ID: 1186514533

View in Genome Browser
Species Human (GRCh38)
Location X:10156783-10156805
Sequence ACAGGACGCCCCACCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514533_1186514547 20 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514533_1186514539 -8 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514533_1186514548 24 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514533_1186514549 27 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514533_1186514546 19 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514533_1186514538 -9 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514533_1186514544 17 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514533_1186514545 18 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514533_1186514542 2 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514533 Original CRISPR ACAGGACGCCCCACCCTCAG GGG (reversed) Intergenic