ID: 1186514538

View in Genome Browser
Species Human (GRCh38)
Location X:10156797-10156819
Sequence GCGTCCTGTCTCCGGGACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514532_1186514538 -5 Left 1186514532 X:10156779-10156801 CCAGCCCCTGAGGGTGGGGCGTC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514531_1186514538 -4 Left 1186514531 X:10156778-10156800 CCCAGCCCCTGAGGGTGGGGCGT 0: 1
1: 0
2: 2
3: 15
4: 211
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514526_1186514538 4 Left 1186514526 X:10156770-10156792 CCGTGCAGCCCAGCCCCTGAGGG 0: 1
1: 3
2: 10
3: 82
4: 532
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514533_1186514538 -9 Left 1186514533 X:10156783-10156805 CCCCTGAGGGTGGGGCGTCCTGT 0: 1
1: 0
2: 0
3: 8
4: 163
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514534_1186514538 -10 Left 1186514534 X:10156784-10156806 CCCTGAGGGTGGGGCGTCCTGTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79
1186514524_1186514538 18 Left 1186514524 X:10156756-10156778 CCGGTCACAGAATTCCGTGCAGC No data
Right 1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514538 Original CRISPR GCGTCCTGTCTCCGGGACGC CGG Intergenic
903284857 1:22270171-22270193 GGGTCCTCTATCCGGGATGCTGG + Intergenic
906495741 1:46302893-46302915 GCGGCCTGGCTCGGGGGCGCGGG - Intronic
908474012 1:64470823-64470845 GCGTGCTGGCTCCTGGGCGCCGG + Exonic
918044801 1:180935410-180935432 GCTCCCCGGCTCCGGGACGCGGG + Exonic
922851199 1:228735448-228735470 GCGTCGTGTCGCCGGGAAGCCGG + Exonic
1063904096 10:10765352-10765374 GAGTTCTGTCTGCGGGAAGCTGG + Intergenic
1064602282 10:17006085-17006107 GTGTGCTGTCTCCTGGAGGCTGG - Intronic
1067349985 10:45466740-45466762 GTGTCCTGGGTCCGGGAGGCAGG + Intronic
1071342803 10:84664277-84664299 GCTTCCTGTCTCCTGGAAGAAGG - Intergenic
1073136926 10:101225369-101225391 GGGTCCCGCCTCCGGGCCGCTGG - Intergenic
1075629923 10:123994728-123994750 GCAGCCTGTCTCCGGAAGGCCGG + Intergenic
1075793754 10:125104189-125104211 CCGTCCTTTCTCCAGGCCGCTGG - Intronic
1077360242 11:2137596-2137618 GCGGCCTCTCTCCGGGTCGAAGG + Intronic
1077517807 11:3012410-3012432 GCGTCCAGGCTCTGGGATGCCGG - Intronic
1079277657 11:19056699-19056721 GTGTCATGTCTCCTGGAGGCAGG + Intronic
1081566333 11:44263408-44263430 GCTTCCTGCCTCCAGGAAGCGGG - Exonic
1084556591 11:69879559-69879581 GGGTCCTGGCCCCGGGAAGCTGG - Intergenic
1089464897 11:118678760-118678782 CTGTCCTGTCTCCTGGACTCAGG - Intronic
1089466951 11:118691662-118691684 CTGTCCTGTCTCCTGGACTCAGG - Intergenic
1095049540 12:37543916-37543938 GCGTCCGGGCTCCGAGACTCTGG + Intergenic
1102221026 12:111194584-111194606 GCCTCCTGTAGCAGGGACGCTGG + Intronic
1105277339 13:18943748-18943770 GCGTCCTGTACCCGTGACCCAGG + Intergenic
1105277451 13:18944183-18944205 GCGTCCTGTCCCCGTGTCCCGGG + Intergenic
1111520751 13:89400571-89400593 GAGTGCTGTCTCCAGGAAGCGGG + Intergenic
1113696052 13:112346301-112346323 GCGTCCTCTCTCTGGGGAGCTGG - Intergenic
1121439251 14:93938571-93938593 GTGTCCTGCCTCTGGGTCGCTGG + Intronic
1124962236 15:34407583-34407605 GCATCCTATCTCCAGGAAGCAGG - Intronic
1124978859 15:34553804-34553826 GCATCCTATCTCCAGGAAGCAGG - Intronic
1126106144 15:45148209-45148231 GTGTCCTGTGTCTGGGTCGCAGG + Intronic
1126348230 15:47718315-47718337 GCGCCCCTTCTCCAGGACGCAGG - Intronic
1128724736 15:69980039-69980061 GCCGCCTGGCTCCAGGACGCAGG + Intergenic
1132639252 16:970374-970396 GCGTCCTGGCTGCGGGGCGGGGG - Intronic
1132655439 16:1040154-1040176 GCGACCTGTGCCCGGGACCCGGG + Intergenic
1136724901 16:32349312-32349334 GTCGGCTGTCTCCGGGACGCAGG - Intergenic
1136843225 16:33555352-33555374 TCTGGCTGTCTCCGGGACGCAGG - Intergenic
1203001529 16_KI270728v1_random:168443-168465 GTCGGCTGTCTCCGGGACGCAGG + Intergenic
1203133132 16_KI270728v1_random:1704849-1704871 GTCGGCTGTCTCCGGGACGCAGG + Intergenic
1203153390 16_KI270728v1_random:1855650-1855672 TCTGGCTGTCTCCGGGACGCAGG - Intergenic
1147585444 17:41651659-41651681 GGGTCCTGGCTCCGCGACGAGGG + Intergenic
1151438735 17:74114698-74114720 GCCACCTGTCTCCGGGGAGCGGG + Intergenic
1151618746 17:75232000-75232022 GCCTACTGTCTGTGGGACGCAGG + Intronic
1155385779 18:25275770-25275792 GCTTCCTGTCTCCGTGGCGTAGG - Intronic
1160149837 18:76390651-76390673 GCCTCCTGCCTGCGGGACCCGGG - Intronic
1161149994 19:2702580-2702602 CAGTCCCCTCTCCGGGACGCCGG + Intronic
1162664652 19:12200046-12200068 GAGTGCTGTCTCCAGGACACAGG + Intergenic
1163051803 19:14690029-14690051 GCTTCCGGTCTCGGGGCCGCCGG - Intronic
948147268 2:235716981-235717003 GGGTCCTGTGTCTGGGAGGCAGG + Intronic
948932123 2:241138615-241138637 GCCTCATGTCTCATGGACGCTGG - Intronic
1173000955 20:39105300-39105322 GAGTCCTGTCTGTGGGACACAGG + Intergenic
1173221721 20:41137359-41137381 GCGGCCTGTCTGGGGGTCGCGGG + Intronic
1179661530 21:42879097-42879119 GCTTCCGGTCTCCGCGGCGCCGG - Intronic
1180309524 22:11158331-11158353 TCTGGCTGTCTCCGGGACGCAGG + Intergenic
1180548001 22:16520141-16520163 TCTGGCTGTCTCCGGGACGCAGG + Intergenic
1182211451 22:28680221-28680243 TCTGGCTGTCTCCGGGACGCAGG - Intergenic
1185315701 22:50178321-50178343 CCCTCCTGGCTCCGGGAGGCGGG - Exonic
1185388369 22:50546832-50546854 GCGTCCTCTCGCCAGGCCGCAGG + Intergenic
952929274 3:38346986-38347008 GCGGGCTGTCACCCGGACGCGGG + Intronic
959850774 3:111083830-111083852 ACCTGCTGTCTCCTGGACGCTGG + Intronic
967858152 3:194133996-194134018 GCGCCAGGCCTCCGGGACGCGGG + Intergenic
968498448 4:931984-932006 GAGTGTTGTCTCCGGGACGCTGG - Intronic
972581911 4:40402769-40402791 GCATCCTGCCTCAGGGACCCAGG + Intergenic
980075842 4:128291871-128291893 TTGTCCTGTCTCCGAGACCCTGG - Intergenic
980975515 4:139606675-139606697 CCGTCCTAGCTCCTGGACGCTGG - Intronic
983229063 4:165112216-165112238 GCGACAGGTCTGCGGGACGCTGG + Intronic
985684376 5:1274039-1274061 ACATCCTGTCTTGGGGACGCAGG - Intronic
985702999 5:1384798-1384820 GGGTCCTGTCGCCAGGACACTGG - Intergenic
986600494 5:9467791-9467813 GCGTCCTGCCTGCGGGAGGCTGG + Intronic
988856219 5:35230187-35230209 GCGGCCGCTCTCCGGGATGCGGG - Intronic
1001959559 5:175872006-175872028 CGGTCCTGGCTCCGGGACCCCGG - Intronic
1023789028 7:43737432-43737454 GCCTCCTGGCTCCAGGAAGCAGG + Intergenic
1035334053 7:158114276-158114298 GCCTCCTGACTCCGAAACGCTGG - Intronic
1035625770 8:1069330-1069352 GCGACCTGTCCACGGGCCGCAGG - Intergenic
1036203432 8:6787905-6787927 GCATCCTGTCTCCCGGCCACGGG - Intergenic
1039474644 8:37833287-37833309 GAGCCCTATCTCCGGGCCGCTGG + Intronic
1040106931 8:43546712-43546734 GCATCCTGTCTCCGTCACCCGGG + Intergenic
1040107040 8:43547146-43547168 GCGTCCTGTCCCCGTCACCCAGG + Intergenic
1044698852 8:94949030-94949052 GCGCCCTGCCTTCGGGGCGCCGG - Intronic
1044971639 8:97625696-97625718 GCTTCCCCTCTCCGTGACGCAGG + Intergenic
1046929517 8:119828193-119828215 GCCTCCTGTCTCTGTGACCCTGG + Intronic
1049850288 8:144827049-144827071 GCCTCCTGTCGCAGGGACGCGGG + Intergenic
1059402305 9:114077995-114078017 GCGGCCTGTCTCGGGGTCTCAGG - Intronic
1061961659 9:133991943-133991965 GCGGCCGGGCTCCGGGACGCGGG - Intronic
1062040528 9:134402334-134402356 GCGTCCCCTCTCAGGGATGCCGG + Intronic
1186514538 X:10156797-10156819 GCGTCCTGTCTCCGGGACGCCGG + Intergenic
1186933999 X:14427117-14427139 GTGTCCAGTCTCCGGGTCGCGGG + Intergenic
1201188765 Y:11429486-11429508 TCTGGCTGTCTCCGGGACGCAGG + Intergenic