCGGGCACCCCGGCTGGTGG + Intronic
1134742465 16:16560076-16560098 GCCCAGGGAGACCCCACTGGAGG + Intergenic
1134880766 16:17743737-17743759 AATCAGGGAGGCCCGGCTGGTGG - Intergenic
1134925098 16:18152383-18152405 GCCCAGGGAGACCCCACTGGAGG - Intergenic
1136146605 16:28320069-28320091 CCTCAGGGAGCCCCACCTGCGGG - Exonic
1136146678 16:28320462-28320484 GCGAAGGCAGCCCCGGCAGGCGG - Exonic
1136551751 16:30985748-30985770 GCAGCGGGAGCCCCGGCTCGGGG + Exonic
1136683650 16:31981949-31981971 GCGGCGGGAGCCCGGGCTGGCGG + Intergenic
1137650132 16:50112770-50112792 GCTCAGGAGGCCACGGCAGGAGG + Intergenic
1138250292 16:55496959-55496981 GCCCATGGGGCCCCTGCTGGTGG + Exonic
1138763118 16:59567729-59567751 CCACAGGGAGTCCCGGCAGGGGG - Intergenic
1139207625 16:65044581-65044603 GGTCTAGGAGCCCCTGCTGGAGG + Intronic
1139580883 16:67873044-67873066 GTTCCGGGAGCCTCGGCTCGTGG + Exonic
1139613036 16:68072594-68072616 AGTCGGGGCGCCCCGGCTGGTGG - Intronic
1140471670 16:75218899-75218921 GCTCAGGCCTCCCTGGCTGGGGG + Intergenic
1140864351 16:79046962-79046984 GGTCAGGTAGCTCAGGCTGGGGG - Intronic
1141091960 16:81136522-81136544 CCTCAGGGAGCACTGGCTGCGGG - Intergenic
1141510121 16:84506406-84506428 ACTCAGGGAGCCGAGGCAGGAGG + Intronic
1141546752 16:84775610-84775632 ACGCAGGGATCACCGGCTGGGGG - Intronic
1141770487 16:86086981-86087003 GATCAGAGAGTCCCGGGTGGAGG + Intergenic
1142361678 16:89630580-89630602 GCTGGGGGAGCCGGGGCTGGGGG + Intronic
1142361692 16:89630609-89630631 GCTGGGGGAGCCAGGGCTGGGGG + Intronic
1142361740 16:89630699-89630721 GCTGGGGGAGCCGGGGCTGGGGG + Intronic
1142762469 17:2050384-2050406 GCCCCGGCTGCCCCGGCTGGGGG + Intergenic
1143526602 17:7476767-7476789 GCTCAGGGATCCCCAGCTGAGGG - Intronic
1143747839 17:9006390-9006412 GCTGAGGGGGCCCAGGCAGGAGG + Intergenic
1143904326 17:10197660-10197682 GCTGAGGGGGCTCGGGCTGGTGG + Intronic
1147123709 17:38351957-38351979 GCTCCGGGGGCCGCGGCGGGCGG + Intergenic
1147781640 17:42947221-42947243 GCTCAGGGAGTCTCAGCAGGGGG + Intergenic
1148284111 17:46372876-46372898 GGTCTGGGAGCCCAGGCTTGAGG + Intergenic
1148306332 17:46590797-46590819 GGTCTGGGAGCCCAGGCTTGAGG + Intronic
1148734635 17:49858571-49858593 CCTCCGGGAGCACTGGCTGGTGG - Intergenic
1149107015 17:52981669-52981691 TCTCAGGGAGCACAGGGTGGTGG + Intergenic
1149683777 17:58523296-58523318 GCCCGGGGAGCCCCGGGAGGTGG + Intronic
1151890879 17:76949723-76949745 GCTCTGGGACCCCTGCCTGGGGG + Exonic
1152111720 17:78360549-78360571 CCTCGGGGAGGCCCGGGTGGCGG - Intergenic
1152307018 17:79527038-79527060 GCTCAGGCTGCCCAGGGTGGGGG - Intergenic
1153514230 18:5890492-5890514 GCTCCCGGAGTCCCGCCTGGTGG + Exonic
1153752139 18:8243473-8243495 GCTCAGAGAGCTCAGGCTGTAGG - Intronic
1154216624 18:12420687-12420709 GATCAGGGGGCACGGGCTGGGGG + Intronic
1154300112 18:13185030-13185052 GCCCAAGGAGGCCTGGCTGGTGG + Intergenic
1154498372 18:14979154-14979176 GCTCAGGGAGCGCCCCCTTGTGG - Intergenic
1157098749 18:44711070-44711092 GATCAGTGAGCCCCCGCTGCTGG + Intronic
1157530975 18:48420139-48420161 GCTCAGGGAGGCATGGCTGGAGG - Intergenic
1159258166 18:65975971-65975993 ACTCAGGGGGCCGAGGCTGGAGG + Intergenic
1160190476 18:76710748-76710770 CCTCAGGTAGCCCCGCCTGGTGG - Intergenic
1160306924 18:77748597-77748619 GGTAAGGGAACCCCTGCTGGGGG - Intergenic
1160793432 19:933303-933325 TCTCAGGGACCCCAGGCTGAAGG + Intronic
1160842150 19:1150968-1150990 GCTCAGGGTGCCCAGGCTGCCGG - Intronic
1160843868 19:1158195-1158217 GCTCAGGGACCCCCAGGGGGAGG - Intronic
1161042147 19:2116002-2116024 GAACAGGGCCCCCCGGCTGGAGG + Intronic
1161167920 19:2798433-2798455 GCAGAGGCAGCCCCGCCTGGAGG + Intronic
1161200067 19:3009638-3009660 GCTGTGGGAGCCCAGGCTGAAGG + Exonic
1161221547 19:3120328-3120350 GCTCAGAGAGCCCTGGTGGGGGG + Intronic
1161979755 19:7624273-7624295 CCTCTGGGGGCCCCGGCTGGTGG - Intronic
1162234272 19:9294378-9294400 ACTCAGGGAGCTGAGGCTGGAGG - Exonic
1162523146 19:11193633-11193655 GGTCAGGGAGCCCAGGCCGGTGG + Exonic
1162545240 19:11325204-11325226 CCTCAGGCAGCCCCGGTGGGAGG - Exonic
1162802368 19:13118489-13118511 CCTCGGGCCGCCCCGGCTGGAGG - Intronic
1163290532 19:16376682-16376704 GCTCAGGGAGGGCCTGTTGGGGG - Intronic
1164598826 19:29547750-29547772 GCTCAGGGAGGGCTGCCTGGAGG + Intronic
1164995710 19:32719651-32719673 GCCCTGGGAGGCCCGGCTAGGGG - Intergenic
1165152059 19:33766729-33766751 GCTCAGGCTGGCCCGACTGGGGG - Intronic
1165660756 19:37578516-37578538 GCTCAGGGATCCGGGGCTTGTGG - Intronic
1166368974 19:42291112-42291134 GCCCAGGGGGCCCCTGGTGGTGG + Exonic
1166677283 19:44747862-44747884 GCCCCGCGGGCCCCGGCTGGGGG + Intronic
1167162816 19:47778878-47778900 GGTCAGGGAGCCCCGGGGAGAGG + Intronic
1167641869 19:50686837-50686859 GCCCAGGGAGCCCCCGGGGGCGG + Intronic
1167940647 19:52943127-52943149 GCTCAGGAAGCAGCGGCGGGAGG + Intronic
1168146361 19:54421714-54421736 GCTCAGGGACCCCCGCCCTGAGG + Intronic
1168238071 19:55076007-55076029 TCTCAGGGAGGACGGGCTGGGGG + Intronic
925751242 2:7091756-7091778 TCTCGGGGAGCCCAGGCTGGAGG - Intergenic
926138728 2:10355895-10355917 GCACCGGGAGCCCCTGCCGGAGG + Intronic
926171564 2:10555972-10555994 GCTGAGGGACCCCCGGAGGGAGG - Intergenic
927413824 2:22856041-22856063 GCCCAGGGACCCCAGGCAGGAGG + Intergenic
927962510 2:27249893-27249915 GCTCAGGAAGCCGAGGCAGGAGG + Intergenic
928172623 2:29013050-29013072 CCTCAGGCAGCCTCAGCTGGTGG + Intronic
928200886 2:29246931-29246953 CCTCGGGGAGCCGAGGCTGGAGG - Intronic
929611799 2:43276245-43276267 CATCAGGGAGCCCCAGCTGCAGG - Intronic
929882920 2:45852887-45852909 ACTCAGGCAGCCCAGGATGGGGG + Intronic
929993962 2:46813333-46813355 GGTCAGCCAGGCCCGGCTGGAGG + Intergenic
930730417 2:54723614-54723636 GCCCCCGGAGCCCCGGCTGGAGG + Intronic
932447070 2:71787613-71787635 GCTCAGGGAGTGGCTGCTGGTGG + Intergenic
933376074 2:81481622-81481644 GCTCAGCGAGCCATGGGTGGGGG + Intergenic
934924541 2:98372873-98372895 GTTCAGTAAGCCTCGGCTGGTGG - Intronic
936537587 2:113324119-113324141 GCTCCTGGGGCCCCGGGTGGGGG - Intergenic
937118613 2:119427001-119427023 GCGCAGGGAGCCCTAGCTGGAGG + Intergenic
937961588 2:127464176-127464198 ACTCAGAGAGCCAGGGCTGGGGG + Intronic
938119930 2:128626161-128626183 GCTCAGGGAGACCAGCCTGCAGG - Intergenic
938639847 2:133266799-133266821 GCTCAGGGAGGCCCCTCGGGTGG + Intronic
940904497 2:159157058-159157080 GCTCTGGGAGCCCCGTATGCTGG - Intronic
945602819 2:211889273-211889295 TGTCAGTGTGCCCCGGCTGGGGG - Intronic
947658624 2:231849775-231849797 CCTCAGGGGACCCAGGCTGGAGG + Intergenic
947718922 2:232355977-232355999 GGTCAGTGTGCCCCTGCTGGGGG - Intergenic
948436685 2:237958509-237958531 GCTCAGGAAGGCCTGGCTGCAGG - Intergenic
948565028 2:238879463-238879485 GGCCAGGTAGTCCCGGCTGGAGG - Intronic
948825529 2:240571895-240571917 GCCCAGGCAGCCTCGCCTGGAGG - Intronic
948836198 2:240627093-240627115 CCTCAGGGAGCTCCCGCTGCCGG - Intronic
948916906 2:241039109-241039131 GATCAGGGAGCCCCTGTGGGGGG - Intronic
948936368 2:241167547-241167569 GCTCAGGGAGGCCAGGGTGCAGG - Intronic
949032452 2:241803445-241803467 GCTCGGGGCGCCCCGGAAGGCGG - Exonic
1169832530 20:9839587-9839609 GCTCAGCAACCCCAGGCTGGAGG - Intergenic
1171464553 20:25318477-25318499 CCTCAGGGGGACCCGGGTGGTGG + Intronic
1172273461 20:33667350-33667372 GCTGTGGGAGCGCCTGCTGGTGG + Exonic
1172304455 20:33871325-33871347 GCTCAGGGTCCCCCGGCTGCAGG + Intergenic
1172304488 20:33871427-33871449 GCTCAGGGTCCCCGGGCTGCAGG + Intergenic
1172854990 20:37994786-37994808 GTTCAGGGAGCCTCAGGTGGAGG - Intronic
1172942508 20:38664118-38664140 GCCCAGGGAACCCTGCCTGGTGG - Intergenic
1173175609 20:40762742-40762764 GCTCAGGAGGCCCAGACTGGGGG + Intergenic
1173564137 20:44027360-44027382 GCTCAGGGATCCCAGGCAGGTGG - Intronic
1173737478 20:45372415-45372437 GCCCAGGGAGCCCCAAGTGGAGG - Intronic
1174174425 20:48636003-48636025 GCTCCTGGAGCCCCTGCTGCTGG - Intronic
1175132829 20:56802433-56802455 GCTCAAGGTGCACAGGCTGGTGG - Intergenic
1175165866 20:57044085-57044107 GTTCAGCGAGCCCTGGCTAGGGG + Intergenic
1175166439 20:57047692-57047714 GTTCAGTGAGCCCTGGCTAGGGG + Intergenic
1175545937 20:59777856-59777878 GCTCAGGGGCCATCGGCTGGAGG - Intronic
1175923475 20:62460952-62460974 GGTCAGGAAGCCCCAGCTGACGG + Intergenic
1175936486 20:62516613-62516635 GCTCAGGGGTCTCAGGCTGGAGG - Intergenic
1176075380 20:63245862-63245884 GCTATGGGAGCCGAGGCTGGAGG - Intronic
1176098640 20:63355178-63355200 GCTCAGAGAGCGCTGGCTGCCGG + Intronic
1176551352 21:8223852-8223874 GCGGTGGGAGCCTCGGCTGGGGG - Intergenic
1176570261 21:8406851-8406873 GCGGTGGGAGCCTCGGCTGGGGG - Intergenic
1176578170 21:8451038-8451060 GCGGTGGGAGCCTCGGCTGGGGG - Intergenic
1179552857 21:42154502-42154524 GCTCAGGGCTCCCAGGGTGGTGG - Intergenic
1179617834 21:42593436-42593458 CCTCAGTGAGCCGGGGCTGGGGG - Intergenic
1179647312 21:42783915-42783937 GCTGAGAGAGCCCAGGCTGCAGG + Intergenic
1179890239 21:44331524-44331546 GTGCAGGGAGCCCCTGGTGGGGG - Intronic
1179921547 21:44510245-44510267 GCGCAGGGATCCCCGGCCTGTGG - Intronic
1179966236 21:44807774-44807796 GCAGAGGGAGCCCTGCCTGGGGG - Intronic
1180011612 21:45055013-45055035 GCTCAGGGTGGCCCTGCGGGAGG + Intergenic
1180054983 21:45352975-45352997 GGTCAGGCCGCCCCGGCTGTGGG - Intergenic
1181003134 22:19997334-19997356 CCACAGGGAGCCACTGCTGGAGG + Intronic
1181037747 22:20178114-20178136 ACTCAGGGTGCCAAGGCTGGTGG + Intergenic
1182141810 22:27966256-27966278 GCTCAGGGCACCACAGCTGGCGG - Intergenic
1182273389 22:29169972-29169994 GCTCAGGGAGTCCAGGTTGGGGG - Intergenic
1182347263 22:29674955-29674977 ACTAAGGCAGCCCCAGCTGGTGG - Intronic
1182356318 22:29723742-29723764 GCTCAGGGAGGCCAGAGTGGTGG + Intronic
1183280062 22:36927289-36927311 GCTCAGGGGGCCCAGGCTGGAGG + Intronic
1183342159 22:37287402-37287424 GCCCAGGGCGCACCTGCTGGAGG - Intronic
1183531052 22:38353538-38353560 GCTCCGGGCGCCCCACCTGGAGG + Intronic
1184493290 22:44823016-44823038 GCAGAGGGAACCCAGGCTGGGGG - Intronic
1185050378 22:48551183-48551205 GCCCTGGGAGCCCAGGCTGAGGG - Intronic
1203256375 22_KI270733v1_random:140796-140818 GCGGTGGGAGCCTCGGCTGGGGG - Intergenic
950423915 3:12914524-12914546 GTTCGGGGAGCACTGGCTGGAGG + Intronic
950684556 3:14607162-14607184 CCCCAGGGAGCGCTGGCTGGGGG - Intergenic
951425649 3:22542215-22542237 ACTCATGGAGCCCAGGATGGAGG + Intergenic
951946488 3:28142744-28142766 GCACAGGGAGTCCTGGGTGGTGG - Intergenic
952189216 3:31004577-31004599 GCTGAAGGAGCCCCAGCTGTTGG - Intergenic
952402862 3:32979007-32979029 GCTCTTGAAGCCCAGGCTGGAGG + Intergenic
952865841 3:37854627-37854649 TCTCTGACAGCCCCGGCTGGGGG - Intergenic
953463429 3:43099576-43099598 GGTCGGGGAGCCCAGGCTGTGGG + Intronic
954222641 3:49163895-49163917 GTTCGGGGAGCACTGGCTGGAGG + Exonic
954451785 3:50575688-50575710 GCTCAGGGAGCTGGGGATGGTGG - Intronic
955228252 3:57078689-57078711 GCTCAGGGCGCTCCGGGCGGCGG - Intronic
956629908 3:71305990-71306012 TCTCAGGGCTCCCAGGCTGGCGG + Intronic
958790740 3:98648245-98648267 GCTCATGTCGCCCAGGCTGGAGG + Intergenic
961648827 3:128407451-128407473 GGGCAGGGAGCCCCAGCGGGTGG + Intronic
961685268 3:128625602-128625624 GCTGCAGGAGCCCCTGCTGGTGG - Exonic
968307411 3:197658827-197658849 GCCCAGGGAGCCCGGACTGCCGG - Intergenic
968903669 4:3442314-3442336 GCTCACGGAGCCCCACCTGGGGG + Intronic
969643348 4:8412269-8412291 GCACAGGGTGCCCCTGCTGTGGG - Intronic
973888515 4:55346603-55346625 GTTCGGGGCGCCCCGGCTCGCGG + Intronic
975118714 4:70705633-70705655 GGCCAGGGCGCCCCGGGTGGAGG - Intronic
976246754 4:83012665-83012687 CCTCCGGGAGCCCGGGCCGGTGG - Intronic
977038030 4:91978949-91978971 TGTCAGGGTGCCCCTGCTGGGGG - Intergenic
981927457 4:150155571-150155593 CCTCAGGGAGTCCCCTCTGGAGG + Intronic
982695338 4:158592539-158592561 GCTCCCGTAGCCCAGGCTGGAGG - Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
983088320 4:163473855-163473877 GTTGTGGGCGCCCCGGCTGGTGG - Intergenic
983882762 4:172951910-172951932 CCTCAGGCAGCCCTGGTTGGTGG - Intronic
983943935 4:173565281-173565303 TTGCAGGGAGCCCTGGCTGGGGG + Intergenic
988264020 5:28927735-28927757 GCTCAGGTGCCGCCGGCTGGCGG + Intergenic
988585615 5:32505104-32505126 TCTCAGGGAGCCGCGGAGGGAGG + Intergenic
990514184 5:56516842-56516864 GTCCAGGGAGCCCCGACAGGTGG + Intronic
991474547 5:67005139-67005161 GCTCAGGCAGCTCCGCCTGTGGG - Intronic
995797999 5:115962105-115962127 GCACACGAAGCCCCAGCTGGCGG + Intergenic
996717753 5:126601234-126601256 GCTCACGGAGCCCGGGCTGCGGG + Intronic
997120205 5:131165388-131165410 CCTCAGGGACCTCCGGCTTGGGG + Exonic
997443842 5:133927136-133927158 GCTCAGGGAGCTGCGGGTCGGGG + Intergenic
997617756 5:135263542-135263564 GCCCAGGGAGACCCGGCCAGAGG + Intronic
998458575 5:142292715-142292737 ACTCAGGGAGCTGAGGCTGGGGG + Intergenic
999188267 5:149729043-149729065 GCTAAGGGAGCCCATGATGGTGG + Intergenic
999384070 5:151141844-151141866 GCTCAGTGAGCGCAGGATGGGGG + Intronic
999606929 5:153326064-153326086 GTTCAGTGTGCCCCTGCTGGGGG - Intergenic
999721736 5:154403514-154403536 GCTCAGGGAGACCCAGCGAGAGG + Intronic
999737149 5:154521372-154521394 GCTCAGGAAACCTCGGCTTGGGG + Intergenic
1001012205 5:168108769-168108791 GCTCAGAGAGCCCCAGCTGCTGG - Intronic
1001780682 5:174366410-174366432 TCTCAGGGAGCCCAGGGTGGGGG - Intergenic
1001970254 5:175949624-175949646 GCTCAGGGAACCCCAGCAGAAGG - Intronic
1002204505 5:177553778-177553800 GCTGAGGGGGCCGCGGCTGCAGG + Intronic
1002247184 5:177894140-177894162 GCTCAGGGAACCCCAGCAGAAGG + Intergenic
1002951861 6:1821350-1821372 GCCAGGGGAGCCGCGGCTGGTGG + Intronic
1004786589 6:18974504-18974526 TCTCAGGGGGACCCAGCTGGGGG + Intergenic
1006224161 6:32522237-32522259 GCCCAGGGAGCCCCGGATGGCGG - Intronic
1006228147 6:32558249-32558271 ACCCAGGGAGCCCTGGATGGCGG - Intronic
1006230750 6:32584440-32584462 GCTCAGGGAGCCCCGGATGGTGG - Intronic
1006449218 6:34096367-34096389 GCTCAGGGAGGGCTGCCTGGAGG - Intronic
1006811893 6:36825462-36825484 GGTCAGGGAGGCCCAGTTGGGGG - Intronic
1007088639 6:39168057-39168079 GCTCAGGGAGCCCCAGTCTGAGG + Intergenic
1007244027 6:40447063-40447085 ACTCAGGGAGCCCAGTCTGAGGG - Intronic
1007244036 6:40447099-40447121 ACTCAGGGACCCCAGTCTGGGGG - Intronic
1007276773 6:40679815-40679837 CCTCAGGGAGCCCCAGCCTGAGG + Intergenic
1007284598 6:40738396-40738418 CCCCAGGGAGCCCCAGCCGGAGG - Intergenic
1007452080 6:41947817-41947839 GGTCAGGGAGACCCGGCAGGAGG - Intronic
1007548536 6:42711541-42711563 CCTCAGGGAGCCCCGGTCTGAGG + Intronic
1007707208 6:43798226-43798248 ACTCAGGGAGCCCCAGTTTGAGG + Intergenic
1007740006 6:44004465-44004487 CCTCAGGGAGCCCCAGTCGGAGG - Exonic
1007740019 6:44004504-44004526 CCTCAGGGAGCCCCAGTCGGAGG - Exonic
1007784312 6:44271084-44271106 GCTCAGGGGTCCCGGGCAGGGGG + Intronic
1007969276 6:46034363-46034385 GCTCAGGGATACCCGAATGGTGG - Intronic
1011395183 6:86898443-86898465 GGTCAGTGTGCCCCTGCTGGGGG - Intergenic
1014076295 6:117239036-117239058 TCTCAGGCAGCCAGGGCTGGTGG - Intergenic
1016899598 6:149088561-149088583 CCCCAGGGAGCCCAGGCTGAGGG + Intergenic
1017646130 6:156541333-156541355 GCTCATGGAGCCCTGGCTGTTGG - Intergenic
1018911947 6:168106354-168106376 GCAGAGGGAGCCCAGGCAGGCGG + Intergenic
1018919001 6:168157899-168157921 GCTCTGGGAGCCGGGGCAGGGGG - Intergenic
1019524423 7:1474378-1474400 GCCCAGTCAGCCCCGGCCGGCGG + Intronic
1019923148 7:4175399-4175421 ACGCAGGGAGCCCCGGCTGGAGG - Intronic
1019989848 7:4683216-4683238 GCTCCAGGAGCCCAGGCCGGTGG - Intronic
1020142652 7:5621070-5621092 GCGCAGGGAGGCCGGGCTTGGGG - Intronic
1021698987 7:23299535-23299557 GCACAGCGAGCCTGGGCTGGAGG + Exonic
1022111449 7:27235051-27235073 GCTCAGGAAGTCCAGGCTGTGGG - Intergenic
1022497547 7:30862482-30862504 CCTCAGAGAGCCAAGGCTGGAGG - Intronic
1026805107 7:73424393-73424415 GCTCGGGGAGCCCCGGCCACGGG - Intergenic
1026979508 7:74518188-74518210 GCTCAGGGAGCCAGGGCTGCTGG + Exonic
1027657874 7:80953495-80953517 GCTCTGGTTGCCCAGGCTGGAGG - Intergenic
1029548273 7:101222710-101222732 GCTGAGGGAGTCCCGCGTGGGGG - Exonic
1029933684 7:104399860-104399882 GATCAGGGAGCCGAGGCAGGTGG + Intronic
1032461073 7:132111914-132111936 GCTTTGGGAGCCCCGGCAGGAGG - Intergenic
1032504632 7:132425916-132425938 GGTCAGGGAGCCTGGGCAGGAGG - Intronic
1035040356 7:155922232-155922254 GCCCTGGGAGCCCCTGCAGGAGG - Intergenic
1035052183 7:156005295-156005317 TCTGAGGGAGCCCCAGGTGGAGG + Intergenic
1035556732 8:572741-572763 GCTCGGGGAGCCCCAGCTTTAGG - Intergenic
1035841132 8:2812733-2812755 GCTCAGGGACCCCTGGAAGGCGG + Intergenic
1035966973 8:4203316-4203338 GCTCAGGGAGACCCATCTGCAGG + Intronic
1036184545 8:6612559-6612581 GGTCAGGAAGCCCAGGGTGGAGG - Intronic
1036293564 8:7517201-7517223 ACCCAGGGACCCCTGGCTGGAGG - Intergenic
1036328997 8:7803794-7803816 ACCCAGGGACCCCTGGCTGGAGG + Intergenic
1036497503 8:9282847-9282869 TCTCAGTGAGCCCAGGCAGGAGG - Intergenic
1039238889 8:35533314-35533336 GGTCAGTGTGCCCCTGCTGGGGG + Intronic
1039433404 8:37543319-37543341 CTCCAGGGAGCCCAGGCTGGAGG + Intergenic
1040578389 8:48674484-48674506 CCTGAGGGAGGCCTGGCTGGCGG - Intergenic
1040725671 8:50379039-50379061 GTTCATGGAGCCCAGGCTGTAGG + Intronic
1041056915 8:53995348-53995370 ACTCAGGAAGCCCAGGCAGGAGG + Intronic
1044411816 8:91892073-91892095 GGTCAGTGTGCCCCTGCTGGGGG - Intergenic
1046285977 8:112092895-112092917 GCTCAGGGATCCAAGGCTTGTGG + Intergenic
1047305733 8:123651813-123651835 GCTGGGGGAGCCCATGCTGGTGG - Exonic
1049357296 8:142195199-142195221 GGTCAGGGAGCCCTGGAGGGTGG - Intergenic
1049988157 9:971000-971022 GCGGAGGGAGCCCCGGCTGCGGG - Intergenic
1050090880 9:2015981-2016003 GGGCGGGGAGCCCAGGCTGGCGG + Intronic
1052982117 9:34457616-34457638 GCGCAGGCAGACCAGGCTGGGGG - Intronic
1054744802 9:68843625-68843647 TGTCAGGCAGCCCCGGTTGGTGG + Intronic
1057186023 9:93058143-93058165 ACTGAGGGGCCCCCGGCTGGGGG - Intergenic
1059102290 9:111483186-111483208 GCCCACTGAGCCTCGGCTGGCGG - Intronic
1059148189 9:111921145-111921167 CCTCAGGAAGCCAAGGCTGGTGG - Intronic
1060506856 9:124204370-124204392 GCTCTGGTTGCCCAGGCTGGAGG + Intergenic
1061293963 9:129667015-129667037 TCTCAGGGTGCCCAGGCTGGTGG + Intronic
1061453367 9:130681057-130681079 GCGAAGGGTACCCCGGCTGGGGG - Intronic
1061509229 9:131050254-131050276 GCTCAGGGTGCCCCGGGAGCGGG - Intronic
1061537471 9:131258867-131258889 GCTCAGGGGGCCCCTGATGGGGG - Exonic
1061753458 9:132796875-132796897 GCTCATGGAGCCCAGGGTGGTGG + Intronic
1061868125 9:133505917-133505939 GCTCAGGCAGCCAGGGCCGGTGG + Intergenic
1062066067 9:134527030-134527052 CCTCAGGGAGCCCCCGCTGTGGG + Intergenic
1062245528 9:135564035-135564057 GGCCATGGAGCCCCGGCTGAGGG - Intronic
1062261015 9:135663473-135663495 GGTCAGAGACCCCAGGCTGGGGG - Intronic
1062272872 9:135717808-135717830 GCTCAGGGAGCCTGGCCTGAAGG + Intronic
1062289624 9:135788723-135788745 CCTCGTGGAGCCCCAGCTGGGGG - Intronic
1062376567 9:136264404-136264426 GCCCAGGGATCCCAGGCGGGAGG - Intergenic
1062412736 9:136433138-136433160 GCTCAGGTGGGCGCGGCTGGAGG - Exonic
1062433281 9:136535369-136535391 GCTCAGGGGCCCAGGGCTGGGGG - Intronic
1062525424 9:136976330-136976352 GGTCAAGGAGCCCAGACTGGGGG - Intergenic
1203472531 Un_GL000220v1:122496-122518 GCGGTGGGAGCCTCGGCTGGGGG - Intergenic
1185461240 X:333625-333647 GCACAGGGAGCTCCTCCTGGTGG + Intergenic
1186213711 X:7276956-7276978 GCTCAGAGATCCCAGGATGGGGG + Intronic
1186509090 X:10117198-10117220 GCTCAGGGAGCCCCGGCTGGAGG - Exonic
1187698231 X:21941294-21941316 GCGCGGCGAGCCCGGGCTGGGGG + Intronic
1188084805 X:25890739-25890761 TCTCAGGGAGCCCCTTCAGGAGG - Intergenic
1189780799 X:44512461-44512483 GCTCAGGAAGCTCAGGCGGGAGG + Intergenic
1189890540 X:45597544-45597566 GCTGAGGGAGCCCCTGAAGGTGG + Intergenic
1192580478 X:72277122-72277144 CCTCGGGCAGCCCCGGCCGGGGG + Intronic
1194397569 X:93404275-93404297 GCTCAGGGTCCCCCTGCTGTGGG - Intergenic
1199440072 X:147857815-147857837 GTTGAGGGAGACCCGGCGGGTGG - Intergenic
1200039534 X:153355474-153355496 GCACAGGGAGCCCAGGGAGGAGG - Intronic
1200149255 X:153943315-153943337 GCACAGGGAGCCCAGGGAGGAGG + Intronic