ID: 1186514531

View in Genome Browser
Species Human (GRCh38)
Location X:10156778-10156800
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514531_1186514548 29 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514531_1186514547 25 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514531_1186514539 -3 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514531_1186514546 24 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514531_1186514544 22 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514531_1186514545 23 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514531_1186514538 -4 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514531_1186514542 7 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514531 Original CRISPR ACGCCCCACCCTCAGGGGCT GGG (reversed) Intergenic