ID: 1186514540

View in Genome Browser
Species Human (GRCh38)
Location X:10156801-10156823
Sequence AAACCCGGCGTCCCGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186514540_1186514548 6 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514548 X:10156830-10156852 GACACGAATGCTCCGGGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 46
1186514540_1186514551 22 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514551 X:10156846-10156868 GGGTAGGAGGCGAATGACACTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1186514540_1186514544 -1 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514544 X:10156823-10156845 TTCTCTGGACACGAATGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 97
1186514540_1186514547 2 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 37
1186514540_1186514553 30 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG 0: 1
1: 0
2: 0
3: 2
4: 59
1186514540_1186514546 1 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG 0: 1
1: 0
2: 2
3: 5
4: 59
1186514540_1186514545 0 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514545 X:10156824-10156846 TCTCTGGACACGAATGCTCCGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1186514540_1186514549 9 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514549 X:10156833-10156855 ACGAATGCTCCGGGGGTAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 51
1186514540_1186514552 27 Left 1186514540 X:10156801-10156823 CCTGTCTCCGGGACGCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1186514552 X:10156851-10156873 GGAGGCGAATGACACTGGCACGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186514540 Original CRISPR AAACCCGGCGTCCCGGAGAC AGG (reversed) Intergenic
902832911 1:19029283-19029305 AAACCCGGCACCCCGGAGATGGG + Intergenic
1063929934 10:11018390-11018412 GAGCGCGGCGTCCCGGGGACCGG + Intronic
1069590813 10:69640796-69640818 AAACCCTGCTCCCCGGGGACAGG - Intergenic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1091286960 11:134412869-134412891 GCACCCGGCGTTCCGGAGAGAGG + Intergenic
1092817753 12:12326136-12326158 AACCAAGGCATCCCGGAGACTGG + Exonic
1103649556 12:122422396-122422418 AAGCCCGGCGTCCGGGAGCGGGG - Intronic
1106558511 13:30829996-30830018 ACAGCCGGAGTCCCGGAGCCAGG - Intergenic
1107978756 13:45714381-45714403 AAACTCGGCGTCCCGGTGCAAGG - Exonic
1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG + Intergenic
1123123414 14:105928547-105928569 AAGACCGGGGTCCCGGACACGGG - Intronic
1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG + Exonic
1132309920 15:100849889-100849911 AAACCTGGTCTCCCGGAGCCAGG + Intergenic
1154322828 18:13368403-13368425 AAAGCAGGCATCCCTGAGACAGG - Intronic
1158859898 18:61581977-61581999 AAACCCAGCCTCCCGGTGCCCGG + Intergenic
1163851932 19:19669128-19669150 ACACCCGGGGTCCCGGCGGCTGG - Intronic
1164615021 19:29662629-29662651 AAACCCGGGTTCCCGCAGTCTGG + Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167894586 19:52570704-52570726 GAACTCGGCCTCCCTGAGACTGG - Exonic
927252469 2:21009241-21009263 AAACCTGGCCTACCAGAGACAGG + Exonic
940656169 2:156489951-156489973 AAACCCTGCGTCAGGGAGAGGGG - Intronic
945973526 2:216253257-216253279 AAACCCGGAGTTCAGGAGTCTGG + Intergenic
1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG + Intronic
1176193735 20:63826918-63826940 AAACCCTGCTTCCCGGAGAGTGG - Intronic
1181769053 22:25112354-25112376 ACACCTGGCTTCCCGGAGTCGGG + Intronic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1185133558 22:49055580-49055602 AACCCCAGCTTCCAGGAGACAGG - Intergenic
955023885 3:55148398-55148420 AAGCCAGGCATCCCGGAGCCTGG + Intergenic
955716620 3:61836456-61836478 AAAGCTGGCCTCCAGGAGACAGG - Intronic
961213374 3:125142110-125142132 AGACGCGGCCTCACGGAGACGGG + Intronic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
1024704085 7:51938514-51938536 AATCCTGGAGTCCTGGAGACTGG + Intergenic
1057230659 9:93319589-93319611 AAACCAAGCCTCCTGGAGACAGG - Intronic
1060934374 9:127506927-127506949 AAGCCCAGCGACCAGGAGACTGG - Exonic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic