ID: 1186514534

View in Genome Browser
Species Human (GRCh38)
Location X:10156784-10156806
Sequence GACAGGACGCCCCACCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514534_1186514545 17 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514534_1186514547 19 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514534_1186514542 1 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40
1186514534_1186514546 18 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514534_1186514539 -9 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514534_1186514548 23 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514534_1186514538 -10 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514534_1186514549 26 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514534_1186514544 16 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514534 Original CRISPR GACAGGACGCCCCACCCTCA GGG (reversed) Intergenic
900645480 1:3706898-3706920 GAAAGGCCGCTCCACGCTCAGGG - Intronic
900794356 1:4699026-4699048 GACAGGAGGCCACGCCCCCAGGG - Intronic
902306448 1:15543254-15543276 AACAGTACTCCCCACACTCAGGG - Intronic
902864387 1:19268807-19268829 GAGAGGACACCCGCCCCTCAGGG - Intergenic
902869622 1:19306253-19306275 GAGAGGACACCCGCCCCTCAGGG - Intronic
903215600 1:21841895-21841917 GTCTGGACGCCCCACATTCATGG - Intronic
903660103 1:24971758-24971780 GGAAGGGAGCCCCACCCTCAGGG + Intergenic
903900984 1:26645213-26645235 GGCAGGGCGCTCCACCCTCCAGG - Intergenic
903935154 1:26890323-26890345 GAGAGGAAGTCCCGCCCTCACGG + Intergenic
904310582 1:29626909-29626931 GAGAGAAGGCCCCACCCGCACGG - Intergenic
910429186 1:87144448-87144470 GAGAGGAAGACCCACCCTCGTGG + Intronic
915525256 1:156472189-156472211 CCCAGGCCACCCCACCCTCAGGG + Intronic
915939528 1:160109933-160109955 GACAGGACAACCTACCCTCTTGG + Intergenic
923215594 1:231845443-231845465 GCCAGGTCTCCCCACCTTCAAGG - Intronic
1067915732 10:50396196-50396218 GACTGGGAGCCCCACCCTGAGGG - Intronic
1068648863 10:59499639-59499661 GAGAGGAAGGCCCGCCCTCAAGG + Intergenic
1069163494 10:65119293-65119315 GAGAGGAAGACCCACCTTCAGGG + Intergenic
1076264414 10:129098690-129098712 AACAGGACCTCCCGCCCTCAAGG + Intergenic
1076829348 10:132986220-132986242 GACAGGCCAACCCTCCCTCAGGG - Intergenic
1079083424 11:17429322-17429344 GACAAGCCATCCCACCCTCAAGG + Intronic
1079144913 11:17842122-17842144 GACATGATCCCTCACCCTCAAGG - Intronic
1079335101 11:19564239-19564261 CAGAGAGCGCCCCACCCTCAAGG - Intronic
1088543794 11:110939939-110939961 GACAGCACTTCCCAGCCTCATGG - Intergenic
1088698606 11:112391748-112391770 GGCAAGATGCCCTACCCTCATGG - Intergenic
1090351359 11:126110528-126110550 GCCAGGTCACCCCAGCCTCAGGG - Intergenic
1096345502 12:50842807-50842829 GAAAGAACCCCTCACCCTCAAGG - Intergenic
1103708865 12:122896115-122896137 GACCGGAAGCGCCGCCCTCAAGG + Exonic
1107753687 13:43596890-43596912 TACAGCATGCCCCACCCTCATGG + Intronic
1107972083 13:45653142-45653164 GAAAGGAAGACCCACCTTCAAGG - Intergenic
1108938953 13:55924968-55924990 GACTGGACACTCCATCCTCATGG - Intergenic
1112142484 13:96660843-96660865 GAGAGGAAGACCCACCTTCAGGG + Intronic
1113784355 13:112994692-112994714 GGGAGGATGCCCCACCCTCGGGG - Intronic
1113806348 13:113111888-113111910 CACAGGACACCTCACACTCAGGG + Intronic
1113806361 13:113111970-113111992 CACAGGACACCTCACACTCAGGG + Intronic
1113851756 13:113421833-113421855 CAGAGGAAGCCCCAGCCTCAGGG - Intergenic
1118140126 14:63071833-63071855 GTCAGGAAGCCCCATCCTTAGGG - Intronic
1119074441 14:71621694-71621716 GACAGAAGCCCCCACCCTCCTGG - Intronic
1119102353 14:71891597-71891619 CACAGGCCCACCCACCCTCAAGG + Intergenic
1119173076 14:72549408-72549430 GCCAGGACGCCCCACGCACATGG - Intronic
1121236789 14:92397528-92397550 GACAGGATGCCCCCTCCTCCAGG - Intronic
1121641106 14:95485497-95485519 GACAGGACGCCCTAACCTACAGG + Intergenic
1121842000 14:97142345-97142367 GGCAGGGAGCCCCAACCTCAGGG - Intergenic
1123902155 15:24887882-24887904 GAGAGGACCCCCCAGGCTCATGG + Intronic
1124414846 15:29466520-29466542 GAGAGGACGCTGCACCCCCAAGG + Intronic
1129704238 15:77785413-77785435 GACAGGACTGCCCACGCTCCAGG - Intronic
1131119949 15:89815706-89815728 GACAGGGAGCCCCACCCTGGCGG - Intergenic
1133769046 16:8857073-8857095 AACAGGGCTCCCCAGCCTCATGG + Intronic
1133812160 16:9169020-9169042 GACAGAGCGCCCCACCCGGAAGG - Intergenic
1134009342 16:10839486-10839508 GACAGATGGCCCCACCCACAGGG - Intergenic
1134791055 16:16989663-16989685 GACAGAACACCCTACACTCATGG - Intergenic
1141143479 16:81513252-81513274 GGCAGGAAGCCCCACACTCTGGG - Intronic
1142063991 16:88049795-88049817 GACACGACGCCCCAGCCACACGG + Intronic
1142221003 16:88854956-88854978 GACAGGAAGCCCCGCCCACCTGG - Intronic
1148125630 17:45235188-45235210 GACAGGTCACCCTGCCCTCAGGG + Intronic
1150209437 17:63434071-63434093 GAGAGGAGGCCCCACCCTCCTGG - Exonic
1150477464 17:65486011-65486033 GTCAGGGAGCCCCACCCTCCAGG + Intergenic
1150825323 17:68469462-68469484 GACAGGAGACCCCATCCTCATGG - Intergenic
1151786101 17:76275789-76275811 GGCAGGACGCCCCACCCAGAGGG + Intronic
1152362025 17:79837214-79837236 GGCAGGGCCACCCACCCTCAAGG - Intronic
1152681669 17:81671661-81671683 CAGAGGCCGCCCCACCCACAAGG - Intronic
1155149612 18:23112544-23112566 GGAAGGAAGCCCAACCCTCATGG - Intergenic
1155550490 18:26959855-26959877 GCCAGGATCCCCCATCCTCAAGG - Intronic
1159269549 18:66130922-66130944 GAGAGAAAGACCCACCCTCAAGG + Intergenic
1160981325 19:1817889-1817911 GACAGGAGGCCTCAGCCTCTTGG + Intronic
1161207338 19:3047868-3047890 GACAGAAAGCCCCGCCCTCCTGG - Intergenic
1162761654 19:12892051-12892073 CACAGGAAGCCCCAGCCCCAAGG - Intronic
1163374389 19:16921505-16921527 CACAGCACACCCCAGCCTCAAGG + Intronic
1167245634 19:48371457-48371479 GATAGGAGCCCCCGCCCTCAAGG + Intronic
1168341248 19:55624342-55624364 CACAAGAAGCCCCACCCCCAGGG + Intronic
1168414087 19:56158119-56158141 GACAAGTCACCCCACACTCAGGG + Intronic
925857146 2:8140256-8140278 GAGAGGAATCCCAACCCTCAAGG + Intergenic
926840467 2:17074230-17074252 TTCAGGAGGCCCCACCCTCAAGG - Intergenic
932336842 2:70936372-70936394 CACAGCACACCCCACTCTCAGGG - Intronic
933730030 2:85449397-85449419 CACAGGAGGCCTCACCCCCAGGG - Intergenic
933990323 2:87629047-87629069 GACAGGACAACCCAGCCTCCCGG + Intergenic
936170716 2:110170601-110170623 GACATGATTCCCCATCCTCAAGG + Intronic
936303523 2:111321777-111321799 GACAGGACAACCCAGCCTCCCGG - Intergenic
941802249 2:169672743-169672765 GAGAAGAAGACCCACCCTCAAGG - Intronic
1175024937 20:55891735-55891757 GACAGCACTCACTACCCTCATGG - Intergenic
1176116191 20:63432665-63432687 CAGAGAAGGCCCCACCCTCAGGG + Intronic
1176148113 20:63574362-63574384 CAGAGGACGCCCCTCCCTGAAGG + Intergenic
1177411860 21:20739569-20739591 AACAGGAAGTCACACCCTCAGGG + Intergenic
1178909152 21:36660291-36660313 GGCAGGAGGCCTTACCCTCAGGG + Intergenic
1179473363 21:41626987-41627009 GACAGGACACCCTTCCATCAAGG - Intergenic
1180691844 22:17723240-17723262 GACAGCTTGCCCCAGCCTCAGGG - Intronic
1181045960 22:20214356-20214378 GAGAGGACACCCCGCCCCCATGG - Intergenic
1181681455 22:24498525-24498547 GAGAGGCCGCTCCACCCTCCAGG - Intronic
1184103949 22:42356650-42356672 GACAGGAGGCCTTGCCCTCAAGG + Intergenic
1184309772 22:43633745-43633767 GACAGGGCGCCCCAAGCTCGTGG + Intronic
1185418822 22:50723845-50723867 GTCAGGAGACCCCAGCCTCAGGG - Intergenic
953574087 3:44098913-44098935 GCCAGGACGCACCTCCCCCAGGG + Intergenic
953716617 3:45321482-45321504 GACACGAGGTCCCACCCCCAGGG - Intergenic
954003770 3:47577463-47577485 GGCAGCACACCCGACCCTCAAGG - Exonic
957878780 3:86183572-86183594 GACAGGACACCCATCCCCCAAGG + Intergenic
961137919 3:124529135-124529157 GACAAGAATCCCTACCCTCATGG - Intronic
961630681 3:128296254-128296276 GACAGGAAGCCCCATCCTGCTGG - Intronic
962320465 3:134385922-134385944 GACAGGGAGCGCCACCATCAAGG - Intergenic
967766979 3:193291771-193291793 GTCAGGATGCCTCACCCTCTTGG - Intronic
970088499 4:12374946-12374968 GAGAGGCAGACCCACCCTCAAGG - Intergenic
971923399 4:32972999-32973021 GACAGAAAGACCCACCTTCAAGG - Intergenic
972682396 4:41318907-41318929 GACAGGCCACTCCACCTTCAAGG - Intergenic
973613464 4:52658452-52658474 CACAGCCCGCCCCACCCTTAGGG + Intronic
974868184 4:67605336-67605358 GACTAGGGGCCCCACCCTCAGGG + Intronic
982017317 4:151167837-151167859 GCCAGGCCGCCCCACCGTCTGGG + Intronic
984750032 4:183263350-183263372 GACAGGACTCCCAGACCTCAGGG - Intronic
992190406 5:74286030-74286052 GACAGGGAGCCACTCCCTCAAGG + Intergenic
997817875 5:137035589-137035611 GACTGGAAGCCCCACCCTGAGGG - Intronic
997895510 5:137712501-137712523 GACAGGCTTCCCCACCCCCAGGG - Intronic
1001318988 5:170664682-170664704 GACAAGGCGCCCTGCCCTCAAGG + Intronic
1004455997 6:15791983-15792005 TGCAGGACGCCCCACCCTGGAGG + Intergenic
1006432723 6:34007766-34007788 GAAAGGCCCCACCACCCTCATGG - Intergenic
1007210759 6:40191953-40191975 GAGACGCAGCCCCACCCTCAGGG + Intergenic
1007885727 6:45227674-45227696 GACAGGACACCCAACCCACCAGG + Intronic
1015733457 6:136372225-136372247 GAGTGGACGCCCTACCCTCCTGG - Intronic
1019431376 7:1001353-1001375 CACAGGACTCCCCACCCACAGGG - Intronic
1019431435 7:1001559-1001581 CACAGGACTCCCCACCCACAGGG - Intronic
1019431519 7:1001827-1001849 CACAGGACTCCCCACCCACAGGG - Intronic
1019431667 7:1002337-1002359 CACAGGACTCCCCACCCACAGGG - Intronic
1019589563 7:1824028-1824050 TGCAGGACACCCCATCCTCATGG - Intronic
1020283589 7:6663917-6663939 GGCAGGAGGCTCCACCCACATGG - Intergenic
1020329457 7:7002851-7002873 GGAAGGAAGACCCACCCTCAAGG - Intergenic
1020978139 7:15033347-15033369 GAAAGGCAGACCCACCCTCAAGG + Intergenic
1022129430 7:27390805-27390827 AACAGAACTCCCTACCCTCATGG - Intergenic
1028790684 7:94849840-94849862 GCCTGGCCGCCCCACCCTCTGGG - Intergenic
1037281493 8:17247002-17247024 AACAGGAGGTCCCACCTTCACGG - Exonic
1039923557 8:41909377-41909399 GACAAGACTCCCTACCCTCCTGG - Intergenic
1040111466 8:43568796-43568818 GACAGGAGGCCCGGCCTTCAGGG - Intergenic
1040356208 8:46620872-46620894 GGAAGGAAGACCCACCCTCAAGG - Intergenic
1041829935 8:62143154-62143176 CACAGCAACCCCCACCCTCAAGG + Intergenic
1045111204 8:98940615-98940637 GACAGGCTGCCCCACTCCCACGG - Intronic
1049425356 8:142535658-142535680 CCCAGGAGGCCCCAGCCTCATGG - Intronic
1050724435 9:8631378-8631400 GACAGTAAGCCCAACCATCAAGG - Intronic
1051615342 9:19000441-19000463 GCCAGGCCGCCCCACCGTCTGGG + Intronic
1057262259 9:93591676-93591698 GCCAGGACACCCCACCCACATGG - Intronic
1061073262 9:128325168-128325190 CACAGGACACCGCACCCTGAAGG + Exonic
1061268575 9:129523103-129523125 CACACAAGGCCCCACCCTCATGG + Intergenic
1062000893 9:134215198-134215220 GCCAGGAGCCCCCACCCACAAGG + Intergenic
1062356825 9:136169005-136169027 GACAAGCTGCCCGACCCTCATGG - Intergenic
1062681693 9:137785398-137785420 CTCAGCACGGCCCACCCTCACGG - Intronic
1062681701 9:137785422-137785444 CTCAGCACACCCCACCCTCAGGG - Intronic
1062681708 9:137785446-137785468 CTCAGCACGGCCCACCCTCACGG - Intronic
1186514534 X:10156784-10156806 GACAGGACGCCCCACCCTCAGGG - Intergenic