ID: 1186514533

View in Genome Browser
Species Human (GRCh38)
Location X:10156783-10156805
Sequence ACAGGACGCCCCACCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 163}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514533_1186514544 17 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514533_1186514538 -9 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514533_1186514549 27 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514533_1186514546 19 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514533_1186514548 24 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514533_1186514539 -8 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514533_1186514545 18 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514533_1186514547 20 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514533_1186514542 2 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514533 Original CRISPR ACAGGACGCCCCACCCTCAG GGG (reversed) Intergenic
900099715 1:956563-956585 ACAGTCCGTCCCACCCACAGCGG + Intronic
900440095 1:2650530-2650552 ACAGCACCCTCCACCCCCAGGGG + Intronic
900645479 1:3706897-3706919 AAAGGCCGCTCCACGCTCAGGGG - Intronic
901131502 1:6964318-6964340 CCAGGACGCTGCACCCTCCGGGG - Intronic
902036334 1:13460917-13460939 AGAGAACGCCTCAACCTCAGGGG - Intergenic
902555151 1:17242567-17242589 ACAGGATGACCCACAGTCAGGGG - Intronic
906248203 1:44291893-44291915 ACCGCATGCCCCACCATCAGGGG - Intronic
906557052 1:46722161-46722183 GCAGGAGGCCCCACTCTGAGTGG - Intergenic
906614463 1:47225236-47225258 ACAGAAGGCCCCTCCCTCACTGG + Intronic
918171850 1:182004815-182004837 TCAGGAAGCCCCACCCCTAGGGG + Intergenic
919861224 1:201740456-201740478 CCAGGACCCCCGACCCTCACAGG - Intronic
922896045 1:229101210-229101232 ACAGGCCACCCCAGCCTGAGGGG - Intergenic
924550761 1:245074448-245074470 TCCTGAAGCCCCACCCTCAGAGG + Intronic
1064662914 10:17624179-17624201 TCAGGACACCTTACCCTCAGTGG - Intergenic
1066026473 10:31363766-31363788 ACAGGACGCAGGACCCTCTGTGG + Intronic
1066570773 10:36769450-36769472 ACAGGGTGCCCCACTGTCAGAGG + Intergenic
1073741741 10:106415164-106415186 TCAGGAAGCCCCATCCTTAGCGG + Intergenic
1075728181 10:124621221-124621243 CCAGGACCCCCCACGCCCAGTGG + Exonic
1076264415 10:129098691-129098713 ACAGGACCTCCCGCCCTCAAGGG + Intergenic
1077095907 11:799031-799053 ACAGGAGGCCCCAGGCACAGTGG + Exonic
1077184117 11:1228834-1228856 CCAGGCCTCCCCACCCCCAGTGG - Intronic
1079415850 11:20235728-20235750 TCAGGAAGCCCCACCCCTAGGGG + Intergenic
1084519650 11:69655545-69655567 CCCGGAGCCCCCACCCTCAGGGG - Intronic
1084677961 11:70647749-70647771 ACAGGACCCCCTTCCCTCTGCGG + Intronic
1088687688 11:112298527-112298549 AGAGGAAGACCCACCCTCAACGG - Intergenic
1091822029 12:3482666-3482688 AAAGGACACCCCAGCCCCAGAGG - Intronic
1093604423 12:21073267-21073289 TCAGGAAGCCCCACCCCTAGGGG - Intronic
1096193834 12:49636168-49636190 TCAGGACACCCCTCCCTCTGGGG + Intronic
1098436312 12:70471732-70471754 ACAGGATGCCCAATACTCAGAGG + Intergenic
1102045533 12:109828006-109828028 CCAGGCCACTCCACCCTCAGGGG + Intronic
1102933011 12:116876762-116876784 CCAGGCCTCCCCAGCCTCAGAGG + Intronic
1104568686 12:129906508-129906530 ACAGGAGGCCCCATCTTTAGAGG - Intergenic
1106392168 13:29345874-29345896 TCAGGAAGCCCCACCCCTAGGGG - Intronic
1108594115 13:51935763-51935785 CCGGGCTGCCCCACCCTCAGCGG + Intronic
1108882802 13:55142044-55142066 AGAGGAAGACCCACCCTCACTGG + Intergenic
1110232568 13:73182154-73182176 GCAGGAGTCCCCAACCTCAGGGG - Intergenic
1111360938 13:87175437-87175459 TCATGAGGCCCCAACCTCAGAGG - Intergenic
1113506509 13:110820798-110820820 GCAGGAGCCACCACCCTCAGAGG - Intergenic
1113806282 13:113111409-113111431 ACAGGACACCTCACACTCACAGG + Intronic
1113806297 13:113111531-113111553 ACAGGACACCTCACACTCACAGG + Intronic
1113806401 13:113112238-113112260 ACAGGACACCTCACACTCATAGG + Intronic
1113806408 13:113112310-113112332 ACAGGACACCTCACACTCACAGG + Intronic
1113806412 13:113112346-113112368 ACAGGACACCTCACTCTCACAGG + Intronic
1113806468 13:113112747-113112769 ACAGGACACCTCACACTCATAGG + Intronic
1113806475 13:113112819-113112841 ACAGGACACCTCACACTCACAGG + Intronic
1113848069 13:113403670-113403692 CCAGGAAGCCGCCCCCTCAGGGG - Intergenic
1115604024 14:34982581-34982603 AGAGACCGCCCCACCCTCCGCGG + Intronic
1116104444 14:40483279-40483301 ACAAGACTTCCCACCATCAGTGG - Intergenic
1118140125 14:63071832-63071854 TCAGGAAGCCCCATCCTTAGGGG - Intronic
1118778359 14:68988744-68988766 GCAGGACTCTCCACCCTGAGAGG - Intergenic
1119102354 14:71891598-71891620 ACAGGCCCACCCACCCTCAAGGG + Intergenic
1121463476 14:94099550-94099572 ACAGGAGGACCCTCCCTGAGAGG + Intronic
1122501376 14:102202245-102202267 ACAGGAGGCCAGAGCCTCAGAGG - Intronic
1122982889 14:105199527-105199549 GCATGACACCCCAGCCTCAGGGG + Intergenic
1123039676 14:105485385-105485407 CCACGATGCCCCACACTCAGTGG + Intergenic
1123130132 14:105978811-105978833 ACAGCACGCCCTACCGACAGTGG - Intergenic
1125605669 15:40938481-40938503 ACAGGAGGCCCTGCCCTCATTGG - Exonic
1125641167 15:41231539-41231561 CCAGGACCCCCCAACCTCACAGG - Intronic
1129065070 15:72895692-72895714 ACAGGAGTCACCACACTCAGGGG + Intergenic
1132029228 15:98427067-98427089 ACAGGGTGCCCCATCCTCCGGGG - Intergenic
1133769047 16:8857074-8857096 ACAGGGCTCCCCAGCCTCATGGG + Intronic
1133867122 16:9654686-9654708 ACAGGACTGACCACCCTCGGAGG - Intergenic
1138026820 16:53528609-53528631 ACAGGAAGCACCAACCACAGGGG + Intergenic
1140873029 16:79124147-79124169 ACAGGAAGCTTCACCCTCTGGGG - Intronic
1142280222 16:89144188-89144210 TCCCGACTCCCCACCCTCAGTGG + Intronic
1142412787 16:89924701-89924723 ACTGGGCCTCCCACCCTCAGAGG - Intronic
1145167422 17:20625130-20625152 TCAGGAAGCCCCATCCTTAGGGG + Intergenic
1146255599 17:31390323-31390345 AGAGGAAGCCCCACCCAGAGGGG - Intergenic
1147359207 17:39920757-39920779 ACAGGTCACCCCAGCCTCTGGGG + Intergenic
1148125631 17:45235189-45235211 ACAGGTCACCCTGCCCTCAGGGG + Intronic
1149497319 17:57127511-57127533 ACAGAACCCTCCACCCCCAGAGG + Intergenic
1151284429 17:73099731-73099753 ACAGGCTGCCCCAGGCTCAGAGG - Intergenic
1152177990 17:78800413-78800435 ACAGCACTCACCACCCTCATCGG + Intronic
1152264650 17:79287309-79287331 ATAGCACTCCCCACCCACAGGGG + Intronic
1152421862 17:80197972-80197994 ACAGGACGCCCCATCAGCAGTGG + Intronic
1152421876 17:80198039-80198061 ACAGGACGCCCCATCAGCAGTGG + Intronic
1152604600 17:81282836-81282858 AGAGGACACCCCCGCCTCAGTGG + Intronic
1152681668 17:81671660-81671682 AGAGGCCGCCCCACCCACAAGGG - Intronic
1152890575 17:82879459-82879481 ACAGAGCGTCCCACCCTGAGTGG - Intronic
1156326749 18:36080370-36080392 ACAGGAAGCCCCATCCCTAGAGG + Intergenic
1156748260 18:40418923-40418945 ATAGGACACCCCACCCCCACCGG + Intergenic
1158615098 18:58979846-58979868 ACAGGCTGCCCCACCTTCAGTGG - Intronic
1161562363 19:4980760-4980782 ACAGGACACCCCCCGCACAGGGG - Intronic
1161988129 19:7669032-7669054 CCAGGAAGCCCCACCCCAAGAGG + Exonic
1163426016 19:17241469-17241491 ACAGGTGGCCCCACCCTGAGAGG + Intronic
1166596630 19:44055998-44056020 ACAGGTCACCAGACCCTCAGTGG - Intronic
1168176996 19:54633474-54633496 CCAGGCCTGCCCACCCTCAGTGG + Intronic
1168414088 19:56158120-56158142 ACAAGTCACCCCACACTCAGGGG + Intronic
925116394 2:1382120-1382142 ACTGCACAGCCCACCCTCAGAGG + Intronic
931695282 2:64866291-64866313 TCAGGATGCCCCGCCCGCAGTGG + Intergenic
932336841 2:70936371-70936393 ACAGCACACCCCACTCTCAGGGG - Intronic
932409159 2:71535040-71535062 AGAAGACGGCCAACCCTCAGTGG + Exonic
938216510 2:129522400-129522422 TCAGGAAACCCCACCCACAGGGG - Intergenic
940630407 2:156230639-156230661 TCAGGAAGCCCCATCCCCAGGGG + Intergenic
945748428 2:213748859-213748881 CCACCACGCCCCACCCTGAGAGG - Intronic
948510628 2:238461891-238461913 ACAGCACCTCCCACCCGCAGAGG + Intergenic
948884864 2:240877469-240877491 GCAGGAAGCCCCGCCCTCTGTGG - Intronic
1172225996 20:33305748-33305770 GGAGGATGCCCCATCCTCAGGGG - Intronic
1176148114 20:63574363-63574385 AGAGGACGCCCCTCCCTGAAGGG + Intergenic
1178878992 21:36433739-36433761 ACAGGAAGGCCCAGCCACAGAGG + Intergenic
1182486215 22:30640663-30640685 CCAGGCCTCCCCACCCTGAGTGG - Intronic
1184021330 22:41823705-41823727 ACAGGACGCCCTCCCATCACAGG + Intronic
1184698283 22:46151357-46151379 CCTGGGCGCCCGACCCTCAGCGG - Intronic
1185012437 22:48322078-48322100 CCAGGACGCTCCACCCTTTGGGG - Intergenic
1185095758 22:48805115-48805137 ACAGGCTGCCCCTCCCTGAGAGG - Intronic
1185126605 22:49014683-49014705 AGAGGACAGCCGACCCTCAGAGG - Intergenic
1185418821 22:50723844-50723866 TCAGGAGACCCCAGCCTCAGGGG - Intergenic
950632367 3:14291013-14291035 ACAGTCCACCCCACCCTCTGGGG + Intergenic
951153691 3:19323721-19323743 TCAGGAAGCCCCATCCTTAGGGG - Intronic
952984796 3:38769778-38769800 TCAGGAAGCCCCATCCCCAGGGG - Intronic
954807995 3:53231410-53231432 ACAGGAGGACGCACCCTCAGTGG - Exonic
956403409 3:68903837-68903859 TCAGGACTCTCCATCCTCAGAGG + Intronic
956898052 3:73683948-73683970 AGAGGAAGACCCACCCTCAGTGG - Intergenic
962191948 3:133319797-133319819 ACAGGAAGCCCCATCCCTAGGGG + Intronic
963078061 3:141366702-141366724 ACCTGACACCCCACCCACAGTGG + Intronic
965185023 3:165451976-165451998 ACAGGAAGCCCCATCTTTAGTGG + Intergenic
967313264 3:188126625-188126647 ACAGCAAGCCCCATTCTCAGTGG + Intergenic
969311844 4:6357517-6357539 ACAGAAAGCCCCACGCACAGTGG + Intronic
969607414 4:8209524-8209546 ACAAGCTGCCCCACACTCAGAGG - Intronic
969624800 4:8297018-8297040 ACAGGGTTCCCCAGCCTCAGAGG + Intronic
975269852 4:72418895-72418917 TCACGAGGCCCCAACCTCAGGGG + Intronic
982177241 4:152717574-152717596 ACAGCTTCCCCCACCCTCAGTGG + Intronic
984661612 4:182381065-182381087 AGAGCACACCCCTCCCTCAGGGG - Intronic
984844504 4:184098257-184098279 ACAGGACAGCCCCCACTCAGAGG - Intronic
987901982 5:24023888-24023910 ACAGGAAGCCCCATCCCTAGGGG + Intronic
990918504 5:60936995-60937017 TCAGGAAGCCCCAACCTTAGGGG - Intronic
996631934 5:125643198-125643220 ACAGGAAGCCCCATCCCTAGGGG + Intergenic
997438295 5:133890975-133890997 CCAGGAAGCACCAGCCTCAGTGG + Intergenic
997605026 5:135168724-135168746 ACTGTACACCTCACCCTCAGAGG - Intronic
1003035473 6:2637425-2637447 GCAGGACTCCACAGCCTCAGGGG + Intergenic
1004230741 6:13831026-13831048 ACACCACACCCCACCCCCAGGGG + Intergenic
1007766362 6:44162602-44162624 AAAGTGCACCCCACCCTCAGGGG + Intronic
1010407332 6:75520025-75520047 AGAGGTCGCCCCATCCCCAGTGG - Intergenic
1015644132 6:135368069-135368091 TCAGGAAGCCCCATCCTTAGGGG - Intronic
1017544768 6:155438791-155438813 ACAGGACCCTCCATGCTCAGCGG + Intronic
1019462023 7:1164899-1164921 AGAGGAAGATCCACCCTCAGTGG - Intergenic
1021611128 7:22459097-22459119 ACAGGAGTCCCCACCCTCCATGG - Intronic
1025295510 7:57772770-57772792 GCAGAACCCCCCAGCCTCAGGGG + Intergenic
1026458761 7:70595525-70595547 ACAGAGAGCTCCACCCTCAGGGG - Intronic
1028782955 7:94757843-94757865 TCAGGAAGCCCCATCCTTAGGGG + Intergenic
1032448840 7:132009406-132009428 ACAGGAAGCCCCATTCCCAGAGG - Intergenic
1032791932 7:135248732-135248754 TCCTGAGGCCCCACCCTCAGAGG - Intronic
1035302666 7:157907480-157907502 CCAGGACACCCCACACGCAGGGG - Intronic
1035302712 7:157907646-157907668 CCAGGACACCCCACACGCAGGGG - Intronic
1036691319 8:10946530-10946552 GCAGGACACGCCACCCCCAGGGG - Intronic
1040111465 8:43568795-43568817 ACAGGAGGCCCGGCCTTCAGGGG - Intergenic
1042466639 8:69135885-69135907 TCAGGAAGCCCCATCCTTAGGGG - Intergenic
1042928442 8:73990371-73990393 GCAGGAGGCCCCATCCTCTGGGG + Intergenic
1042950628 8:74197898-74197920 ACAGGAAGCTCCTCCCTCTGGGG - Intergenic
1043425750 8:80147038-80147060 ACAAGACCTCACACCCTCAGAGG - Intronic
1049425354 8:142535657-142535679 CCAGGAGGCCCCAGCCTCATGGG - Intronic
1049747721 8:144270055-144270077 ACATGAACCCCCAACCTCAGTGG + Intronic
1055496769 9:76862437-76862459 ACAGGACGCCACAAGGTCAGAGG - Intronic
1056126121 9:83537921-83537943 ATAAGGCCCCCCACCCTCAGAGG + Intronic
1060214207 9:121728654-121728676 GCAGGCCTCCCCACCCTCACTGG - Intronic
1061022438 9:128024993-128025015 TCAGGAAGCCCCTCCCTCATTGG - Intergenic
1061765560 9:132878918-132878940 ACGGGCCTCCCCACCCTCCGGGG + Exonic
1062027369 9:134346785-134346807 CCAGGAGGACCCTCCCTCAGAGG - Intronic
1062603716 9:137333012-137333034 AGAGGCAGACCCACCCTCAGTGG + Intronic
1062681692 9:137785397-137785419 TCAGCACGGCCCACCCTCACGGG - Intronic
1062681700 9:137785421-137785443 TCAGCACACCCCACCCTCAGGGG - Intronic
1062681707 9:137785445-137785467 TCAGCACGGCCCACCCTCACGGG - Intronic
1185636791 X:1558924-1558946 ACAGGACGGCCCCACCGCAGAGG + Intergenic
1186514533 X:10156783-10156805 ACAGGACGCCCCACCCTCAGGGG - Intergenic
1187167382 X:16816954-16816976 CCAGGAGGCCCCACCCCCAATGG + Intronic
1188476437 X:30597671-30597693 ACAGGAAAACCCTCCCTCAGTGG + Intergenic
1193203165 X:78715816-78715838 TCAGGAGGCCCCATCCCCAGGGG + Intergenic
1193954563 X:87844033-87844055 TCAGGAAGCCCCATCCCCAGAGG - Intergenic
1197556681 X:127964199-127964221 TCAGGAAGCCCCACCCCTAGAGG - Intergenic
1199779384 X:151044372-151044394 AGTGGAAGCCCCACCCCCAGAGG - Intergenic
1200287212 X:154834770-154834792 ACAGGGCCCCACACCCTGAGGGG + Intergenic
1200428977 Y:3055047-3055069 TCAGGAAGCCCCATCCTTAGGGG - Intergenic