ID: 1186514535

View in Genome Browser
Species Human (GRCh38)
Location X:10156785-10156807
Sequence AGACAGGACGCCCCACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 193}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514535_1186514545 16 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514535_1186514539 -10 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514539 X:10156798-10156820 CGTCCTGTCTCCGGGACGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1186514535_1186514547 18 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514535_1186514544 15 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514535_1186514549 25 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514535_1186514546 17 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514535_1186514548 22 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514535_1186514542 0 Left 1186514535 X:10156785-10156807 CCTGAGGGTGGGGCGTCCTGTCT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1186514542 X:10156808-10156830 CCGGGACGCCGGGTTTTCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514535 Original CRISPR AGACAGGACGCCCCACCCTC AGG (reversed) Intergenic
900112572 1:1014739-1014761 AGACAGCTCTCCCCACCCTTTGG + Intergenic
900624213 1:3600801-3600823 ACACAGGACGCCCATCCCCCCGG + Intronic
901131506 1:6964320-6964342 ACCCAGGACGCTGCACCCTCCGG - Intronic
901481346 1:9527385-9527407 GGAGAGGAAGACCCACCCTCAGG - Intergenic
902306449 1:15543255-15543277 AAACAGTACTCCCCACACTCAGG - Intronic
902579498 1:17399224-17399246 GGACAGGAAGACCCACCCTGAGG - Intronic
902864388 1:19268808-19268830 AGAGAGGACACCCGCCCCTCAGG - Intergenic
902869623 1:19306254-19306276 AGAGAGGACACCCGCCCCTCAGG - Intronic
903660102 1:24971757-24971779 AGGAAGGGAGCCCCACCCTCAGG + Intergenic
905491174 1:38345012-38345034 AGAAAGGAACCCCCAGCCTCGGG + Intergenic
905764964 1:40592740-40592762 GGAGAGGAAGACCCACCCTCAGG + Intergenic
906511629 1:46413389-46413411 AGGCAGGACTCCCCACCCCCAGG - Intronic
907440546 1:54475679-54475701 AGACAGGAAGCCCCTGCCTCGGG - Intergenic
907962809 1:59298452-59298474 AGACATGGCTCTCCACCCTCTGG - Intronic
910290863 1:85599139-85599161 AGACAGGACACCACATCATCTGG + Intergenic
911696110 1:100892196-100892218 GGACAGGAAGACCCACTCTCAGG + Intronic
913063964 1:115232616-115232638 AGACAGCTCTCCCCACCCTGAGG - Intergenic
915080626 1:153349430-153349452 AGGGAGGCTGCCCCACCCTCCGG - Intergenic
915660754 1:157403305-157403327 AGAAAGGAGGCTCCGCCCTCAGG - Intergenic
922268295 1:224008957-224008979 AGACCGAACACCCCACCCTTTGG - Intergenic
1062830018 10:599193-599215 AGACAGCACCCCACATCCTCTGG + Intronic
1062860527 10:806122-806144 AGATGGGACCACCCACCCTCCGG - Intergenic
1062901129 10:1147749-1147771 AGAAAGCACTCCCCACCCACAGG - Intergenic
1064584165 10:16822969-16822991 AGACAGGGCTCCCCACGCCCTGG + Intergenic
1067719056 10:48713104-48713126 AGACAAGACCCCACACCCTAGGG - Intronic
1069492277 10:68871275-68871297 AGACAGGTGGCCCCACCCGGGGG - Intronic
1069823027 10:71239306-71239328 AGAGGTGACGCCCCACCCCCAGG + Intronic
1071561438 10:86649381-86649403 AGACAGGGCTCCCTGCCCTCTGG - Intergenic
1071576924 10:86734073-86734095 AGGCAGGACCTCCCACCTTCAGG + Exonic
1076569011 10:131420221-131420243 AGAGGGGCCGCCCCAACCTCAGG + Intergenic
1077127120 11:945267-945289 AGACAGGAGGTCCTACCATCTGG - Intronic
1078551114 11:12281188-12281210 TGACAGGAAGCCTCGCCCTCAGG + Intronic
1081052456 11:38361564-38361586 AAACAGGAAGACCTACCCTCAGG + Intergenic
1082788109 11:57328465-57328487 AGACAGGACCCCACGGCCTCAGG + Intronic
1087430029 11:98041706-98041728 AGAGAGGAAGACCCACCCTCAGG - Intergenic
1087578506 11:100022050-100022072 GGAGAGGAAGACCCACCCTCAGG - Intronic
1089130730 11:116209900-116209922 AGGCAGGACTACCCACCCCCAGG + Intergenic
1090416242 11:126542536-126542558 AGAGAGGGAGCCCCACCCTTGGG - Intronic
1093340616 12:17968627-17968649 AATCAGGGCTCCCCACCCTCTGG + Intergenic
1094523237 12:31215118-31215140 GGAGAGGAAGACCCACCCTCAGG - Intergenic
1095472636 12:42553083-42553105 AGACAGGGGTCCCCACCCCCAGG - Intronic
1096922859 12:55107671-55107693 GGAGAGGAAGACCCACCCTCAGG + Intergenic
1106027453 13:25968494-25968516 AGACAGGCCGCTCCCCTCTCAGG - Intronic
1113784356 13:112994693-112994715 CGGGAGGATGCCCCACCCTCGGG - Intronic
1113806360 13:113111969-113111991 ACACAGGACACCTCACACTCAGG + Intronic
1114216033 14:20658439-20658461 GGACAGGAAGCCACACCCACGGG + Intergenic
1117007912 14:51441164-51441186 AGAGAGGAGGTCCCGCCCTCTGG - Intergenic
1119357794 14:74021305-74021327 AGCCACGATGCCCCACCCACCGG - Intronic
1121776158 14:96592592-96592614 AGACAGGACTCCCCCCGCCCGGG + Intergenic
1121842001 14:97142346-97142368 AGGCAGGGAGCCCCAACCTCAGG - Intergenic
1122202800 14:100132786-100132808 AAGCAGCCCGCCCCACCCTCAGG + Intronic
1128720368 15:69943389-69943411 AGACAGGGCGGGCCACCCTTGGG + Intergenic
1134028967 16:10976763-10976785 AGACATGACACCCCTCCCCCAGG - Intronic
1137745702 16:50818600-50818622 AGACAGGACTCCTCTCCCTGAGG - Intergenic
1138488672 16:57363436-57363458 AGCAAGGATGCCACACCCTCGGG - Intronic
1139535905 16:67573552-67573574 AGAGAGAACTTCCCACCCTCAGG - Intronic
1140658677 16:77166209-77166231 GGAGAGGAAGGCCCACCCTCAGG - Intergenic
1141143480 16:81513253-81513275 TGGCAGGAAGCCCCACACTCTGG - Intronic
1141292090 16:82727780-82727802 AGACAGGCAGCCCCAACCTATGG + Intronic
1142305282 16:89281030-89281052 AGACAGGGCGCCCCTGCCCCCGG - Exonic
1142406959 16:89895489-89895511 AGCCACCACGCCCCGCCCTCTGG + Intronic
1143583471 17:7839472-7839494 AGACAGTCAACCCCACCCTCTGG - Intergenic
1145184246 17:20780533-20780555 AAACAGAACCCCCCACCCCCTGG - Intergenic
1148125629 17:45235187-45235209 AGACAGGTCACCCTGCCCTCAGG + Intronic
1148753533 17:49959920-49959942 AGTCAGGAGGCTCCACCCTGTGG - Intergenic
1150599277 17:66636561-66636583 AAACAGGACTCCCTATCCTCTGG - Intronic
1151786100 17:76275788-76275810 TGGCAGGACGCCCCACCCAGAGG + Intronic
1152614019 17:81329727-81329749 AGACAGGAAACCCCACCCCAGGG + Intronic
1157441441 18:47714920-47714942 AGGGAGGAGCCCCCACCCTCTGG + Intergenic
1158037414 18:53050223-53050245 GGAGAGGAAGACCCACCCTCAGG - Intronic
1160753259 19:745213-745235 AGACAGGACCACCCACCCTGGGG - Intronic
1161627082 19:5333542-5333564 ACACAGGACCCCCCACCCCAAGG - Intronic
1163372760 19:16911104-16911126 AGACAGGGGTCCCCAACCTCCGG + Intronic
1164630037 19:29756004-29756026 AGAGAGGGAGCCCCACCATCGGG - Intergenic
1164765106 19:30758616-30758638 GGAGAGGAAGACCCACCCTCAGG - Intergenic
1167463405 19:49638177-49638199 GGAGAGGCTGCCCCACCCTCGGG + Intronic
1168352957 19:55686897-55686919 AGCCAGGATGTCCCACCCTCAGG - Intronic
925131596 2:1497498-1497520 TGACAGGAAGCCCCAGCCTCAGG - Intronic
926102955 2:10132268-10132290 AGAGGGGAGGCCCCTCCCTCTGG + Intergenic
929574773 2:43044476-43044498 AGACAGGAGGCCCCAAGCTCGGG - Intergenic
930724974 2:54673875-54673897 ACACAGGATGCCCCACCCTGTGG - Intergenic
933354681 2:81196754-81196776 AGACAGGGCGCCCCTGCCCCCGG - Intergenic
939773005 2:146347501-146347523 AGTCAGAATGCCCCAGCCTCTGG - Intergenic
946147725 2:217743539-217743561 AGACAGGAAGCCCCTGACTCTGG - Intronic
946523557 2:220493367-220493389 AGAAAGAACACCCCACTCTCAGG + Intergenic
947564050 2:231182539-231182561 AGACTGGATTCCCCACCGTCTGG - Intergenic
948097329 2:235346881-235346903 AGTCATGAGGCTCCACCCTCAGG + Intergenic
1169640047 20:7741516-7741538 AGACAGGGGTCCCCAACCTCTGG - Intergenic
1173736857 20:45367964-45367986 AGACAAGAAGCCCAACCTTCTGG + Exonic
1174041252 20:47701260-47701282 AGTCATGACCCCCCACCCTGGGG - Intronic
1174299498 20:49571215-49571237 TGACAGGACATCCAACCCTCTGG + Intergenic
1174437505 20:50520950-50520972 AGAAAGATCACCCCACCCTCTGG - Intronic
1175267860 20:57713485-57713507 AGAGAGGAGGCCCAACCCTTTGG - Intergenic
1175593333 20:60211230-60211252 AGGCAGGACGCTCAACCCTGTGG - Intergenic
1176102527 20:63370936-63370958 TGACAGAACTCTCCACCCTCCGG - Intronic
1176116190 20:63432664-63432686 ACAGAGAAGGCCCCACCCTCAGG + Intronic
1177375778 21:20269531-20269553 AGCCACCACGCCCCAGCCTCAGG + Intergenic
1178909151 21:36660290-36660312 AGGCAGGAGGCCTTACCCTCAGG + Intergenic
1179552325 21:42151118-42151140 AGACAGGACCCCACACACCCAGG + Intergenic
1180897249 22:19345712-19345734 AGACAGGGGTCCCCAACCTCTGG - Intronic
1181406705 22:22690120-22690142 AGAGAGGACGCCTGACCCTGAGG - Intergenic
1183379787 22:37485218-37485240 AGGCAGGCCTCCCCAACCTCCGG + Intronic
1185012441 22:48322080-48322102 ACCCAGGACGCTCCACCCTTTGG - Intergenic
949361603 3:3238036-3238058 AGACAGGGATCCCCACCCCCTGG + Intergenic
954304155 3:49716758-49716780 CCACAGGACGGCACACCCTCCGG - Intronic
954945333 3:54419209-54419231 ACACAGGACACCCCATCCTGTGG - Intronic
955821617 3:62901944-62901966 AGAGAGGATGACCCATCCTCAGG + Intergenic
957743343 3:84304282-84304304 GGAGAGGAAGACCCACCCTCAGG + Intergenic
958636152 3:96750129-96750151 AGGCAGGACCCCCATCCCTCTGG + Intergenic
960588773 3:119345563-119345585 AAACAGGAGGCCCCATCCCCAGG - Intronic
962750887 3:138434241-138434263 AGCCAGGCCTCCCCAGCCTCAGG - Intergenic
964613945 3:158642589-158642611 ACACAGGAGTCCCCAACCTCTGG - Intergenic
968662530 4:1804724-1804746 AGTCAGAACGCCCCCCCTTCTGG + Intronic
974989517 4:69067476-69067498 ATAAAGGAAGCCCCACCCTAGGG - Intronic
982017316 4:151167836-151167858 TGCCAGGCCGCCCCACCGTCTGG + Intronic
984750033 4:183263351-183263373 AGACAGGACTCCCAGACCTCAGG - Intronic
997297419 5:132776914-132776936 AGGCAGGCCGCCCGACGCTCCGG + Intronic
997817876 5:137035590-137035612 AGACTGGAAGCCCCACCCTGAGG - Intronic
997895511 5:137712502-137712524 AGACAGGCTTCCCCACCCCCAGG - Intronic
998737126 5:145155057-145155079 GGAGAGGAAGACCCACCCTCAGG + Intergenic
1002433857 5:179219776-179219798 AGACAGGAGGCCCCAGCCCTGGG - Intronic
1002870791 6:1165864-1165886 AGTCAGGAGGCCCACCCCTCTGG + Intergenic
1004885802 6:20050534-20050556 AGTCAGGATGCACCACCCCCAGG + Intergenic
1005501142 6:26430257-26430279 AGACAGTAAGCAGCACCCTCAGG - Intergenic
1006342174 6:33452841-33452863 ACACAGGTCCCCCCACCCTGGGG - Exonic
1006865764 6:37207948-37207970 AGACAGCACACTCCAGCCTCGGG - Intergenic
1007192344 6:40030351-40030373 AGAGAGGCAGACCCACCCTCAGG + Intergenic
1007210758 6:40191952-40191974 AGAGACGCAGCCCCACCCTCAGG + Intergenic
1013823196 6:114180079-114180101 AGAGAGGAAGACCCACCTTCAGG - Intronic
1016224268 6:141715534-141715556 GGAGAGGAAGACCCACCCTCAGG - Intergenic
1019431377 7:1001354-1001376 CCACAGGACTCCCCACCCACAGG - Intronic
1019431387 7:1001388-1001410 CCACAGGACTCCCCACCCACAGG - Intronic
1019431407 7:1001456-1001478 CCACAGGACTCCCCACCCACAGG - Intronic
1019431425 7:1001526-1001548 CCACAGGACTCCCCACCCACAGG - Intronic
1019431436 7:1001560-1001582 CCACAGGACTCCCCACCCACAGG - Intronic
1019431448 7:1001594-1001616 CGGCAGGACCCCCCACCCGCAGG - Intronic
1019431460 7:1001626-1001648 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431480 7:1001694-1001716 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431490 7:1001728-1001750 CCACAGGACTCCCCACCCACAGG - Intronic
1019431504 7:1001780-1001802 CCACAGGACTCCCCACCCACAGG - Intronic
1019431520 7:1001828-1001850 CCACAGGACTCCCCACCCACAGG - Intronic
1019431530 7:1001862-1001884 CCACAGGACTCCCCACCCACAGG - Intronic
1019431552 7:1001928-1001950 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431566 7:1001980-1002002 CCACAGGACTCCCCACCCACAGG - Intronic
1019431576 7:1002014-1002036 CCACAGGACTCCCCACCCACAGG - Intronic
1019431586 7:1002048-1002070 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431625 7:1002184-1002206 CCACAGGACTCCCCACCCACAGG - Intronic
1019431652 7:1002290-1002312 CCACAGGACTCCCCACCCACAGG - Intronic
1019431668 7:1002338-1002360 CCACAGGACTCCCCACCCACAGG - Intronic
1019431678 7:1002372-1002394 CCACAGGACTCCCCACCCACAGG - Intronic
1019431694 7:1002422-1002444 CCACAGGACTCCCCACCCACAGG - Intronic
1019431708 7:1002474-1002496 CCACAGGACTCCCCACCCACAGG - Intronic
1019431718 7:1002508-1002530 CCACAGGACTCCCCACCCACAGG - Intronic
1019431747 7:1002614-1002636 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431781 7:1002736-1002758 CCACAGGACTCCCCACCCACAGG - Intronic
1019431801 7:1002803-1002825 CCACAGGACTCCCCACCCACAGG - Intronic
1019431811 7:1002837-1002859 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431852 7:1002990-1003012 CCACAGGACTCCCCACCCACAGG - Intronic
1019431862 7:1003024-1003046 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431872 7:1003058-1003080 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431886 7:1003110-1003132 CCACAGGACTCCCCACCCACAGG - Intronic
1019431896 7:1003144-1003166 CCACAGGACTCCCCACCCACAGG - Intronic
1019431906 7:1003178-1003200 CCACAGGACTCCCCACCCGCAGG - Intronic
1019431920 7:1003230-1003252 CCACAGGACTCCCCACCCACAGG - Intronic
1019431946 7:1003336-1003358 CCACAGGACTCCCCACCCACAGG - Intronic
1019431952 7:1003352-1003374 CCACAGGACTCCCCACCCACAGG - Intronic
1019431966 7:1003404-1003426 CCACAGGACTCCCCACCCACAGG - Intronic
1019431990 7:1003490-1003512 CCACAGGACTCCCCACCCACAGG - Intronic
1019432010 7:1003557-1003579 CCACAGGACTCCCCACCCACAGG - Intronic
1019432016 7:1003573-1003595 CCACAGGACTCCCCACCCACAGG - Intronic
1019432026 7:1003607-1003629 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432036 7:1003641-1003663 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432045 7:1003675-1003697 CCACAGGACTCCCCACCCACAGG - Intronic
1019432055 7:1003709-1003731 CCACAGGACTCCCCACCCGCAGG - Intronic
1019432083 7:1003810-1003832 CCACAGGACTCCCCACCCACAGG - Intronic
1019432101 7:1003878-1003900 CCACAGGACTCCCCACCCACAGG - Intronic
1019432115 7:1003930-1003952 CCACAGGACTCCCCACCCACAGG - Intronic
1019432129 7:1003982-1004004 CCACAGGACTCCCCACCCACAGG - Intronic
1019494290 7:1330479-1330501 AGCCAGCAGGCCCCAGCCTCGGG - Intergenic
1019984005 7:4642026-4642048 AGACCGGCCCCGCCACCCTCGGG + Intergenic
1020101242 7:5395325-5395347 AGACAGCAGGCCCCACCCCGGGG + Intronic
1027338795 7:77183182-77183204 AAACAGGGCTTCCCACCCTCAGG + Intronic
1028790685 7:94849841-94849863 TGCCTGGCCGCCCCACCCTCTGG - Intergenic
1029956546 7:104646038-104646060 AGACATGAGGCTTCACCCTCAGG + Intronic
1034971825 7:155424078-155424100 ACACAGGATGCCCCAGCCCCGGG + Intergenic
1035661702 8:1352890-1352912 AGACCGGAGGCCCCATTCTCAGG - Intergenic
1035755236 8:2026062-2026084 AGCCAGGAAGCCACAGCCTCCGG - Intergenic
1042928440 8:73990369-73990391 AAGCAGGAGGCCCCATCCTCTGG + Intergenic
1043098004 8:75999992-76000014 AGACAAGAAGCCCCAACCCCAGG - Intergenic
1045436194 8:102167371-102167393 AGAAAAGAAGACCCACCCTCTGG + Intergenic
1046737286 8:117790577-117790599 AGCCACCACGCCCCACCCTGTGG - Intergenic
1048395482 8:134010418-134010440 AGAGAGCAGGCCCCAGCCTCTGG - Intergenic
1048895094 8:138985138-138985160 GGAGAGGAGGACCCACCCTCAGG + Intergenic
1049578892 8:143401831-143401853 AGCCAGGATGCCCCGCCCGCTGG - Intergenic
1049744622 8:144258003-144258025 ACACACTACGCCCCACCCACTGG + Intronic
1051615341 9:19000440-19000462 TGCCAGGCCGCCCCACCGTCTGG + Intronic
1056957653 9:91095559-91095581 AGACAGGGCTCCCTGCCCTCTGG - Intergenic
1059246940 9:112856757-112856779 AGACACGAGGCCCCACTCTCCGG - Intronic
1060833830 9:126739819-126739841 GGACAGGATGCCCCATTCTCTGG - Intergenic
1203783238 EBV:112775-112797 AGACAGGTGGGCTCACCCTCTGG + Intergenic
1186514535 X:10156785-10156807 AGACAGGACGCCCCACCCTCAGG - Intergenic
1186586010 X:10873919-10873941 AGAAAGGACGCCCCTCTCTCAGG + Intergenic
1189007204 X:37008981-37009003 AGACAGGACACCCGAGTCTCGGG - Exonic
1189167031 X:38870508-38870530 AGCCAGGACAGCCCATCCTCAGG + Intergenic
1195123986 X:101786757-101786779 GGAGAGGAAGACCCACCCTCAGG - Intergenic