ID: 1186514531

View in Genome Browser
Species Human (GRCh38)
Location X:10156778-10156800
Sequence ACGCCCCACCCTCAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514531_1186514547 25 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514531_1186514548 29 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514531_1186514539 -3 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514531_1186514538 -4 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514531_1186514546 24 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514531_1186514545 23 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514531_1186514542 7 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514531_1186514544 22 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514531 Original CRISPR ACGCCCCACCCTCAGGGGCT GGG (reversed) Intergenic
900191307 1:1353430-1353452 ACACCCCTCTCCCAGGGGCTTGG - Intronic
900976579 1:6020527-6020549 AAGCCCCACCCTCCTGGACTCGG + Intronic
901321057 1:8340019-8340041 AAGCCCCACCCTGAATGGCTGGG - Intronic
901322399 1:8347862-8347884 GCTGCCCGCCCTCAGGGGCTTGG - Intergenic
901654133 1:10759697-10759719 CTGCCCCTCCCTCTGGGGCTGGG - Intronic
902784336 1:18723242-18723264 ACACCCCACCCCCAGGGCCTCGG - Intronic
903438380 1:23369167-23369189 CCGCCCCCCCCGCAGGGGCCTGG - Intronic
903938031 1:26910130-26910152 GTGCCCCACCCTCAGGTGCAAGG + Intronic
906142202 1:43540491-43540513 AGGCCCCTTCCTCTGGGGCTGGG - Intronic
907437683 1:54459879-54459901 CTCCCCCACCCCCAGGGGCTGGG - Intergenic
907627177 1:56041649-56041671 ACTCCCCAGCCTCCAGGGCTGGG - Intergenic
907897211 1:58703111-58703133 ACACCCCACCCTGAGTAGCTGGG - Intergenic
908393425 1:63703799-63703821 ACCCCCCACCCCCAAGGGGTTGG + Intergenic
912429266 1:109620559-109620581 AGGCCCCTCCCTCCTGGGCTGGG + Intronic
915490329 1:156246967-156246989 AGTCCCCACACTGAGGGGCTTGG + Intronic
915524150 1:156466007-156466029 ACCCCCCGCCCTAAGGGGCCTGG - Exonic
918055933 1:181022409-181022431 GCCCCCCACCACCAGGGGCTTGG + Intronic
919786267 1:201260276-201260298 CAGCCACACCCTCAGGGTCTGGG - Intergenic
922892144 1:229070301-229070323 CCGGCCCACCCCCAAGGGCTGGG + Intergenic
923338903 1:232991516-232991538 AGGCCCCACCCTGAGGTCCTGGG - Intronic
924463943 1:244283715-244283737 ACCTCCCACCCCAAGGGGCTTGG + Intergenic
924948087 1:248859091-248859113 TCGCCCCTCCCTCTGGGGCGCGG - Intronic
1064167858 10:13001783-13001805 ACGCCCCAGCCGCAGGGGGCAGG - Intronic
1064218365 10:13418948-13418970 GCCCCATACCCTCAGGGGCTGGG + Intergenic
1066985511 10:42462908-42462930 GCTCCCCACCCTGAGTGGCTGGG - Intergenic
1067038529 10:42935949-42935971 GTGCCCCACCCTGAGGGGCTCGG + Intergenic
1070688978 10:78510782-78510804 ACTCCCCAGCCTCTGGGTCTTGG - Intergenic
1071597216 10:86936985-86937007 AGACACCACGCTCAGGGGCTCGG + Exonic
1073932765 10:108595098-108595120 ATGCCCAACCTTCAGGGGCATGG + Intergenic
1074457619 10:113609217-113609239 ACACCCCACCCTGAGAGACTGGG + Intronic
1074859500 10:117499636-117499658 ATGCTTCACCCTCAGGGGCCTGG + Intergenic
1076587803 10:131561136-131561158 ACGCCACACCCTGAGGACCTTGG + Intergenic
1076830854 10:132993436-132993458 ACACAGCACCCTCAGGGGCCAGG - Intergenic
1076830868 10:132993485-132993507 ACACAGCACCCTCAGGGGCCAGG - Intergenic
1078856122 11:15207496-15207518 ACGCCCCACCCTCATTTCCTGGG + Intronic
1083470690 11:62881801-62881823 CCGTCCCACCCTTAGGCGCTGGG + Intronic
1083668171 11:64286301-64286323 AGGCCCCTCACTCAGGGGCATGG - Intronic
1083922564 11:65788418-65788440 ACGCCCCGCCCCCAAGGCCTGGG - Intronic
1084147968 11:67275078-67275100 GCTCCCCACCCTCAGAGGCTGGG - Intronic
1084163173 11:67362002-67362024 ATGCCCCACCCTGAGGGGTCCGG - Intronic
1084519648 11:69655540-69655562 AGCCCCCACCCTCAGGGGAGAGG - Intronic
1085521990 11:77144462-77144484 AGCCCCCACTCTCAGGGCCTGGG - Intronic
1088651036 11:111958339-111958361 TCGCTGCACTCTCAGGGGCTAGG + Intronic
1093358430 12:18197165-18197187 ACGCCCAAACCGCAGGGGCCAGG + Intronic
1096575689 12:52551507-52551529 TCGGCTCAGCCTCAGGGGCTAGG - Intronic
1097247270 12:57613463-57613485 CCTCCTCACTCTCAGGGGCTTGG - Exonic
1097262647 12:57728172-57728194 CTGCCCCACTCCCAGGGGCTCGG - Intronic
1097280888 12:57845201-57845223 CCGCCCCAGCCTCCGGGGCCAGG + Intronic
1097282343 12:57852727-57852749 TCGCCCCACCCTCCGGTCCTGGG + Intergenic
1100299766 12:93296249-93296271 TCGCCCCACCCTCAGTGACTGGG + Intergenic
1102762935 12:115404843-115404865 GCTCCCCACCCTCTTGGGCTGGG - Intergenic
1103362447 12:120362030-120362052 GCGCCCTACCCTCTGGGGCCCGG + Intronic
1104638049 12:130450153-130450175 CTGCCCCACTCACAGGGGCTCGG + Intronic
1107513451 13:41107370-41107392 AAGCCCCACCCTCCTGGGCAGGG + Intergenic
1113778732 13:112963660-112963682 AGGCCACACCCACAGGCGCTGGG - Intronic
1114644792 14:24249384-24249406 AGCCCCCATCCCCAGGGGCTGGG + Exonic
1117270335 14:54136909-54136931 ACACCCCACCCCCAGTGGCCTGG - Intergenic
1119038177 14:71248116-71248138 ATGCTCCATCCTCAGGGGCTGGG - Intergenic
1119681978 14:76599330-76599352 GATCCCCACCCTCAGGGGCCCGG + Intergenic
1122778758 14:104134868-104134890 CCGCCCCAGGCTCAGGGTCTTGG + Intergenic
1122893485 14:104743814-104743836 ACGCCACACCCTCAGCTACTCGG - Intronic
1122900015 14:104778533-104778555 AAGCCCCAGGCTGAGGGGCTGGG - Intronic
1123016972 14:105380368-105380390 TCACCCCACCCTCAGGGTCAGGG + Intronic
1123016996 14:105380433-105380455 TCCCCCCACCCTCAGGGTCAGGG + Intronic
1123017008 14:105380465-105380487 TCCCCCCACCCTCAGGGTCAGGG + Intronic
1123017020 14:105380497-105380519 TCACCCCACCCTCAGGGTCAGGG + Intronic
1123017033 14:105380529-105380551 TCACCCCACCCTCAGGGTCTGGG + Intronic
1123093192 14:105751206-105751228 CCACCCCTTCCTCAGGGGCTGGG + Intergenic
1202832378 14_GL000009v2_random:50469-50491 ATGCCCCACCTCCAGGGCCTTGG + Intergenic
1124210848 15:27763982-27764004 ACCCCCACCCCTCAGTGGCTGGG - Intronic
1128566063 15:68700976-68700998 ATGCCCCTCCCTGAGGAGCTGGG + Intronic
1128699351 15:69793054-69793076 CAGGCCCACCCTCAGAGGCTGGG + Intergenic
1129476195 15:75785980-75786002 AGGCCCCAGCCCCAGGGACTGGG + Intergenic
1129876575 15:78979369-78979391 TGGCCCCATCCTCAGGGTCTGGG + Intronic
1130235145 15:82126543-82126565 CCTCACCACCCTCAAGGGCTGGG - Intergenic
1132669048 16:1095272-1095294 AGGCCCCACCCACTGTGGCTGGG + Intronic
1133042631 16:3068650-3068672 CCACCCCAAGCTCAGGGGCTGGG - Intronic
1133217101 16:4299278-4299300 ACGCCACACCCTCAGCAGCCTGG + Intergenic
1135207038 16:20492624-20492646 ACTCCGCACCCTCGGGGGCCTGG + Intergenic
1135211847 16:20531008-20531030 ACTCCGCACCCTCGGGGGCCTGG - Intergenic
1135544226 16:23355044-23355066 AGGCCTCACCCTCAGCAGCTGGG + Intronic
1135638630 16:24100656-24100678 AAGCCCCTCCCTTTGGGGCTTGG - Intronic
1136251707 16:29009614-29009636 ACCCACCTCCCTCACGGGCTTGG + Intergenic
1137291661 16:47055690-47055712 ACGCCCCGCCCTCCTGGGCAGGG - Intergenic
1138033545 16:53580155-53580177 AAGCCCCACCTTCAGGGGGAAGG - Intergenic
1138090641 16:54171044-54171066 ACACCCCTCCCTGAGGGTCTTGG - Intergenic
1138283121 16:55787042-55787064 ACGCCCCACCCACACAGCCTTGG - Intergenic
1139493793 16:67301578-67301600 ACTCCCCACCCTCAGTGGGAAGG + Intronic
1139676978 16:68530404-68530426 ACCCCCATTCCTCAGGGGCTCGG + Intronic
1139954333 16:70686069-70686091 ACGCCCGATCCTCGGCGGCTCGG - Intergenic
1141568843 16:84922041-84922063 GCGCCCCACCTTCGGGGACTCGG + Intergenic
1142214568 16:88824319-88824341 ACGCCACACGCACAGGGCCTGGG - Intronic
1142390734 16:89798072-89798094 ACACCCCACCTTGAGAGGCTGGG - Intronic
1142757384 17:2024295-2024317 GCTCCCCACCCTCAGCCGCTGGG + Intronic
1142978584 17:3659011-3659033 CCCTCCCACCCTCAGGGACTGGG - Intronic
1146255597 17:31390318-31390340 AAGCCCCACCCAGAGGGGATGGG - Intergenic
1146522833 17:33539621-33539643 AGGCCCCAGGCACAGGGGCTGGG - Intronic
1149636781 17:58177281-58177303 ACGCTCCACCCTCGGAGGCCTGG + Intergenic
1151536494 17:74741869-74741891 ACACCCCATCTCCAGGGGCTCGG + Intronic
1152192934 17:78899500-78899522 GGGCCCCTCCCGCAGGGGCTGGG - Intronic
1152278695 17:79372660-79372682 CCTCCCCACCCACAGGGGCAGGG + Intronic
1152748961 17:82053793-82053815 ACTCCTGACCCTCAGGGCCTGGG + Intronic
1156481821 18:37441159-37441181 CTGCCCCACCCTCCGTGGCTGGG - Intronic
1157494136 18:48143132-48143154 GTTCCCCACCCTCAGGGGCCAGG + Intronic
1157681288 18:49609091-49609113 AAGCCCCACAGTCAGGGGATAGG + Intergenic
1160948019 19:1652388-1652410 ACGCGCGACCCTCGGGGGCCCGG - Intronic
1161183488 19:2900899-2900921 ACGTCCCGCCCTCGGGGCCTCGG - Exonic
1161323695 19:3652934-3652956 ACTCCCGACCCCCAAGGGCTGGG + Intronic
1161443577 19:4305485-4305507 ACGCCCCACCTTCAGGATGTAGG + Intronic
1161468541 19:4445276-4445298 AGGCCTCTCCCTCGGGGGCTTGG + Exonic
1162818524 19:13209685-13209707 AGGCTCCACCCTCAGAGGCCTGG - Intronic
1162888869 19:13717589-13717611 ACTCCCCACCCTCATCCGCTTGG + Intergenic
1163696739 19:18768124-18768146 CCGCAGCACCCACAGGGGCTGGG + Intronic
1165907835 19:39204352-39204374 GCGCCCCTCCCTCAGGAGCCGGG + Intergenic
1166231345 19:41427235-41427257 ACACCCCAACCCCAGGGACTGGG + Intronic
1166295493 19:41887483-41887505 ACCCTCCTCCCTCAGGGACTGGG - Intronic
1166300035 19:41908069-41908091 ACCCCCCCCACTCTGGGGCTGGG + Intronic
1167296762 19:48654965-48654987 CCGCCTCCCACTCAGGGGCTGGG - Intergenic
1202640304 1_KI270706v1_random:77268-77290 ATGCCCCACCTCCAGGGCCTTGG - Intergenic
925273625 2:2633415-2633437 ACTCCCCACGCTCAGGCCCTAGG + Intergenic
926102956 2:10132275-10132297 AGGCCCCTCCCTCTGGAGCTTGG + Intergenic
929085846 2:38166540-38166562 AGGCCCCACTCTCAGGGAGTAGG + Intergenic
929586379 2:43117421-43117443 ACACCCCAGGCCCAGGGGCTTGG - Intergenic
930411065 2:51027469-51027491 ACGCCCGACCCACGGGGGCCGGG - Intronic
931355760 2:61537226-61537248 TCTCCCCAGCCCCAGGGGCTGGG + Intronic
931667776 2:64622738-64622760 GCGCCCCAGCCTCAGGGGAGTGG + Intergenic
932370012 2:71179005-71179027 AAGCCCCGCCCCCAGGTGCTCGG + Intergenic
933944695 2:87275901-87275923 ACACACCACCCTCTGGGACTAGG - Intergenic
933973087 2:87486067-87486089 AGGCCCCACCCACACAGGCTGGG - Intergenic
935057311 2:99578875-99578897 AGGCCCCACCCTGAGAGTCTGGG + Intronic
936320633 2:111464146-111464168 AGGCCCCACCCACACAGGCTGGG + Intergenic
936335515 2:111585677-111585699 ACACACCACCCTCTGGGACTAGG + Intergenic
937281567 2:120720866-120720888 TGTCCCCACCCTCAGGGCCTCGG - Intergenic
937315718 2:120930904-120930926 ACACCCCACCCTCACTGGCAAGG - Intronic
940987370 2:160062650-160062672 TCGCCCCACCCACTGCGGCTTGG + Intergenic
948040979 2:234901270-234901292 ACCCACCAGCCGCAGGGGCTGGG - Intergenic
948184125 2:236005984-236006006 ACACCCCACCCTCAAGGACAGGG - Intronic
948630380 2:239298700-239298722 ACACTCCACCTACAGGGGCTAGG + Intronic
948717068 2:239871908-239871930 ACCCCCCACCCACTGGGGCCTGG - Intergenic
949014362 2:241701488-241701510 CTGCCCCTCCCTCAGGGCCTGGG - Intergenic
949056307 2:241929687-241929709 TCCCTCCACGCTCAGGGGCTGGG - Intergenic
1169030095 20:2400250-2400272 AGGCCCCTCTCTCAGGGGCCAGG + Intronic
1169276474 20:4236578-4236600 ACGCCCCAGCCACAGGGGCTCGG - Intronic
1169967315 20:11232313-11232335 ACTCCCCACCCTCAGCTGGTAGG + Intergenic
1171887182 20:30663929-30663951 ATGCCCCACCTCCAGGGCCTTGG - Intergenic
1172975735 20:38904316-38904338 TGGCCCCACCCCCATGGGCTGGG + Intronic
1174611494 20:51801705-51801727 TCTCCCCACCCTCAGGAGCTGGG - Intronic
1176381944 21:6118050-6118072 TGGCCTCACCCGCAGGGGCTAGG + Intronic
1176648631 21:9374854-9374876 ATGCCCCACCTCCAGGGCCTTGG - Intergenic
1179260117 21:39750620-39750642 ACCCCCCACCCTCAAGTGCTAGG - Intronic
1179741528 21:43420189-43420211 TGGCCTCACCCGCAGGGGCTAGG - Intronic
1179950034 21:44704189-44704211 CCTCCCCACCCCCAGGGGCTAGG - Intronic
1180361639 22:11904628-11904650 ATGCCCCACCTCCAGGGCCTTGG + Intergenic
1180969484 22:19807685-19807707 AGCCCCCAGCCTCAGGGGCTTGG - Intronic
1181436817 22:22915944-22915966 TCACCCCACCCACAGGGGCCTGG + Intergenic
1181437658 22:22919870-22919892 TCACCCCACCCACAGGGGCCTGG + Intergenic
1181438306 22:22922925-22922947 TCACCCCACCCACAGGGGCCTGG + Intergenic
1181550889 22:23638591-23638613 CCACCCCACCCACAGGGGCCTGG - Intergenic
1181797397 22:25320098-25320120 CCACCCCACCCACAGGGGCCTGG + Intergenic
1184374437 22:44102874-44102896 ACTCCCCACCCCCAGGTGCTGGG + Intronic
1184931372 22:47683586-47683608 GCTCCCCTCCCTCAGGGACTGGG - Intergenic
1185146578 22:49140208-49140230 ATGTCCCACCCACAGGGACTCGG + Intergenic
1185342508 22:50298005-50298027 AGGCCAGTCCCTCAGGGGCTGGG - Intronic
950614096 3:14145844-14145866 AGCCCCCACCACCAGGGGCTGGG + Exonic
950706541 3:14785919-14785941 CCACCCCAACCTCAGGGCCTTGG + Intergenic
951445873 3:22779856-22779878 AATCCCCACACTCAGGGGCATGG + Intergenic
952984795 3:38769773-38769795 AAGCCCCATCCCCAGGGGATTGG - Intronic
961325473 3:126106802-126106824 ACCCCCCACACTGAGTGGCTTGG - Intronic
961385345 3:126520140-126520162 TCTCCCCACCCTGAGGGGCAAGG - Intergenic
961441785 3:126957829-126957851 AGGCCCCACCTTCAAGGGCCGGG + Intronic
961803169 3:129468317-129468339 AAGACCCAGCCTCAAGGGCTAGG + Intronic
963711791 3:148755089-148755111 ACACTCATCCCTCAGGGGCTGGG - Intergenic
964223003 3:154368013-154368035 ACCCCCGACCCTCCAGGGCTGGG + Intronic
1202738249 3_GL000221v1_random:30132-30154 ATGCCCCACCTCCAGGGCCTTGG + Intergenic
969838100 4:9859952-9859974 TCTCCACACCCTCAGGAGCTGGG - Intronic
972203762 4:36747442-36747464 AAGCCCCACCCTCCTGGGCGGGG + Intergenic
973383820 4:49487783-49487805 ATGCCCCACCTCCAGGGCCTTGG - Intergenic
978249211 4:106610388-106610410 TCCCCCTACCCTCAGAGGCTTGG + Intergenic
984661611 4:182381060-182381082 ACACCCCTCCCTCAGGGGTACGG - Intronic
994279524 5:97885319-97885341 ATGCCTCACCCTCAGGTTCTGGG - Intergenic
998078608 5:139256475-139256497 ATCCCCCAACCTCAGGGGCTGGG - Intronic
999428213 5:151505384-151505406 TCCCTCCACCCTCAGGGACTAGG + Exonic
1001679324 5:173544503-173544525 ATGCCTCAGCCTCAGGGGCCTGG - Intergenic
1002139812 5:177132214-177132236 ATGCCCGGCCCTCAGGGGCGAGG + Intergenic
1002614529 5:180442649-180442671 AAGCCCCACCCTCAGGGTGCTGG + Intergenic
1002622118 5:180494963-180494985 ACGCCCCCCTCCCAGGGACTCGG - Intronic
1006365910 6:33615060-33615082 AGGCCCCAACCTCAATGGCTGGG - Intergenic
1007766363 6:44162607-44162629 GCACCCCACCCTCAGGGGAATGG + Intronic
1009561057 6:65244107-65244129 AGGCCTCTCCCTAAGGGGCTTGG + Intronic
1018948871 6:168365445-168365467 GGGAGCCACCCTCAGGGGCTCGG + Intergenic
1019522950 7:1468797-1468819 ACGCCCCACCCCTGGGGGCTGGG + Intergenic
1019817284 7:3210625-3210647 ACGCCCTCACCTCTGGGGCTGGG - Intergenic
1020141212 7:5612921-5612943 AAGCCACACCCTCAGAGGATCGG - Intergenic
1022843965 7:34191533-34191555 AAGCCCCAGCCTGAGGGGCCTGG - Intergenic
1024460631 7:49656022-49656044 GCCCCCCAGCCCCAGGGGCTTGG - Intergenic
1026665173 7:72335833-72335855 ACGCCCCATCCAGACGGGCTGGG - Intronic
1029450906 7:100641393-100641415 AGGGGCCAGCCTCAGGGGCTTGG + Intronic
1031407847 7:121407106-121407128 AGGCCCCACCATCTAGGGCTGGG - Intergenic
1033450989 7:141462365-141462387 ACACCCCATCCCCAGGGGCACGG - Intronic
1034278909 7:149838351-149838373 ACGCCCCGCCGCCTGGGGCTGGG + Exonic
1034386956 7:150748026-150748048 ACTTCCCACCCTGAGGGCCTGGG + Intronic
1034704369 7:153127417-153127439 ACCCCCCACCCTCATGGCATTGG + Intergenic
1034992246 7:155555231-155555253 GGGCCGCACCCTCAGGGGCTGGG + Intergenic
1035236631 7:157501302-157501324 GCACTCCACCCTCCGGGGCTCGG + Intergenic
1035470772 7:159107340-159107362 ATGCCCCATGCTCAGGGGCCAGG - Intronic
1041275939 8:56157423-56157445 ACCCTCCTCCCTCAGGGGGTTGG - Intergenic
1044778915 8:95723438-95723460 ACGCCTCCACCTCAGGGCCTTGG - Intergenic
1048264201 8:132971165-132971187 AAGCCCCACCCTCAGCTTCTAGG - Intronic
1048286473 8:133145750-133145772 AGGCCACAGCCTCAGGGGCCAGG - Intergenic
1048484097 8:134831801-134831823 ACGCCCGACCCTGAGGGACGGGG + Intergenic
1049595940 8:143483412-143483434 TTGCCCCAGCCTCACGGGCTGGG - Intronic
1053203343 9:36167098-36167120 ACCCCCCACCCCCAGTAGCTGGG - Intergenic
1055404575 9:75961213-75961235 ATGCACCAGCCCCAGGGGCTGGG - Intronic
1059345159 9:113623353-113623375 AAGCCCCTCCCTCAGGGGCTTGG - Intergenic
1060602174 9:124885669-124885691 ACCCTCCAACCTCAGGGCCTTGG - Intronic
1061395213 9:130340025-130340047 GCCCCCCTCCCTCAGGGGATAGG - Intronic
1061765168 9:132877387-132877409 ACACCCCATCCCCAGGGGCATGG - Intronic
1062149000 9:135007806-135007828 AGGCCTCACCATCAGGGTCTGGG + Intergenic
1062426039 9:136506686-136506708 ACGCCCCACCCGCCTGGGCGCGG + Intronic
1062440651 9:136567833-136567855 ACTCTCCAGCCTCAGGGGCCTGG - Intergenic
1062582940 9:137236436-137236458 CCGCCCCACCCTCCCCGGCTGGG + Exonic
1203692081 Un_GL000214v1:52077-52099 ATGCCCCACCTCCAGGGCCTTGG - Intergenic
1203706979 Un_KI270742v1:60577-60599 ATGCCCCACCTCCAGGGCCTTGG + Intergenic
1203644214 Un_KI270751v1:52114-52136 ATGCCCCACCTCCAGGGCCTTGG + Intergenic
1186514531 X:10156778-10156800 ACGCCCCACCCTCAGGGGCTGGG - Intergenic
1191256479 X:58281723-58281745 ACGTCCTACCCTCAGGGCCGTGG - Intergenic
1193462954 X:81811586-81811608 CCCCCCGACCCTCCGGGGCTGGG - Intergenic
1200020741 X:153204479-153204501 ACGCCCCACCCCCATGTGCTCGG - Intergenic
1201750251 Y:17423599-17423621 ACCCCCAACCCTCCGAGGCTGGG - Intergenic