ID: 1186509140

View in Genome Browser
Species Human (GRCh38)
Location X:10117435-10117457
Sequence CGAGCTTGGGGGCGACAGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186509140_1186509150 11 Left 1186509140 X:10117435-10117457 CCTCGCTGTCGCCCCCAAGCTCG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1186509150 X:10117469-10117491 GCCCTTCCTCCCTGCCTCACGGG 0: 1
1: 0
2: 4
3: 72
4: 568
1186509140_1186509149 10 Left 1186509140 X:10117435-10117457 CCTCGCTGTCGCCCCCAAGCTCG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1186509149 X:10117468-10117490 CGCCCTTCCTCCCTGCCTCACGG 0: 1
1: 0
2: 6
3: 50
4: 452
1186509140_1186509156 23 Left 1186509140 X:10117435-10117457 CCTCGCTGTCGCCCCCAAGCTCG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 1186509156 X:10117481-10117503 TGCCTCACGGGACTCGCCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186509140 Original CRISPR CGAGCTTGGGGGCGACAGCG AGG (reversed) Exonic
900244364 1:1630671-1630693 CGAGCCTGGGGGCGAGGGGGGGG + Intergenic
900473195 1:2864425-2864447 GGGGATTGGGGGCTACAGCGTGG + Intergenic
902698761 1:18157490-18157512 CCAGCTTGTGGGCTGCAGCGTGG - Intronic
904083400 1:27886326-27886348 AGAGCTTGGGGGTGAGAGTGGGG - Exonic
906280017 1:44546724-44546746 CCAGCTTTGGGGTGCCAGCGAGG - Intronic
918040717 1:180912673-180912695 CGAGCTTGGGGACGACGGGGCGG - Intergenic
920698925 1:208203222-208203244 CGAGCTTGGCGGCGGGAGCCCGG + Intronic
924825135 1:247531063-247531085 CGAGCGGGGGAGCCACAGCGAGG + Exonic
1064203094 10:13300517-13300539 CGAGCTTCGGTGCGGCAGGGAGG - Intronic
1071429881 10:85598839-85598861 TGAGCTTGAGGCCGACAGCGGGG + Intergenic
1072613969 10:97037443-97037465 GGAGCTTTGGGGAGACGGCGTGG + Intronic
1074571911 10:114632108-114632130 AGAGCGCGGGGGCGATAGCGGGG - Intronic
1076993723 11:288778-288800 CGAGCCCTCGGGCGACAGCGAGG + Intergenic
1077098429 11:809973-809995 CGACCTCGGTGGCGACAGGGAGG - Exonic
1083596178 11:63919168-63919190 GGAGTTTGGGGGCGACTGTGGGG + Intergenic
1086424777 11:86672421-86672443 CGAGCTCGCGGCCGCCAGCGCGG - Exonic
1095975925 12:47941212-47941234 CTAGATTGGGGGTGACAGGGGGG + Intronic
1096739873 12:53685259-53685281 TGAGCTTGGGGGTGATAGTGGGG + Intergenic
1101916087 12:108897145-108897167 GGAGCTTGGGGGAGGCAGCAGGG - Intronic
1107433044 13:40356696-40356718 CGAGCTGCGGGGCGGCAGTGAGG + Intergenic
1118342465 14:64906415-64906437 CCAGCCTGGGCGAGACAGCGAGG - Intergenic
1122517616 14:102319783-102319805 GGAGGCTGGGGGCGGCAGCGAGG + Exonic
1125479212 15:40069176-40069198 AGGGCTGGGAGGCGACAGCGGGG - Intergenic
1138478165 16:57284225-57284247 CGATCTTGGGGGCGTCCGTGCGG + Intronic
1139443195 16:66979365-66979387 CCAGCTTGGGGGCAGCAGGGAGG - Intergenic
1140985223 16:80152396-80152418 CGAGCTTGGGGGAGGCAAGGAGG - Intergenic
1141407711 16:83808307-83808329 CGGGCTTGGGGGCGCCCGCGGGG - Intronic
1141570300 16:84930001-84930023 AGAGCGTGGGGGCGGCAGCCTGG - Intergenic
1142863434 17:2776868-2776890 CGAGGGAGGGGGCGACCGCGGGG + Intergenic
1152921361 17:83068150-83068172 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1152921539 17:83068627-83068649 CGACAGCGGGGGCGACAGCGGGG + Intergenic
1161564391 19:4992077-4992099 AGGGCCTGGGGGCGACAGAGTGG + Intronic
1162065596 19:8123611-8123633 TGAGCTTGGGGACGTCAGGGTGG - Intronic
1162496635 19:11026886-11026908 AGAGCTTGGAGGCGGCAGAGTGG - Intronic
1163598346 19:18233285-18233307 CGGGAGTGGAGGCGACAGCGAGG + Exonic
925609902 2:5693707-5693729 CGAGGACGCGGGCGACAGCGCGG - Exonic
925725393 2:6866027-6866049 CTACCTTGGGGCCGACGGCGCGG - Intronic
931763660 2:65436476-65436498 GGGGCTTGGGGGAGACAGCTGGG - Intergenic
938041675 2:128081406-128081428 CCAGCCTGGGGGACACAGCGAGG - Intergenic
938500183 2:131828292-131828314 CGAGCGTGGCGGCACCAGCGCGG + Intergenic
938537074 2:132256247-132256269 CGAGATTGGGCGCGGCAGGGCGG + Intronic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
946418567 2:219552484-219552506 CGAGCCTGGGCGGGGCAGCGAGG + Intronic
948734253 2:239989645-239989667 AGAGCTTGGGACAGACAGCGAGG - Intronic
1183776716 22:39970955-39970977 CGAGCTGGGGTTCCACAGCGGGG + Exonic
1185394125 22:50578191-50578213 GGAGTTGGGGGGCGTCAGCGAGG + Intronic
950692576 3:14671928-14671950 CGAGCATGGGGGCGACAGGGAGG - Exonic
952301390 3:32106961-32106983 CGTGCGTGCGGGGGACAGCGCGG + Intronic
962851104 3:139308950-139308972 CAAGCTGGGGGGCCACAGCATGG - Intronic
966683818 3:182671999-182672021 AGAGATTGTGGGCGACAGGGAGG - Intergenic
968477944 4:821151-821173 CAACCTGGGGGGCGACAGCCTGG - Intronic
969308761 4:6340177-6340199 CGGGCCTGGGGGCCACAGCTGGG - Intronic
978637109 4:110822760-110822782 GAAGCTTGGGGGAGACAGCTGGG + Intergenic
983779180 4:171646091-171646113 GGGGCTTGGGGGCTACAGCTGGG + Intergenic
987128549 5:14838602-14838624 CCTGCTTGGGGGCGCCAGAGAGG + Intronic
998054385 5:139061964-139061986 GGAGCTTGGAGGCCCCAGCGAGG - Intronic
1005962540 6:30704283-30704305 TGAGCTTGGGGGTGACAGGCTGG + Exonic
1006144212 6:31948583-31948605 CTACCTTGAGGGCGACAGGGAGG + Intronic
1016590060 6:145735003-145735025 CGCGGCTGGCGGCGACAGCGTGG + Intronic
1020411694 7:7899208-7899230 TGAGCTTGGGGTCAACAGCAAGG + Intronic
1024235556 7:47394900-47394922 CCAGCTTGGGGACAAGAGCGGGG + Intronic
1025929296 7:65981823-65981845 CGGGCTTGGGGGCGCCGGCTTGG - Intronic
1034270251 7:149800200-149800222 GGAGCTTGGGGGCTTCAGGGAGG + Intergenic
1035602644 8:905800-905822 CGTGCTTGGGGGCGGGAGGGTGG - Intergenic
1035772042 8:2155538-2155560 GGGGGTTGGGGGCTACAGCGGGG - Intronic
1052058064 9:23925129-23925151 CGAGCTTAGGATCGACAGAGAGG - Intergenic
1058617141 9:106842941-106842963 AGAGGTTGGGGTCGACAGAGTGG + Intergenic
1060675912 9:125514339-125514361 CGAGGCTGGGGGAGGCAGCGAGG - Intronic
1062380967 9:136286292-136286314 CGAGCGTGGGGGCGGCAGGTAGG + Exonic
1062499525 9:136846285-136846307 CGAGCGTGGCGGCGCCAGCGCGG - Exonic
1185779192 X:2830043-2830065 CAGGCCTGGGGGCGACAGCGTGG - Exonic
1186509140 X:10117435-10117457 CGAGCTTGGGGGCGACAGCGAGG - Exonic
1191855270 X:65620306-65620328 GGAGCTGCGGGGCGGCAGCGAGG - Intronic
1197982168 X:132228513-132228535 GGAGGTGGGGGGCGACAGCAGGG - Intergenic
1201290854 Y:12420450-12420472 CAGGCCTGGGGGCGACAGCGTGG + Intergenic