ID: 1186514532

View in Genome Browser
Species Human (GRCh38)
Location X:10156779-10156801
Sequence GACGCCCCACCCTCAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514532_1186514548 28 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514532_1186514545 22 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514532_1186514544 21 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514532_1186514539 -4 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514532_1186514547 24 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514532_1186514538 -5 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514532_1186514546 23 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514532_1186514542 6 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514532 Original CRISPR GACGCCCCACCCTCAGGGGC TGG (reversed) Intergenic
900645478 1:3706893-3706915 GCCGCTCCACGCTCAGGGGCCGG - Intronic
900941547 1:5801816-5801838 GGCCCCCCACCCTCAAGGCCTGG + Intergenic
901080218 1:6579929-6579951 GGGGCCCCGCCCTCGGGGGCCGG + Intergenic
901109896 1:6785792-6785814 CACACCCCACCCCCGGGGGCGGG + Intronic
901182493 1:7351291-7351313 GACGCCACGCACTCAGGAGCTGG + Intronic
901627937 1:10634297-10634319 GCCTCCGCACCCTCTGGGGCAGG - Intergenic
905279981 1:36842907-36842929 GGTGCTCCTCCCTCAGGGGCAGG + Intronic
906095086 1:43217521-43217543 CAAGCCCCACCCTCAGGTACCGG + Intronic
906511628 1:46413383-46413405 GACTCCCCACCCCCAGGCCCAGG - Intronic
907334851 1:53693393-53693415 GACACCCAGCCCTCGGGGGCAGG + Intronic
915146556 1:153799179-153799201 GGCGCCTCACCCTGAGGGGCAGG - Intergenic
918171851 1:182004819-182004841 GAAGCCCCACCCCTAGGGGAAGG + Intergenic
919536917 1:198798495-198798517 GGGGCTCCACCCTCATGGGCGGG + Intergenic
919861223 1:201740452-201740474 GACCCCCGACCCTCACAGGCCGG - Intronic
920702785 1:208230546-208230568 GAGGCCCCAGCCTAAGGAGCTGG - Intronic
922464714 1:225839026-225839048 GACACACCGCCCTCCGGGGCTGG + Intronic
922559486 1:226558851-226558873 GAAGCCCCACAATCTGGGGCAGG + Intronic
924062885 1:240194637-240194659 GAGGCCCCATCCTCAGGTGAAGG + Intronic
924507819 1:244702748-244702770 CAAGCCACACCCTCAGGGGTTGG + Intronic
1063409732 10:5828125-5828147 CACTCCCCACCCCCAAGGGCAGG + Intronic
1067863548 10:49878743-49878765 ACTGCCCCACCCTCAGAGGCAGG + Intronic
1069160478 10:65085262-65085284 GAAGCCCCATCCCCAGGGGAAGG + Intergenic
1069626181 10:69869018-69869040 CACACCTCACCCCCAGGGGCAGG + Intronic
1070669385 10:78367373-78367395 GAGGCCCCGACCTCAGGGGAAGG - Intergenic
1072470347 10:95707279-95707301 GAAGCTCCACCCTCCTGGGCAGG - Intergenic
1074422764 10:113323883-113323905 GAGGCCCCACACTGAGGGTCAGG - Intergenic
1075106600 10:119543356-119543378 GACGCCCCACCCGCATTCGCGGG - Intergenic
1075599246 10:123755211-123755233 GACCACCCACCTCCAGGGGCTGG - Intronic
1075701032 10:124469497-124469519 GCCCCCCCCACCTCAGGGGCTGG - Intronic
1076547280 10:131253870-131253892 CATGTCACACCCTCAGGGGCAGG - Intronic
1076887281 10:133268522-133268544 CCCGCCCCAGCCTCAGGGGAAGG + Intronic
1077555089 11:3222120-3222142 GCTGCCTCACCATCAGGGGCGGG + Intergenic
1079415851 11:20235732-20235754 GAAGCCCCACCCCTAGGGGAAGG + Intergenic
1079428173 11:20363689-20363711 CTCGCCCCGCCCACAGGGGCGGG - Intronic
1083713634 11:64563533-64563555 TTCTCCCCAACCTCAGGGGCAGG - Intronic
1084147969 11:67275079-67275101 TGCTCCCCACCCTCAGAGGCTGG - Intronic
1084559076 11:69892670-69892692 GATGACCCACCCCCAGGGGTGGG + Intergenic
1084650883 11:70488572-70488594 GGCTCCCTCCCCTCAGGGGCAGG - Intronic
1088881864 11:113979148-113979170 GAAGCCCCTCCTTTAGGGGCTGG + Intronic
1089004932 11:115083522-115083544 GAAGCCCCACCCTCCAGGGGAGG - Intergenic
1090800527 11:130168756-130168778 GGGGCCCCACCCCCAGGGGAGGG - Intronic
1091206193 11:133822970-133822992 GATGCCTCACAATCAGGGGCAGG - Intergenic
1091975548 12:4821812-4821834 GACGGCCCAGCCTCAGCAGCAGG - Intronic
1097278002 12:57826301-57826323 GACCCCCCACCCTCTGGGCTGGG + Intronic
1099661395 12:85568075-85568097 GATGCCTCACCCTCAGGTGAAGG + Intergenic
1100299765 12:93296248-93296270 TTCGCCCCACCCTCAGTGACTGG + Intergenic
1101253846 12:102958455-102958477 GACGGCCAGCCCTCAGGGGGCGG + Exonic
1101979032 12:109389399-109389421 CACCCCTCACCTTCAGGGGCAGG - Intronic
1103924212 12:124414722-124414744 GCCCACCCACCCTCAGGGGTAGG - Intronic
1106392167 13:29345870-29345892 GAAGCCCCACCCCTAGGGGAAGG - Intronic
1107513450 13:41107369-41107391 GAAGCCCCACCCTCCTGGGCAGG + Intergenic
1110595815 13:77319360-77319382 GATGCCCCATCCTAAGGGTCAGG + Intronic
1110939432 13:81330770-81330792 GAGGCCCCACCTTCAGGGCAGGG + Intergenic
1113778733 13:112963661-112963683 GAGGCCACACCCACAGGCGCTGG - Intronic
1118339199 14:64880159-64880181 GGCGCCCCAGGCTCAGCGGCGGG - Intergenic
1118778358 14:68988740-68988762 GACTCTCCACCCTGAGAGGCTGG - Intergenic
1119038178 14:71248117-71248139 TATGCTCCATCCTCAGGGGCTGG - Intergenic
1121407533 14:93728092-93728114 GACTCCCCAACCTCAGGCACAGG + Intronic
1122209748 14:100166449-100166471 GGCGCCCTACCCTCAGGACCAGG + Intergenic
1122600200 14:102917579-102917601 GAGGCCCCACCATCAGGAGAGGG + Intergenic
1122850342 14:104524832-104524854 GTCCCTCCACCCTCAGGGCCCGG - Intronic
1123016971 14:105380367-105380389 CTCACCCCACCCTCAGGGTCAGG + Intronic
1123016995 14:105380432-105380454 CTCCCCCCACCCTCAGGGTCAGG + Intronic
1123017007 14:105380464-105380486 CTCCCCCCACCCTCAGGGTCAGG + Intronic
1123017019 14:105380496-105380518 CTCACCCCACCCTCAGGGTCAGG + Intronic
1123017032 14:105380528-105380550 CTCACCCCACCCTCAGGGTCTGG + Intronic
1124239100 15:28015286-28015308 GTCTCCCCACTCTCAGGGACTGG - Intronic
1124653989 15:31494024-31494046 GGGGCCCGATCCTCAGGGGCTGG - Intronic
1128566062 15:68700975-68700997 GATGCCCCTCCCTGAGGAGCTGG + Intronic
1128699350 15:69793053-69793075 GCAGGCCCACCCTCAGAGGCTGG + Intergenic
1129326540 15:74802925-74802947 TCCCCCCCACCCTCACGGGCAGG - Exonic
1129476194 15:75785979-75786001 GAGGCCCCAGCCCCAGGGACTGG + Intergenic
1129604126 15:77016499-77016521 GTCCCCCCAGCCTCAGAGGCAGG - Intronic
1129676028 15:77632775-77632797 GACTCCGCGCCCTCCGGGGCCGG + Intronic
1131344571 15:91634101-91634123 CACACCCCAGACTCAGGGGCAGG - Intergenic
1132600341 16:770201-770223 GCCACCCCACCGTCAGGGCCTGG - Exonic
1133284739 16:4685395-4685417 CATGCCCCACCCACAGGGGAGGG + Intronic
1136261724 16:29082072-29082094 GAGGCCCCGCCTTCCGGGGCCGG + Intergenic
1136379929 16:29888509-29888531 GATGCCCCACCCACTGTGGCAGG + Intronic
1137291662 16:47055691-47055713 AACGCCCCGCCCTCCTGGGCAGG - Intergenic
1137698561 16:50478954-50478976 GGAGCCCCACCCTCCTGGGCGGG - Intergenic
1140697283 16:77547643-77547665 CGCCCCCCACCCTCAGGGACAGG + Intergenic
1141143478 16:81513247-81513269 GAAGCCCCACACTCTGGGTCTGG - Intronic
1142249749 16:88985877-88985899 GAAGCCCTACCCTCTCGGGCCGG - Intergenic
1142280225 16:89144192-89144214 GACTCCCCACCCTCAGTGGCTGG + Intronic
1143697500 17:8630964-8630986 GAGGCCCCAATCTCATGGGCTGG + Intergenic
1144737459 17:17563145-17563167 GAAGCCCCAGCCTGAGGAGCCGG + Intronic
1145167423 17:20625134-20625156 GAAGCCCCATCCTTAGGGGAAGG + Intergenic
1146255598 17:31390319-31390341 GAAGCCCCACCCAGAGGGGATGG - Intergenic
1146522834 17:33539622-33539644 GAGGCCCCAGGCACAGGGGCTGG - Intronic
1147162221 17:38574889-38574911 GACTCCGCCCCCTCCGGGGCTGG - Intronic
1148104885 17:45113832-45113854 AAGCCCCCACCCTCAGGGCCAGG + Intronic
1148855580 17:50577312-50577334 GAAGCCCCCCGCTCAGGGCCTGG - Intronic
1149497325 17:57127521-57127543 GACTGCCCACCCTCTGGGGGTGG - Intergenic
1149884650 17:60328072-60328094 GAGGCCCCACCTTCCGGGCCAGG + Intronic
1150536007 17:66041866-66041888 GATACCCCACCCTCAAGAGCAGG + Intronic
1150821283 17:68436287-68436309 GACGCCCTGCCGTCGGGGGCTGG - Intronic
1151343445 17:73486670-73486692 GACCCCAGACCCTCAGGAGCTGG - Intronic
1152278693 17:79372659-79372681 TCCTCCCCACCCACAGGGGCAGG + Intronic
1152743521 17:82029007-82029029 GACTCCCCACCCTGAAAGGCAGG - Intronic
1153226608 18:2905281-2905303 CCCGCCCCACCCACAGAGGCAGG - Intronic
1155149609 18:23112539-23112561 GAAGCCCAACCCTCATGGGGAGG - Intergenic
1157313311 18:46568554-46568576 GAAGCCCTACCCTCAGGTGTTGG - Intronic
1157405721 18:47421305-47421327 TACATCCCACCCACAGGGGCAGG + Intergenic
1158645851 18:59246375-59246397 GAGGCCCCACCCTCATGGATGGG - Intergenic
1160294721 18:77627565-77627587 GAAGCACCCCCCACAGGGGCTGG + Intergenic
1160845182 19:1163134-1163156 AAGGCCCCACCCACAGGTGCGGG - Intronic
1160918897 19:1510665-1510687 GACGCCACGCCCGCAGGAGCTGG + Exonic
1160973880 19:1782973-1782995 GAAGCACCAGCCACAGGGGCAGG - Exonic
1161237074 19:3203612-3203634 CATGCCCCGCCCTAAGGGGCTGG + Intronic
1161326553 19:3667080-3667102 GGGGCCACACCCTCAGTGGCAGG - Intronic
1162110641 19:8397928-8397950 GCCAACCCACCCTCAGGTGCCGG + Intronic
1163522175 19:17797928-17797950 GAGGAACCACCCACAGGGGCTGG + Intronic
1165027083 19:32969843-32969865 GGAGCCCCACCCTCTTGGGCAGG - Intronic
1165907834 19:39204351-39204373 GGCGCCCCTCCCTCAGGAGCCGG + Intergenic
1166052527 19:40268749-40268771 GAGGCACCACCCTCAGTGGGAGG - Intronic
1166065911 19:40358856-40358878 AACACCCCACCCCCAGGGGAGGG - Intronic
1166102101 19:40577005-40577027 GAGGTCCCATCCTCGGGGGCGGG + Intronic
1166300034 19:41908068-41908090 GACCCCCCCCACTCTGGGGCTGG + Intronic
1167296764 19:48654966-48654988 GCCGCCTCCCACTCAGGGGCTGG - Intergenic
1167507389 19:49878042-49878064 GAGGAGCCACCCTCAGGGGGCGG - Intronic
927493083 2:23533331-23533353 GTTCCCCCACCCTCTGGGGCTGG + Intronic
930411066 2:51027470-51027492 GACGCCCGACCCACGGGGGCCGG - Intronic
930741392 2:54836111-54836133 GAGGCCCGAGCCTCAGGAGCTGG + Intronic
934477353 2:94602433-94602455 GAAGCCCCAACCTCAGAGGAGGG - Intronic
936064056 2:109317349-109317371 GCCGCCCCAGCCCCAGGGGGTGG + Intronic
937249157 2:120512373-120512395 GACACCCCACCCCCAGGCCCTGG - Intergenic
945066230 2:205949774-205949796 CAGGCCCCAACCCCAGGGGCAGG - Intergenic
947597957 2:231425868-231425890 GAAGCACCAGCCTGAGGGGCAGG + Intergenic
947810381 2:233000432-233000454 GGGGCCCCACCCTCATGGCCTGG + Intronic
948184126 2:236005985-236006007 GACACCCCACCCTCAAGGACAGG - Intronic
948583328 2:239003043-239003065 GGAGCCCCACCCTGTGGGGCTGG + Intergenic
948775770 2:240288089-240288111 CAAGCCCCACCCCCAGGGCCAGG - Intergenic
949014363 2:241701489-241701511 GCTGCCCCTCCCTCAGGGCCTGG - Intergenic
1171333908 20:24365938-24365960 GAAACCCCAGCCTCAGGGCCTGG + Intergenic
1172975734 20:38904315-38904337 GTGGCCCCACCCCCATGGGCTGG + Intronic
1173924685 20:46771869-46771891 GGCAGCCCACCCTCTGGGGCAGG + Intergenic
1174611495 20:51801706-51801728 CTCTCCCCACCCTCAGGAGCTGG - Intronic
1175715233 20:61251181-61251203 GAACCCCCACCCTTGGGGGCAGG - Intergenic
1175768766 20:61609532-61609554 GAGGTCCCTCCCTCAGGGGAGGG - Intronic
1178589220 21:33895154-33895176 GCAGCCCCAGCCTCAGCGGCAGG - Exonic
1180959317 22:19755504-19755526 GACTCCCAGCCCTCGGGGGCGGG - Intergenic
1181051278 22:20239347-20239369 GGCGCCCCCACCTCAGGGACGGG + Intergenic
1182278118 22:29203017-29203039 GAGGCCCCGCCCGCAGGGACAGG + Intergenic
1182712916 22:32333665-32333687 GCAGCCCCAGCATCAGGGGCGGG - Intergenic
1182766348 22:32760664-32760686 GGAGCCCCACCCTCAGAGCCTGG - Intronic
1184374436 22:44102873-44102895 AACTCCCCACCCCCAGGTGCTGG + Intronic
1184931373 22:47683587-47683609 GGCTCCCCTCCCTCAGGGACTGG - Intergenic
1185065341 22:48629213-48629235 GCCCTCCCACCCTCAGGGCCTGG + Intronic
1185119025 22:48954823-48954845 GAAGCCCCAGCCTCCAGGGCTGG - Intergenic
950406908 3:12810423-12810445 GACGGCCCACCCTTAGGCCCTGG - Intronic
951117828 3:18885941-18885963 GAGGCCCCACTCTCAGGGAAGGG - Intergenic
953886736 3:46718219-46718241 GAAGACCAAACCTCAGGGGCTGG + Exonic
954305825 3:49724834-49724856 CCCACCCCACCCTCAGGGGCTGG + Exonic
960690472 3:120341841-120341863 GAAGCCCCACCCTCCTGGGTGGG + Intronic
961441784 3:126957828-126957850 CAGGCCCCACCTTCAAGGGCCGG + Intronic
963711792 3:148755090-148755112 GACACTCATCCCTCAGGGGCTGG - Intergenic
964714961 3:159712250-159712272 CACTCCCCACCCCCAGAGGCTGG - Intronic
965793220 3:172411435-172411457 GGAGCCCCACCCTCCTGGGCAGG - Intergenic
968046601 3:195627479-195627501 GACGCAGCACCCTCAGACGCCGG - Intergenic
968308052 3:197662561-197662583 GACGCAGCACCCTCAGACGCCGG + Intergenic
969095384 4:4728974-4728996 CACTCCCCACCCTCAGTGCCAGG + Intergenic
969563651 4:7965037-7965059 GTCTCCCCAGCCTCCGGGGCAGG + Intergenic
969605482 4:8200207-8200229 GAGGCCACACCCTGAGTGGCCGG - Intronic
969675216 4:8610721-8610743 GCTGCCCCACCCACAGGTGCAGG + Intronic
969716577 4:8871027-8871049 GGAGGCCCACCCTCTGGGGCAGG - Intronic
972203761 4:36747441-36747463 GAAGCCCCACCCTCCTGGGCGGG + Intergenic
974868186 4:67605341-67605363 GGGGCCCCACCCTCAGGGCAGGG + Intronic
978795797 4:112706164-112706186 GAGGCCCCGCCTTCCGGGGCCGG - Intergenic
984247752 4:177295988-177296010 GACACCACTCCCTCAGGGCCTGG + Intergenic
984481323 4:180306637-180306659 CACTCCCCACCCTCTGGGACAGG + Intergenic
984869414 4:184313316-184313338 GAGCCCCCAGCCTCAAGGGCAGG + Intergenic
985552657 5:541374-541396 GCCGCCCTTCCCCCAGGGGCAGG + Intergenic
985772437 5:1821231-1821253 CACCCCCCACCCTCAGGGCCAGG - Intergenic
986051248 5:4092174-4092196 GACCCCTCACCTTCAGGGGACGG + Intergenic
989812501 5:45695588-45695610 GACGCCCCCCACCCAAGGGCGGG + Intronic
990918503 5:60936991-60937013 GAAGCCCCAACCTTAGGGGAAGG - Intronic
994279525 5:97885320-97885342 GATGCCTCACCCTCAGGTTCTGG - Intergenic
994725826 5:103434295-103434317 GGAGCCCCACCCTCCTGGGCGGG + Intergenic
997389169 5:133499469-133499491 GACGCGCCACCCTCAGAGCCCGG - Intronic
998078609 5:139256476-139256498 TATCCCCCAACCTCAGGGGCTGG - Intronic
1002057927 5:176609614-176609636 GACGCCCTCCCCCCAGTGGCGGG + Intronic
1002300447 5:178254683-178254705 GAAGCTCCCCACTCAGGGGCAGG - Intronic
1003923433 6:10855425-10855447 GGAGCCCCACCCTCCTGGGCGGG + Intronic
1005332301 6:24761652-24761674 GGAGCCCCACCCTCCTGGGCGGG - Intergenic
1006073780 6:31516236-31516258 GACACCCCACCCTCAGCCTCTGG - Intergenic
1006385929 6:33730944-33730966 GACGACCCTCCCTGAGGGGAGGG - Intronic
1006467257 6:34203073-34203095 GAAGCCCCGCCCTCTTGGGCGGG - Intergenic
1010055347 6:71558075-71558097 GAAGCCCCATCCCCAGGGGAAGG - Intergenic
1013692910 6:112667276-112667298 GAAGCCCCACCCTCCTGGGTGGG + Intergenic
1014820746 6:125986371-125986393 GAAGCCCCTCCCACAGCGGCCGG + Intergenic
1018088856 6:160328681-160328703 GGAGCCCCTCCCGCAGGGGCTGG + Intergenic
1019191793 6:170255681-170255703 GACGCCACTCACACAGGGGCAGG - Intergenic
1019522949 7:1468796-1468818 CACGCCCCACCCCTGGGGGCTGG + Intergenic
1020139556 7:5605157-5605179 GACGCCCCACCCTCCAGTCCCGG - Intronic
1026220313 7:68390560-68390582 CATGCCCCACACTCAGGGACAGG - Intergenic
1026665174 7:72335834-72335856 GACGCCCCATCCAGACGGGCTGG - Intronic
1028481669 7:91313311-91313333 CACTCCCCAGCCCCAGGGGCCGG - Intergenic
1028782956 7:94757847-94757869 GAAGCCCCATCCTTAGGGGAAGG + Intergenic
1031433721 7:121706631-121706653 GAAGCTCCATCCTCAGTGGCCGG + Intergenic
1032683595 7:134209551-134209573 GCTGCCCCAGCCTCAGGTGCTGG + Intronic
1032848436 7:135771873-135771895 GACGCTTCACCATCAAGGGCAGG - Intergenic
1034267553 7:149788591-149788613 GCGGCCCCACTCACAGGGGCAGG - Intergenic
1034431449 7:151043288-151043310 GTCACACCACCCTCAGAGGCAGG + Intronic
1034992245 7:155555230-155555252 GGGGCCGCACCCTCAGGGGCTGG + Intergenic
1035404140 7:158587444-158587466 GAGGCGCCACCCTGAGGGGTCGG - Intronic
1036691317 8:10946526-10946548 GACACGCCACCCCCAGGGGTGGG - Intronic
1037677496 8:21064341-21064363 GACCCAACACCCTCAGGAGCCGG - Intergenic
1042466638 8:69135881-69135903 GAAGCCCCATCCTTAGGGGAAGG - Intergenic
1046416630 8:113923608-113923630 AAGGCCCCACCCTCATGGGTGGG + Intergenic
1048484096 8:134831800-134831822 GACGCCCGACCCTGAGGGACGGG + Intergenic
1049281715 8:141752904-141752926 CGTGCCCCACCCTCAGGGGAAGG - Intergenic
1049747722 8:144270059-144270081 GAACCCCCAACCTCAGTGGCCGG + Intronic
1049769212 8:144372104-144372126 CCCGCCACACCCTCGGGGGCAGG + Intergenic
1052852617 9:33387129-33387151 GAAGCCCCAACCTCAGAGGAGGG + Intronic
1053680717 9:40483680-40483702 GAAGCCCCAACCTCAGAGGAGGG + Intergenic
1053930702 9:43111992-43112014 GAAGCCCCAACCTCAGAGGAGGG + Intergenic
1054282996 9:63141255-63141277 GAAGCCCCAACCTCAGAGGAGGG - Intergenic
1054293799 9:63319195-63319217 GAAGCCCCAACCTCAGAGGAGGG + Intergenic
1054503904 9:65892644-65892666 GAAGCCCCAACCTCAGAGGAGGG - Intronic
1055404576 9:75961214-75961236 GATGCACCAGCCCCAGGGGCTGG - Intronic
1058833721 9:108842069-108842091 ACCTGCCCACCCTCAGGGGCTGG + Intergenic
1060031937 9:120222081-120222103 CACGCCCCCTCGTCAGGGGCAGG + Intergenic
1060407782 9:123381408-123381430 CATCCCCCACCCTCAGGGCCCGG + Exonic
1186514532 X:10156779-10156801 GACGCCCCACCCTCAGGGGCTGG - Intergenic
1187533600 X:20117623-20117645 GACGCCCCACCCTCAGCGTGCGG + Intergenic
1191048941 X:56169956-56169978 GTCACCCCACCCTCAGTTGCAGG + Intergenic
1192147895 X:68693989-68694011 GACCCCCCAATCCCAGGGGCGGG - Intronic
1192244650 X:69362409-69362431 GGCAGCCCAGCCTCAGGGGCTGG + Intergenic
1193203166 X:78715820-78715842 GAGGCCCCATCCCCAGGGGAAGG + Intergenic
1194205200 X:91003211-91003233 GGAGCCCCACCCTCCCGGGCGGG - Intergenic
1200238835 X:154483150-154483172 GAGGCCCCTCCCTGAGGGGCAGG + Intergenic
1200551018 Y:4578332-4578354 GGAGCCCCACCCTCCTGGGCGGG - Intergenic